ID: 1184770697

View in Genome Browser
Species Human (GRCh38)
Location 22:46595017-46595039
Sequence CCTGTCGTTCCCGCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184770693_1184770697 -7 Left 1184770693 22:46595001-46595023 CCCAGTCACCGAGGTACCTGTCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1184770697 22:46595017-46595039 CCTGTCGTTCCCGCCTCCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
1184770690_1184770697 25 Left 1184770690 22:46594969-46594991 CCAGGTTTGTTTCTGCTGCTCTG 0: 1
1: 0
2: 1
3: 49
4: 415
Right 1184770697 22:46595017-46595039 CCTGTCGTTCCCGCCTCCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
1184770694_1184770697 -8 Left 1184770694 22:46595002-46595024 CCAGTCACCGAGGTACCTGTCGT 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1184770697 22:46595017-46595039 CCTGTCGTTCCCGCCTCCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184770697 Original CRISPR CCTGTCGTTCCCGCCTCCTG TGG Intronic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
900131872 1:1090687-1090709 CCTGCGGGTGCCGCCTCCTGGGG - Intronic
900229628 1:1550052-1550074 CCTGTGATTCCAGCCTCCTCCGG + Intronic
900957677 1:5897420-5897442 TCTGACATTCGCGCCTCCTGAGG + Intronic
901351143 1:8598014-8598036 CATCTCTTTCCCGCCTCATGGGG + Intronic
901960319 1:12821333-12821355 CCTGTCGTTCCAGCTACCAGGGG + Intergenic
902001634 1:13198890-13198912 CTTGAAGTTTCCGCCTCCTGTGG + Intergenic
902290108 1:15429749-15429771 CCTGTCATGCCCACCCCCTGAGG + Exonic
903350457 1:22713472-22713494 CCTGTCCTGCCTGTCTCCTGGGG + Intronic
903543256 1:24108462-24108484 CCTGTGGCTCCCACCTGCTGCGG + Exonic
905260654 1:36715907-36715929 TCTGTTGGTCCCGCCTGCTGGGG + Intergenic
906531027 1:46524146-46524168 TCTGCCGGTCCCTCCTCCTGGGG + Intergenic
906832767 1:49051061-49051083 CCTGTCTTTCAAGGCTCCTGAGG - Intronic
913122106 1:115751875-115751897 CCTGTCTTTCCAGCCTCATCTGG + Intronic
914379355 1:147102664-147102686 CATGTCCCTCCCTCCTCCTGAGG + Intergenic
915209852 1:154300397-154300419 CCTGTAGTTCCAGCTACCTGGGG - Intergenic
916950388 1:169774330-169774352 CCTGTAGTTCCTGCTACCTGGGG - Intronic
919984043 1:202660423-202660445 CCTGTCTTTCTCACCTGCTGGGG - Intronic
920380582 1:205532449-205532471 CCTGTCGTGGCCGCCCTCTGGGG - Intronic
920910816 1:210214696-210214718 CCTGTAATTCCAGCCTCCTTTGG - Intergenic
923120924 1:230990677-230990699 CCTGTGGTTCCAGCTACCTGGGG - Intronic
1062870638 10:900557-900579 CCTGTAGTTCCAGCTACCTGGGG - Intronic
1063444528 10:6102253-6102275 CCTGTCCTCCCCACCACCTGTGG + Intronic
1065071749 10:22032071-22032093 CCTGTAGTTCCCAGCTACTGGGG + Intergenic
1065156233 10:22872874-22872896 CATGTCGTTAGCACCTCCTGAGG - Intergenic
1068977979 10:63032514-63032536 CCTGTAGTTCCCAGCTCCTCGGG - Intergenic
1070690940 10:78524952-78524974 CCTGTCGTTTCCGGCATCTGAGG - Intergenic
1070757280 10:79001199-79001221 CCTGCCCTTCCACCCTCCTGTGG + Intergenic
1072099488 10:92215871-92215893 CCTGTAGTTCCAGCCTACTCGGG - Intronic
1073246608 10:102094934-102094956 CCTGTCGTCCCAGCCTTTTGAGG - Intergenic
1075074878 10:119344003-119344025 CCAGCCGCTCCTGCCTCCTGTGG - Intronic
1075508027 10:123043228-123043250 CCTGTCTTGCACACCTCCTGTGG - Intronic
1076921135 10:133455394-133455416 CCTTTCCCTCCCACCTCCTGGGG - Intergenic
1080645745 11:34186398-34186420 CCTGTCCTCCCCCCATCCTGAGG + Intronic
1083352071 11:62036821-62036843 CCTGTAGTTCCAGCTTCTTGAGG + Intergenic
1083424187 11:62574559-62574581 CCTGTCCCTCCCACCTCCTCCGG + Exonic
