ID: 1184769525

View in Genome Browser
Species Human (GRCh38)
Location 22:46589300-46589322
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184769510_1184769525 21 Left 1184769510 22:46589256-46589278 CCTGGGTTTGGGGGCGGCTCTGA 0: 1
1: 0
2: 2
3: 26
4: 190
Right 1184769525 22:46589300-46589322 GGGGCAGCTCTGATATGTGGGGG 0: 2
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901650464 1:10740043-10740065 GGGGCAGCTTTCCTATGGGGTGG - Intronic
903849602 1:26297913-26297935 GGGGCCGGTCTGAGAGGTGGAGG - Intronic
904222270 1:28981806-28981828 TGGGCAACTGTAATATGTGGTGG + Intronic
905238250 1:36565239-36565261 GGGGCAGCTCTGGGAACTGGCGG + Intergenic
913485993 1:119333301-119333323 GGGTAAGCCCTGACATGTGGAGG - Intergenic
915733937 1:158072766-158072788 TGGACAGTTCTGACATGTGGTGG + Intronic
916189808 1:162167649-162167671 GGGGCAGCCCTGCTATCTGAGGG + Intronic
916673598 1:167046790-167046812 GGGGCAGCTGGGAAGTGTGGGGG + Intergenic
919881643 1:201904878-201904900 GAAGCAGCTCTGCTATGTGCCGG - Intronic
920162219 1:204007753-204007775 GGGGAGGCTGTGATGTGTGGAGG + Intergenic
921779593 1:219146714-219146736 TGAGCAGCTCTGATGAGTGGAGG - Intergenic
1062842800 10:684195-684217 GTGGCAGCACTGATATGTGTGGG - Intronic
1064377082 10:14806702-14806724 GTGGCAGCTGTGATCAGTGGAGG - Intergenic
1064581398 10:16796527-16796549 GTGGGAGCTCTGATAAGAGGGGG - Intronic
1064941387 10:20739583-20739605 GGGTGAGTTTTGATATGTGGGGG - Intergenic
1067687673 10:48476895-48476917 GGGGCAGAACTGAGAAGTGGAGG - Intronic
1069568592 10:69480184-69480206 GTGGCAGCTCTGGTGTTTGGGGG + Intronic
1070825281 10:79387104-79387126 GGGCCGGCCCTGAGATGTGGGGG - Intronic
1071259603 10:83908174-83908196 GGAGCAGCTCTGGGATGGGGGGG - Intergenic
1074855272 10:117468744-117468766 TGGGCTACTCTGATATTTGGTGG + Intergenic
1079367171 11:19819508-19819530 GGGGGAGTTCTGCTAAGTGGAGG + Intronic
1080690538 11:34553758-34553780 GGTGAAGCTATGATATTTGGTGG - Intergenic
1081041846 11:38223338-38223360 GGTCCAGCCCTGATATTTGGTGG + Intergenic
1084006206 11:66324954-66324976 GAGGAAGCTTTGATGTGTGGTGG + Intergenic
1084191054 11:67498903-67498925 GGGGGAGCTTTGACATGGGGTGG + Intronic
1088985182 11:114899499-114899521 GGTGCAACTCTGAGATGTGCTGG + Intergenic
1089927630 11:122275262-122275284 GGGGCAGTTCAGATTTGAGGAGG + Intergenic
1090770582 11:129916186-129916208 CAGGCAGCTCTCATATGAGGTGG - Intronic
1091173021 11:133535126-133535148 CGGGCAGCTCTGCAATGTTGGGG - Intergenic
1092720181 12:11433393-11433415 GGGTCATCTCAGATATCTGGTGG - Intronic
1095509717 12:42937276-42937298 GTGGCAGGTCTGTTAGGTGGTGG + Intergenic
1100134997 12:91544160-91544182 AGGGCAGATCTGATGTGTTGGGG - Intergenic
1101773970 12:107776935-107776957 GAGGCAGCTTTGGTTTGTGGGGG + Intergenic
1103291610 12:119850800-119850822 AGGGCAGCACTCATGTGTGGGGG + Intronic
