ID: 1184769558

View in Genome Browser
Species Human (GRCh38)
Location 22:46589417-46589439
Sequence TCACGTGGCCCGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184769553_1184769558 -1 Left 1184769553 22:46589395-46589417 CCGTGGGTGTGAGGGCTGTGCCT 0: 1
1: 1
2: 1
3: 30
4: 309
Right 1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184769558 Original CRISPR TCACGTGGCCCGAGGGCAGA TGG Intronic
901125361 1:6925113-6925135 GCAGGGGGCCCAAGGGCAGAAGG + Intronic
904882969 1:33714621-33714643 TCACGTGCCTGGGGGGCAGACGG - Exonic
907836058 1:58109642-58109664 TCACGTGGGCCAAGGGCGTAAGG + Intronic
908568465 1:65383528-65383550 TCACATTGGCCAAGGGCAGAGGG + Intronic
910129389 1:83885669-83885691 TCATCTGGCCCTAGGGCAGTGGG + Intronic
910476167 1:87609693-87609715 TCACATGGCTGAAGGGCAGAAGG + Intergenic
913059695 1:115193734-115193756 TCAGGAAGCCCCAGGGCAGAAGG - Intergenic
915603842 1:156938744-156938766 ACAGGTGGCCCTTGGGCAGATGG + Intronic
916007596 1:160676266-160676288 ACACGGGGCCCCAGGTCAGAAGG + Intergenic
917802347 1:178581997-178582019 TCAAGGGGCCAGAGAGCAGATGG - Intergenic
922214566 1:223509778-223509800 TCACGTGGCTGAAGGGCAGCAGG - Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1069685168 10:70313229-70313251 TCCAGTGGCCGGAGTGCAGAAGG - Intronic
1069895992 10:71680343-71680365 TTAGGTGCCCCCAGGGCAGAAGG + Intronic
1077056169 11:594344-594366 TCTAGTGGCTCGAGGGCAGCTGG + Intronic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1083658774 11:64242452-64242474 CCACGGGGGCCGAGGGCAAAAGG + Exonic
1083879207 11:65539946-65539968 TCACGTGGCCCCCGCGCAGGTGG - Intronic
1085048521 11:73367570-73367592 TCTCGGGGCCTGGGGGCAGAGGG - Exonic
1089540611 11:119187335-119187357 TGACGTGGCCCGAGCTCAGCTGG + Exonic
1089572602 11:119420360-119420382 GCAGGTCTCCCGAGGGCAGAAGG - Exonic
1089658796 11:119972186-119972208 TCACATGGCAGAAGGGCAGAAGG - Intergenic
1090780220 11:130001665-130001687 TCGCGTGGCTGGAGGGCAGACGG + Intronic
1091020575 11:132096019-132096041 TCATGGGGCCTGGGGGCAGAGGG - Intronic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1096216711 12:49801748-49801770 TCACGTGCCCCTAGGGAAGCAGG - Intronic
1104598792 12:130138637-130138659 GCAAGCGGCCCGCGGGCAGAGGG + Intergenic
1108093892 13:46880359-46880381 TGACGCAGCCCAAGGGCAGAGGG + Intronic
1110272343 13:73604926-73604948 ACAAATGGCCCCAGGGCAGATGG + Intergenic
1113964041 13:114142441-114142463 TCAAGTGCCCTGAGGGCGGATGG - Intergenic
1115820806 14:37210730-37210752 TCATGTGGCCAGAGGTCACAAGG - Intronic
1117180057 14:53182370-53182392 TCATGTGGCCAGAGGTCACAAGG + Intergenic
1117899495 14:60517121-60517143 TCACGTGGCAGAAGGACAGAAGG - Intergenic
1120930646 14:89844824-89844846 TCATGGGGCCTGAGGCCAGAGGG - Intronic
1121020591 14:90577955-90577977 TCACATGGCCTGAAGCCAGAGGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121361949 14:93269818-93269840 TCACGTGGTAGGAGGGAAGAAGG - Intronic
1121811897 14:96898772-96898794 TCACGTGGCAGAAGGGCAAAAGG + Intronic
1122152374 14:99731994-99732016 TCTCAGGGCCAGAGGGCAGAGGG + Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1126343348 15:47667688-47667710 TCACGTGGCAGGAGGGCTTAGGG + Intronic
