ID: 1184770234

View in Genome Browser
Species Human (GRCh38)
Location 22:46592683-46592705
Sequence TATGGTGACCAGCTCTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184770227_1184770234 9 Left 1184770227 22:46592651-46592673 CCCGAGAGTCTTGGAATTCTGCG 0: 1
1: 0
2: 1
3: 11
4: 83
Right 1184770234 22:46592683-46592705 TATGGTGACCAGCTCTGCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 127
1184770228_1184770234 8 Left 1184770228 22:46592652-46592674 CCGAGAGTCTTGGAATTCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1184770234 22:46592683-46592705 TATGGTGACCAGCTCTGCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184770234 Original CRISPR TATGGTGACCAGCTCTGCAA GGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902895419 1:19476478-19476500 TATGGTGACCAGGGCTGGGATGG + Intronic
902999699 1:20256321-20256343 TTTGGGGACCAGCTTTCCAAAGG + Intergenic
905858974 1:41333698-41333720 TAGAGTGACCAGCTCTTCATAGG - Intergenic
908967122 1:69778793-69778815 TTTGCTGACTAGCTCTGCCAAGG - Intronic
910614691 1:89184403-89184425 TATTGTGAACAGTGCTGCAATGG - Exonic
912709625 1:111941158-111941180 GTTGGTTACCAGCTCTGCAGAGG - Intronic
913013154 1:114705105-114705127 TATGCTCACAAGCTCTGGAATGG + Exonic
915998648 1:160591971-160591993 TATTGTGATCAGTGCTGCAATGG + Intergenic
917237313 1:172908130-172908152 TATTGTGAACAGTGCTGCAATGG + Intergenic
920840210 1:209547586-209547608 GATGCTGACCAGCTTGGCAAGGG - Intergenic
922384372 1:225067400-225067422 TATTGTGAGCAGTGCTGCAATGG + Intronic
923325417 1:232876150-232876172 CGTGGTGACCAGCTCTGCACAGG + Intergenic
1063892438 10:10644282-10644304 TTGTGTGACCAGCTCTGGAAAGG + Intergenic
1064993043 10:21273305-21273327 CTTGGAGACCAGCTCTCCAAGGG - Intergenic
1065883230 10:30055607-30055629 TGTGATGACCAACTCTGCCAAGG + Intronic
1066745777 10:38603598-38603620 TAGTGTGATCACCTCTGCAAAGG + Intergenic
1069940941 10:71954860-71954882 CATGGTGAGCAGCTATGGAAGGG + Intergenic
1070462547 10:76684282-76684304 AAGGGAGACCAGGTCTGCAATGG - Intergenic
1074549602 10:114430252-114430274 TCTGGTGGCCACCTCTCCAATGG - Intergenic
1076324097 10:129607708-129607730 CATGGTGAGCAGCTGTCCAAGGG - Intronic
1077960654 11:7073390-7073412 TTTGGTGACCAGAACTGCATGGG - Intergenic
1078055367 11:8004652-8004674 TATTCTGACCACCTCTGTAAGGG + Intergenic
1078407574 11:11083955-11083977 TATGGTGTCCAGCTCTCTAGTGG + Intergenic
1079103669 11:17557307-17557329 TCTGGTGACCAGCTCTGGTGAGG + Exonic
1080005148 11:27398762-27398784 TCTGGTAACCACCTCTGCAAAGG - Intronic
1080020655 11:27556126-27556148 TAAGGTGACCAGGTCTGCCTGGG + Intergenic
1080764248 11:35280938-35280960 CATGGTGACCAGCCCGGCACTGG + Exonic
1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG + Intergenic
1083656551 11:64232532-64232554 TATGATGACCAGCTCCGCTCAGG + Exonic
1086155521 11:83661332-83661354 TATGGAGACAAACTCTGCATAGG + Intronic
1096482906 12:51954014-51954036 TATGGAGACCACTGCTGCAAAGG + Intronic
1100664645 12:96738021-96738043 TGTGGAGACCAGGACTGCAAGGG + Intronic
1103510250 12:121468597-121468619 TCAGGTGATCAGCTCTGCAATGG + Intronic
1110517594 13:76433655-76433677 GATGGCAACCAGCTGTGCAATGG + Intergenic
1111014065 13:82353973-82353995 TATGGTGAATAGCACTGCAATGG - Intergenic
1111331175 13:86763013-86763035 TATGGTGAGCAGCTATGGAAGGG + Intergenic
1112530548 13:100198191-100198213 TATGGAGACCGGCTCTGTAAAGG - Intronic
1112711578 13:102135561-102135583 TTTGGTTAACAGCTCTGTAATGG + Intronic