1106171094 13:27289187-27289209 GGGGCAGGTCTGATAGTTAGAGG - Intergenic
1106913845 13:34490611-34490633 GGTGCAGCTAGGATGTGTGGAGG + Intergenic
1109249872 13:60006664-60006686 GGGGGAGCTCAGAGATGAGGTGG + Intronic
1119209103 14:72816549-72816571 GGGGAAGCTCAGCTAGGTGGGGG - Intronic
1119414489 14:74460430-74460452 GGGGCAGCTCTGAAATGACCAGG - Intergenic
1120210257 14:81627122-81627144 GGGGCAGCTCAAATACCTGGAGG - Intergenic
1121448058 14:93990652-93990674 GGGGCAGCTCTGACAGATTGGGG + Intergenic
1122347558 14:101069996-101070018 GGAGCAGCCCTGACATTTGGGGG - Intergenic
1122816590 14:104317002-104317024 GGGGCAGCCATGAGATGTGTGGG + Intergenic
1124593658 15:31076186-31076208 GGGGCAGCTTGGGGATGTGGAGG + Intronic
1127097494 15:55527306-55527328 CTGGCAGCTCCCATATGTGGAGG - Intergenic
1128701721 15:69809486-69809508 AGGGCAGATCTGATTTGGGGAGG - Intergenic
1130928332 15:88401762-88401784 GGGACAGCTAGGATATGTGTGGG - Intergenic
1131110653 15:89762525-89762547 GGGGCAGGTCTGAGTTCTGGGGG + Intronic
1140477267 16:75245248-75245270 GGGGCAGCTCTGTGGTGTGTAGG - Intronic
1140576869 16:76180746-76180768 GGAGAAGCAGTGATATGTGGAGG - Intergenic
1140786520 16:78347477-78347499 GGGATAGCAATGATATGTGGGGG - Intronic
1142291076 16:89193815-89193837 GGGGCATCTCTGCGAAGTGGCGG - Exonic
1143019656 17:3910579-3910601 GGGGCAGCTCTGGCATGGGTTGG + Intronic
1145028773 17:19488827-19488849 GCGGCAGCTCTGACAAGTGCTGG - Intergenic
1149563810 17:57627907-57627929 GGAGCAGCCCTGGCATGTGGCGG - Intronic
1151188457 17:72380569-72380591 GGGGCAGCTATTTTATGTTGGGG + Intergenic
1151682843 17:75630824-75630846 GGGACAGTTCTCATCTGTGGGGG + Exonic
1152309776 17:79543033-79543055 GAGGCAGCTGTGATATATAGGGG - Intergenic
1154008352 18:10554766-10554788 GGGGCAGAGCTGACCTGTGGTGG - Intergenic
1157710624 18:49847394-49847416 GGGGCATCTCTGGCAGGTGGAGG + Intronic
1157862674 18:51154851-51154873 GGGTCAGCTCTGCCATGTGGGGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160227567 18:77023212-77023234 GACGCAGCTGTGATATGTGGGGG + Intronic
1160996778 19:1885583-1885605 GGGGCGGGGCTGATATGTCGAGG + Intergenic
1161453594 19:4359706-4359728 GGGGCAGCGGTGCTGTGTGGAGG - Intronic
1162111413 19:8401889-8401911 GATCCAGCTCTGAAATGTGGGGG - Intronic
1162344166 19:10110165-10110187 GAGGCAGCTCTGTGATGTTGTGG - Exonic
1166719613 19:44989566-44989588 GGGGGAGCTCTGGGATGTGGGGG + Intronic
1167483449 19:49746613-49746635 GGGGCAGCCCTGGGACGTGGCGG + Exonic
1168019933 19:53601835-53601857 TGGGAAGTACTGATATGTGGGGG + Intronic
1168133472 19:54336082-54336104 GGAGCAGCAATGATAGGTGGAGG - Intronic
926354644 2:12030297-12030319 GTGGAAGTTCTGATTTGTGGGGG - Intergenic
926568000 2:14498956-14498978 ATGGAAGCTCTAATATGTGGTGG - Intergenic
932616519 2:73234759-73234781 GGGGCTGCTCTGAGATTTGCGGG + Intronic
933835334 2:86241123-86241145 GGGGCAGCTGCTGTATGTGGAGG - Intronic