1127042029 15:54987835-54987857 TCATGTGGCCAGAGGTCACAAGG - Intergenic
1127771004 15:62230730-62230752 TCACGTGGATGGTGGGCAGATGG + Intergenic
1130231089 15:82097514-82097536 TCAGGGGGCCTGAGGCCAGAAGG - Intergenic
1130521202 15:84661894-84661916 GCATGTGGCCCGAGGGCCGCGGG + Intergenic
1132341796 15:101083562-101083584 TCACGTGGGTTGAAGGCAGAGGG + Intergenic
1132571322 16:645662-645684 TCACCCGACCCCAGGGCAGATGG + Intronic
1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG + Intronic
1134274777 16:12766399-12766421 TCACGTGGCTGGGAGGCAGAAGG + Intronic
1141231244 16:82169906-82169928 TCAGGAGGCCCGCGGGCGGATGG - Intronic
1141345126 16:83237955-83237977 TCACATAGCCAGAAGGCAGAGGG + Intronic
1141572441 16:84942039-84942061 TCACTCAGCCCAAGGGCAGATGG - Intergenic
1146399591 17:32492770-32492792 TCACGTGTCCCGGGCGCTGAGGG - Exonic
1147763751 17:42818888-42818910 TCATGTGGCCCGTGGGCGGGGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151326494 17:73383137-73383159 TCACGTGGCAAGAGAGCAGGAGG - Intronic
1151959834 17:77399874-77399896 TCACGTGGCCGCAGGGCAGCAGG - Intronic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1153919036 18:9772241-9772263 TCACGTGCCCCTGGGGCACAGGG - Intronic
1154338086 18:13481921-13481943 TCACAGGGCAGGAGGGCAGAGGG + Intronic
1156332715 18:36139595-36139617 TCACTTGGCCTGAATGCAGATGG - Exonic
1158401597 18:57126488-57126510 TCAGATGGCCTGAAGGCAGAAGG - Intergenic
1160403366 18:78628018-78628040 GCATGTGGCCCGAGGGCTGACGG - Intergenic
1160622248 18:80179546-80179568 TAACGTGGGCCCAGGGCAGCAGG - Intronic
1161597100 19:5156184-5156206 GCAGGTGGCCCAAGGGTAGAGGG - Intergenic
1163064124 19:14780704-14780726 TAATGCGGCTCGAGGGCAGATGG - Intergenic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1164995829 19:32720048-32720070 TCCTGGCGCCCGAGGGCAGATGG - Intronic
925308777 2:2867317-2867339 TCACTTGGCCTGAGCGCAGGAGG - Intergenic
925521030 2:4746054-4746076 TCCCTTGCCCCGAGGGGAGAGGG - Intergenic
925973078 2:9121301-9121323 TCACCTGACCTGTGGGCAGAAGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
937914178 2:127090755-127090777 TCACTTGGCCCCAAGGCAGGTGG - Intronic
938072885 2:128317725-128317747 TAAGGTGGCCCGAGGGCAGCGGG + Intronic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
947739769 2:232479792-232479814 TCACGGGTCCCCAGGGCAGGCGG - Intergenic
948285475 2:236781285-236781307 GCATGTGGCCCGAGGGCCGCAGG + Intergenic
948884014 2:240874115-240874137 TCAGGTGGCCCGAGGCGGGAGGG + Intronic
1172012580 20:31854468-31854490 TGACGTGGGCACAGGGCAGAGGG + Intronic
1175118969 20:56703688-56703710 TCAAGTGCCCCGAGGACGGATGG - Intergenic
1175252276 20:57616773-57616795 TCAGGTGTCCTCAGGGCAGAGGG + Intronic
1176284592 21:5012712-5012734 TCACGTGGGCAGGGGTCAGAGGG - Intergenic
1176306356 21:5125425-5125447 TCTCGTGGTCCGAGGCCAGTTGG + Intronic
1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG + Intronic
1179822021 21:43942577-43942599 TCATGTGGACCGAGCACAGAGGG - Intronic