1113695818 13:112344580-112344602 TCTCGTTACCAGCTCTGAAAGGG + Intergenic
1114400141 14:22402552-22402574 AATATTGACCAGCTCTGCACTGG + Intergenic
1114929907 14:27453599-27453621 TATTGAGACCAGCTCTGTCATGG + Intergenic
1117169105 14:53072635-53072657 TATGCTGAACAGCAGTGCAATGG - Exonic
1118367292 14:65106704-65106726 TTTGGTGACCAGCTCTCTGATGG + Intergenic
1122349710 14:101081608-101081630 TATTGTGAGCAGTGCTGCAATGG - Intergenic
1123915505 15:25021482-25021504 TATGGTGAGCAGTTCCCCAATGG - Intergenic
1125308738 15:38354601-38354623 TGTGGTGACCACCTCTACCAGGG + Exonic
1127460431 15:59193756-59193778 TAAGGTGACCAGCTCTTCTTTGG - Intronic
1127522663 15:59758528-59758550 TATTGTGACCAGTTCTCCAGTGG - Intergenic
1128910403 15:71508526-71508548 TTTCATTACCAGCTCTGCAAAGG + Intronic
1130941082 15:88509793-88509815 TATGGTGAGGACCTCTCCAACGG + Intergenic
1132308369 15:100835472-100835494 TATTGTGAATAGCGCTGCAATGG + Intergenic
1133280792 16:4664085-4664107 TACGGTGAGCAGCGCTGCACTGG - Intronic
1133517993 16:6528499-6528521 AATGGTGAACAGCTGGGCAAAGG + Intronic
1133957401 16:10456661-10456683 TATGGTCACTACCACTGCAATGG + Intronic
1141234520 16:82203203-82203225 TATGGCTGCCAGGTCTGCAAAGG - Intergenic
1142069301 16:88082019-88082041 TATTGTGAACAGTGCTGCAATGG - Intronic
1146627550 17:34445718-34445740 TCTGGGGAACAGCTCTGCCAGGG + Intergenic
1153094831 18:1388999-1389021 TGTTGTGACTAGCGCTGCAATGG - Intergenic
1153277854 18:3385454-3385476 CATGGTGCCCTGCTCTGCCAGGG + Intergenic
1162461900 19:10818382-10818404 CATGGGCACCAGCTCTGCAGTGG + Intronic
1163374431 19:16921705-16921727 TACGATCACCAGCTCTGCACTGG + Intronic
925850649 2:8078033-8078055 AATGGTGACCAGCCCTGAAGTGG - Intergenic
929139659 2:38655809-38655831 CATGGGAGCCAGCTCTGCAAGGG + Intergenic
929727272 2:44443785-44443807 TATGTTGTGCAGCTCTGCGAAGG + Intronic
929807708 2:45161783-45161805 TAGGGTGACCAGCCCTGAAGTGG - Intergenic
932292156 2:70590919-70590941 TATGGCTACCAGCTCTGCTCTGG - Intergenic
933628967 2:84634955-84634977 CATTGTGACCAGATCTCCAAAGG - Intronic
934115191 2:88783153-88783175 TGTGTTGACCTGCTCTCCAATGG - Intergenic
934762967 2:96866418-96866440 TACCGTGGCCAGCTCTGCAGGGG + Exonic
943099906 2:183475162-183475184 TTTGGGGACCAGCTGTCCAAGGG - Intergenic
944677117 2:202042795-202042817 TATGGGGACCAGCTTTGTCAAGG + Intergenic
944868630 2:203887123-203887145 TGTGGTGACCAGATTTGCCAAGG - Intergenic
947689324 2:232120345-232120367 CATGGTGACCAGCTCGGAAGTGG - Intronic
1170775747 20:19373318-19373340 CATGGTCACCTCCTCTGCAAAGG + Intronic
1172272421 20:33662327-33662349 AGTGGTGACCAGCCCTGCCATGG + Exonic
1172839318 20:37892703-37892725 TGAGGAGACCAGCTTTGCAAAGG + Intergenic
1174147071 20:48459432-48459454 GATGGTGACCAGCTATGAACAGG + Intergenic
1179273077 21:39866451-39866473 TCTGGTGGCCTGCTCTGCACAGG + Intergenic
1181394742 22:22613050-22613072 GATGGTGACCACCTCTCCAGTGG - Intergenic
1182383272 22:29911881-29911903 TATGGTGATAAGCTCTTTAAGGG - Intronic
1184770234 22:46592683-46592705 TATGGTGACCAGCTCTGCAAGGG + Intronic
952521079 3:34158416-34158438 TATTGTGAACAGTGCTGCAATGG + Intergenic
959116492 3:102184450-102184472 TCAGGTGAGCAGCTCTGCAGAGG + Intronic
959306762 3:104677163-104677185 TATTGTGAATAGTTCTGCAATGG - Intergenic
961467471 3:127090464-127090486 TAGGGTGAGCAGATCTGCCAGGG - Intergenic
964572384 3:158123013-158123035 TATTGTGAACAGTGCTGCAACGG + Intronic
965851916 3:173038031-173038053 TAAGGTCATCAGCTCTTCAAAGG + Intronic
968091657 3:195901756-195901778 TATGGAAACCAGCTCTGGAGAGG + Intronic