937917995 2:127108433-127108455 GGGGCAGCACTGAGCGGTGGTGG - Intergenic
944682821 2:202092313-202092335 TGGGGAGCTCTGAGATGTGCAGG - Intronic
1169219874 20:3815888-3815910 GGGGCAGCTCAGAGGTGAGGGGG - Intergenic
1172128429 20:32639327-32639349 GGGGCAGCTTTGAAAGGTGTTGG - Intergenic
1178503534 21:33145202-33145224 GGAACAGCACTGAGATGTGGTGG - Intergenic
1179906020 21:44423783-44423805 TGGGCGGCTCTGCCATGTGGTGG + Intronic
1180058347 21:45371374-45371396 GGGGCTGCTCTGATGAGGGGTGG - Intergenic
1180108682 21:45637469-45637491 GGGGCAGCTGTGGCATGCGGTGG + Intergenic
1181942102 22:26485970-26485992 GGGGCAGCCCTGAGATGGGTGGG + Intronic
1183700856 22:39450243-39450265 GGGGCTGCCCTGAGTTGTGGTGG + Intergenic
1184706047 22:46214346-46214368 GGTGCAGATCGGAAATGTGGGGG + Intronic
1184769525 22:46589300-46589322 GGGGCAGCTCTGATATGTGGGGG + Intronic
1184769537 22:46589336-46589358 GGGGCAGCTCTGATATGTGGGGG + Intronic
1184783938 22:46662804-46662826 GGGGCAGCTCTGCTGTGTGCCGG + Intronic
1185220080 22:49624822-49624844 GAGGCAGCTGTGATAAATGGAGG - Intronic
949829712 3:8200968-8200990 GGAAAAGCTCAGATATGTGGGGG + Intergenic
953902190 3:46849678-46849700 TGGGCAGCTCTCAGATGTAGGGG - Intergenic
954245363 3:49327163-49327185 TGGGCAGCTCTGATGTTTAGAGG + Intronic
954714029 3:52518277-52518299 GGGTCAGCTCAGATTTGGGGCGG - Intronic
968130685 3:196191232-196191254 GGAGCAGCTCTGAGAGGTCGGGG + Intergenic
969660682 4:8525721-8525743 GGGGCAGCTCTGCGGTGAGGCGG + Intergenic
971287434 4:25304146-25304168 GGGACAGTTCTGGTATTTGGAGG - Intergenic
971990163 4:33882077-33882099 TGGGCAGCTCTGATATGTAAAGG - Intergenic
975098142 4:70481297-70481319 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
975098154 4:70481366-70481388 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
975098168 4:70481435-70481457 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
975098194 4:70481573-70481595 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
977386353 4:96344651-96344673 TTGGCAGCTATGATATGTGATGG - Intergenic
978005979 4:103616986-103617008 GGGTCATCTCAGATTTGTGGAGG - Intronic
979103327 4:116651147-116651169 GTGGCAGCTCTGATATCTTGGGG + Intergenic
983548638 4:168991239-168991261 GGGGAACCTATGATTTGTGGAGG + Intronic
985764236 5:1768436-1768458 GGGTCAACTCAGATGTGTGGAGG + Intergenic
986294796 5:6429106-6429128 GTGGCAGATCTGATAGGAGGTGG - Intergenic
987431962 5:17845371-17845393 CGGGCTGCTGTGATATGTTGGGG + Intergenic
991233997 5:64372989-64373011 GTGGCAACTTTGATTTGTGGTGG + Intergenic
991491170 5:67183949-67183971 GGTGAAGCACTGAAATGTGGTGG + Exonic
991703136 5:69333962-69333984 GGTGCAGCTCTCATCTGAGGGGG - Intergenic
993247192 5:85465835-85465857 GCTGCAGCTCTGATGAGTGGAGG - Intergenic
995591738 5:113706756-113706778 GGAGCAGGTGTGTTATGTGGTGG + Intergenic