1179850702 21:44136605-44136627 TCTCGTGGTCCGAGGCCAGTTGG - Intronic
1179872589 21:44250763-44250785 TCACGTGGGCAGGGGTCAGAGGG + Intronic
1181533567 22:23530532-23530554 TCAGGTGGGCTGAGGGCAGAGGG + Intergenic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
950216181 3:11161421-11161443 TCACCTGGGCCGAGGGCAAGGGG - Intronic
955525770 3:59818232-59818254 CCACGTGGGCCGAGGGGAGGTGG - Intronic
958599525 3:96277200-96277222 TCATGTGGCCCGTGGGCCGAAGG + Intergenic
968578782 4:1380177-1380199 TGCCGTGCCCCGAGGCCAGACGG + Exonic
969248804 4:5953959-5953981 GCACTTGGTCCAAGGGCAGAAGG - Intronic
972907343 4:43767497-43767519 TCACATGGCAGGAAGGCAGAGGG + Intergenic
974004753 4:56544765-56544787 CCACCTGGCCCGAGGGCGGGAGG + Intronic
974837288 4:67266235-67266257 TCAGGTGGCAGAAGGGCAGAAGG + Intergenic
985610700 5:886406-886428 GCACGTGGCCGGTGGGCAGGAGG + Intronic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
992688945 5:79224530-79224552 TCATGTGGCCAGAGGTCACAAGG - Intronic
997040202 5:130243907-130243929 TCACAAGGCTCCAGGGCAGAGGG + Intergenic
1000578827 5:163010253-163010275 TCACATGGCACAAGGGCAAAAGG + Intergenic
1001961869 5:175884429-175884451 GCACGTGGCCCGTGGGGAGTAGG - Intergenic
1002643118 5:180640040-180640062 CCCCGTGGCCCGAGGACGGAGGG - Intronic
1006841106 6:37028285-37028307 ACACGTGGCCTGGGCGCAGATGG - Exonic
1007496015 6:42260791-42260813 TCACATGGCCTGGAGGCAGATGG - Intronic
1008368603 6:50709545-50709567 GAAGGGGGCCCGAGGGCAGATGG + Intergenic
1017155045 6:151315342-151315364 TCATGTGGCAGAAGGGCAGAGGG + Intronic
1018207760 6:161451495-161451517 TCAGGTGGGCCGTGGGCAGGTGG - Intronic
1019368947 7:650796-650818 TCACGTGGCCAGCAGGCAGCAGG + Intronic
1021848575 7:24786137-24786159 TCACGTGCCCCAACAGCAGATGG - Intergenic
1025944038 7:66092768-66092790 TCACGTCGCCCGAGAACAGGGGG - Exonic
1029605890 7:101599205-101599227 TCACATGCCAAGAGGGCAGAGGG - Intergenic
1032293529 7:130613114-130613136 TCCCATGGACAGAGGGCAGAGGG + Intronic
1033410630 7:141114577-141114599 TCACCTGCCCAAAGGGCAGAAGG - Intronic
1033534292 7:142298093-142298115 TCAGGAGGACTGAGGGCAGATGG + Intergenic
1034879997 7:154756225-154756247 TCACCAGGCCCCAGGTCAGAAGG + Intronic
1035171865 7:157021554-157021576 CCGCCTGGCCCGAGGGAAGAGGG + Intergenic
1036181452 8:6588800-6588822 TGACCTGGCCCAAGGGCAGCTGG - Intronic
1036673522 8:10810016-10810038 TCACATGGCCAGATGGCAGGAGG + Intronic
1036849822 8:12193873-12193895 TCACGTGGCCGGAGCGCCGGGGG + Intronic
1036871186 8:12436146-12436168 TCACGTGGCCGGAGCGCCGGGGG + Intronic
1037772170 8:21808730-21808752 CCACGTGGCCCTAGGGCCCAAGG - Intronic
1043558149 8:81458127-81458149 TCAAGTGGGCAGAGGACAGAGGG + Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1049676788 8:143892884-143892906 ACACGTGGGCCCAGGGCAGGAGG + Intergenic
1049975550 9:858199-858221 TCATGTGGCCAGTGGGAAGAGGG + Intronic
1050168557 9:2791823-2791845 TTACGTGGCCAGAGGTCACAAGG - Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1188513355 X:30959935-30959957 TCACGTGGCTGGCGGGGAGAGGG + Intronic
1188984603 X:36758015-36758037 GCACGCTGCCTGAGGGCAGATGG - Intergenic