971255153 4:25007818-25007840 CATGGTCACCAGGCCTGCAAAGG + Intronic
972175185 4:36396035-36396057 TGTGATGACCAGCTCAGCATGGG + Intergenic
972716668 4:41653375-41653397 TATGGTGACCAGCTTAGAACAGG + Intronic
975935840 4:79578980-79579002 TCTGGTCTCCAGCTCTGCATAGG + Intergenic
979035283 4:115708169-115708191 TATGGTGACTCACTGTGCAAAGG - Intergenic
979250820 4:118564948-118564970 CATGGTGTCAAGCTCTGCACAGG - Intergenic
984561587 4:181276916-181276938 TATTGTGAACAGTGCTGCAATGG - Intergenic
986023753 5:3830481-3830503 TACAGTGAACAGCCCTGCAAAGG + Intergenic
986351646 5:6885649-6885671 TTTGGTGAATAGCTGTGCAAAGG + Intergenic
988023846 5:25657605-25657627 TATTGTGAATAGTTCTGCAATGG + Intergenic
991551448 5:67841314-67841336 TATGGAATCCATCTCTGCAATGG + Intergenic
994116384 5:96065834-96065856 TAAGGTGACAAGCTTTGAAAAGG - Intergenic
995464090 5:112432973-112432995 TGTGGTGACCAGCTATTCAATGG - Intergenic
995931566 5:117452698-117452720 TGTGGTCACCTGCTCTGCATGGG + Intergenic
998523749 5:142824056-142824078 TTTGGGGACCAGCTCCACAATGG + Intronic
999644425 5:153703837-153703859 GATGAAGACCAGCTCTGAAAGGG - Intronic
1000095334 5:157966577-157966599 TATGGTGTCCAGCTCTGCTATGG + Intergenic
1001847011 5:174931095-174931117 TATTGTGACTAGTGCTGCAATGG - Intergenic
1002312416 5:178322958-178322980 GATGGAGACTGGCTCTGCAAGGG - Intronic
1002432358 5:179210950-179210972 TTTGGGGAACAGGTCTGCAAGGG - Intronic
1006315749 6:33290522-33290544 TATGGAGAGCTGTTCTGCAATGG - Intronic
1006707130 6:36030195-36030217 ATTGGTGACTAGCTCTGCACTGG + Intronic
1007500221 6:42291240-42291262 CATGCTGAACAGATCTGCAATGG - Intronic
1012991837 6:105934124-105934146 TATGGTGAAGAGTGCTGCAATGG + Intergenic
1018578743 6:165288491-165288513 TATTGTGAATAGTTCTGCAATGG - Intronic
1026379097 7:69781500-69781522 TCTGGAGACCAGCTCTCCTAAGG + Intronic
1026967282 7:74448207-74448229 TCTGGTGGCCAGTTCTGCACCGG + Intergenic
1028329385 7:89570149-89570171 TATTGTGAATAGCTCTGTAATGG - Intergenic
1028969568 7:96842659-96842681 TATGGTGAATAGTGCTGCAATGG + Intergenic
1032491935 7:132330277-132330299 TAAGGTGGCCAGCACTGCGAGGG - Intronic
1033713769 7:143978075-143978097 TATGGTGACCTGCTCTTTAAAGG - Intergenic
1035293778 7:157856066-157856088 CCTGCTCACCAGCTCTGCAAAGG + Intronic
1035677380 8:1465039-1465061 GCAGGTGACCAGCTCTGCAGGGG + Intergenic
1039345896 8:36704878-36704900 CATGGCAACCAGCCCTGCAATGG + Intergenic
1041087848 8:54272956-54272978 CCTGGGGACCAGCGCTGCAATGG - Intergenic
1043101624 8:76054442-76054464 TGTAGTGACCAGTTCTGCAAAGG + Intergenic
1048514513 8:135093684-135093706 CATGGTGGGAAGCTCTGCAAGGG + Intergenic
1051517932 9:17951428-17951450 TATTCTTACCAGCTCTGCAGGGG + Intergenic
1053168393 9:35860850-35860872 AGTTGTGACCAGCTTTGCAAAGG + Intergenic
1056960711 9:91120156-91120178 TATGCTGAACAGCTCTCTAAAGG + Intergenic
1058062844 9:100516281-100516303 TCTGCTGACCAGCTTTGCACAGG + Intronic
1059336202 9:113569906-113569928 GATGGAGACCTGCTCTTCAATGG - Intronic
1059934564 9:119296571-119296593 TATTGTGAGAAACTCTGCAATGG - Intronic
1185989956 X:4882631-4882653 TTTGATCACCAGATCTGCAAAGG - Intergenic
1187330045 X:18329415-18329437 TAGGGTGAACTGCTCTGCACTGG + Intronic
1188604821 X:32015432-32015454 TGTTGTGACCAGCTCTCCAGGGG - Intronic
1190916319 X:54813758-54813780 TCTTGAGACCAGTTCTGCAAGGG + Intronic
1194109934 X:89821071-89821093 TATTGTGACTAGTGCTGCAACGG + Intergenic
1200060746 X:153482665-153482687 TACTGCGAGCAGCTCTGCAATGG + Intronic