997450542 5:133979195-133979217 GCTGAAGCTCAGATATGTGGGGG + Intronic
997665206 5:135625132-135625154 GGTGCAGCCCTGATAGGTGAGGG + Intergenic
1002096073 5:176831698-176831720 GGGTCAGCTCTGGGAGGTGGAGG - Intronic
1005861818 6:29907911-29907933 GGGCCAGCTCAGCTGTGTGGGGG + Intergenic
1006037174 6:31222933-31222955 GGGCCAGCTCAGCTGTGTGGTGG - Intergenic
1006429114 6:33984318-33984340 GGGGGAGTTCAGAGATGTGGAGG + Intergenic
1009628239 6:66163767-66163789 GGTCCAGCCCTGATATTTGGTGG + Intergenic
1017010885 6:150063429-150063451 GGAGAAGCTCTGAAATGGGGAGG - Intronic
1019015715 6:168878478-168878500 GGGGCAGCTTTGACCTGGGGGGG - Intergenic
1019015727 6:168878515-168878537 GGGGCAGTTCTGACCTGGGGGGG - Intergenic
1019015745 6:168878571-168878593 GGGGCAGTTCTGACCTGGGGAGG - Intergenic
1019015797 6:168878746-168878768 GGGGCAGCTCTGACCTGGGTGGG - Intergenic
1019015820 6:168878824-168878846 GGGGCAGTTCTGACCAGTGGGGG - Intergenic
1019015833 6:168878864-168878886 GGGGCAGTTCTGACCTGGGGGGG - Intergenic
1019382203 7:729624-729646 GGAGCAGCTCTGGTAACTGGGGG + Intronic
1019713371 7:2527383-2527405 TGGGCAGTTCTGCTCTGTGGAGG + Exonic
1023283529 7:38595237-38595259 GGGGGAGCTGTGATATGTGGAGG - Intronic
1023861388 7:44219514-44219536 GGCGCAGCTCTGAAATGGGGCGG + Exonic
1025265927 7:57456962-57456984 GTGGCAGCTCTGAAAGGAGGAGG - Intronic
1027797182 7:82710426-82710448 GGGGCAGCTCTGCTCTGCAGGGG - Intergenic
1028394517 7:90352647-90352669 GGGTCAGATCGGAGATGTGGAGG + Intronic
1035019854 7:155794467-155794489 GAGGCAGCTGTGAGATGGGGAGG - Intergenic
1040673345 8:49718256-49718278 GATGCAGCTCTGATGAGTGGAGG - Intergenic
1042335929 8:67630335-67630357 GGTGCAGCTTTGGGATGTGGGGG + Intronic
1045380448 8:101618896-101618918 GTGGCAACTTTGATATGTTGAGG + Intronic
1048975130 8:139667185-139667207 GGGACTGGTCTGATAGGTGGGGG - Intronic
1049363555 8:142225594-142225616 GGAGCTGCTCTGAGGTGTGGCGG - Intronic
1049615306 8:143573268-143573290 GGGGCAGCCCGGAGGTGTGGAGG + Intergenic
1051664807 9:19458579-19458601 GGAGCAGCTCAGATCTGGGGAGG + Intergenic
1055357424 9:75451743-75451765 GCTGCCTCTCTGATATGTGGAGG + Intergenic
1057666135 9:97046936-97046958 GGGGCAGCACTGGTGTGGGGAGG - Intergenic
1057733247 9:97630358-97630380 GTGGCACCTCTGCTATGTGCCGG + Intronic
1058478015 9:105360531-105360553 AAGTCAGCTCTCATATGTGGAGG + Intronic
1059398098 9:114051537-114051559 GTGGCAGGTCTGAGGTGTGGTGG - Exonic
1059571826 9:115446026-115446048 GAGGCAGATCTGAGATCTGGAGG - Intergenic
1062045178 9:134421753-134421775 GGGGCAGCTCTGAGAAGTGTGGG - Exonic
1188609552 X:32079234-32079256 GGGCCAGCTCTGTGATGTAGGGG - Intronic
1198253309 X:134903152-134903174 GTGGTATCTCTGATTTGTGGAGG + Intronic
1198609661 X:138383545-138383567 GGAACATCTCTGATATGAGGGGG + Intergenic
1199858179 X:151777291-151777313 GGGGCAGTTCTGATATCTCGTGG - Intergenic