1083778061 11:64903743-64903765 CCTGTCCATACCACCTCCTGTGG - Intronic
1083779717 11:64911473-64911495 CCTGTCCTTCCAGCACCCTGAGG - Intronic
1084657348 11:70527250-70527272 CCTGTAGTTAAAGCCTCCTGGGG + Intronic
1089710539 11:120311392-120311414 CCTGTCATTCCTACCTCATGGGG - Intronic
1090093616 11:123722759-123722781 CCTGTAGTCCCAGCTTCCTGGGG + Intergenic
1090412622 11:126519613-126519635 CCTGTGGTTCCAGCATCCTCTGG + Intronic
1094437657 12:30439179-30439201 CCTGTCATTGGTGCCTCCTGGGG + Intergenic
1095561560 12:43572066-43572088 CCTGCCATGCCCGCCTCCTCAGG + Intergenic
1098321131 12:69244652-69244674 CCTGTAATTCCAGCCTCCTTTGG - Intronic
1101359634 12:104014229-104014251 CCTGTAGTTCCAACTTCCTGGGG + Intronic
1101904053 12:108812321-108812343 CCTTTCCTTGCCTCCTCCTGGGG - Intronic
1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG + Intergenic
1104456106 12:128913640-128913662 CCAGGCGTTCGGGCCTCCTGAGG + Intronic
1104688374 12:130805636-130805658 CCTGTCATTCCTCACTCCTGAGG - Intronic
1104723603 12:131060944-131060966 CCTGAAGGTCCCTCCTCCTGGGG + Intronic
1109342013 13:61074673-61074695 CCTGTAGTTCCAGCTACCTGGGG - Intergenic
1112199585 13:97261902-97261924 CCTGTCCTTCCCCCTTCTTGAGG + Intronic
1113442823 13:110342606-110342628 CCTACTGTTCCTGCCTCCTGGGG - Intronic
1113492187 13:110700868-110700890 CGTGTCGTTACCTCCTTCTGTGG - Intronic
1113737594 13:112689796-112689818 CCTGTTGCTTCCGCCTCCCGGGG - Intergenic
1113786124 13:113003050-113003072 CCTGTAGTCCCAGCCACCTGGGG + Intronic
1115770979 14:36663610-36663632 ACTGTCTTTCCCACCACCTGAGG + Intronic
1119867756 14:77988325-77988347 CCTGTCTTTCCAGCTTCCAGAGG - Intergenic
1122402593 14:101476158-101476180 TCTGCAGTTCCAGCCTCCTGAGG - Intergenic
1122890883 14:104731757-104731779 TCTGTCTTTCCTGCCTCATGGGG - Intronic
1127278975 15:57472643-57472665 CCTGTCTCTCCTGACTCCTGTGG + Intronic
1132665349 16:1078927-1078949 CCTGTTGTCACCGCCTCCAGAGG - Exonic
1132855736 16:2043861-2043883 CCGCTTGTTCCCGCCTCCTGGGG - Intronic
1134173432 16:11987186-11987208 CCTGTAGTCCCAGCCTCCTGGGG - Intronic
1134539234 16:15051468-15051490 CCTGTAGTTCCCAGCTCCTTGGG - Intronic
1137268892 16:46889855-46889877 CTTGTCTTTCCCACTTCCTGAGG + Intronic
1138178755 16:54928927-54928949 CCCCTCGCTCCCGCCTCTTGCGG - Intergenic
1139834607 16:69828217-69828239 CCTTTCTTTCCCTCCTCCTAAGG + Intronic
1140343063 16:74184448-74184470 CCTGTAGTCCCCACCACCTGGGG + Intergenic
1141757181 16:85998928-85998950 CCTGCCGTTCCTACCTCCTGTGG + Intergenic
1142775273 17:2132903-2132925 CCTGTAGTCCCAGCTTCCTGGGG - Intronic
1143650246 17:8259028-8259050 CCTATAGTCCCAGCCTCCTGAGG + Intronic
1143708976 17:8720647-8720669 CCTGTAATTCCCGGCTACTGCGG - Intergenic
1148831385 17:50434193-50434215 CTTGTGGTTCCAGCTTCCTGGGG + Intronic
1149527638 17:57369130-57369152 CCTGTCATTCCCACCACCAGAGG - Intronic
1149864708 17:60144852-60144874 CCTGTAGTCCCAGCCACCTGGGG - Intergenic
1160832489 19:1110279-1110301 CCTGTGCTTCCAGCCTCATGGGG - Intronic
1161170188 19:2808595-2808617 CCTGTCATGCCCGTGTCCTGGGG + Intronic
1161331060 19:3688022-3688044 CCCGTCGGCCCCGCCACCTGCGG - Intronic
1163779007 19:19235868-19235890 CCTGTAGTCCCAGCCTACTGGGG - Intronic
1165480700 19:36062068-36062090 CCTGTGGTCCCAGCCACCTGGGG - Intronic
1166388703 19:42396914-42396936 CGTGTCGGACCCGCCTCCGGAGG - Intergenic
1166759535 19:45215980-45216002 CCTGTGCTTCCTGCCTCCTGAGG - Intronic
1167565283 19:50252297-50252319 CCTGCGGTTCCTGCCACCTGGGG - Intronic
927459193 2:23283170-23283192 CCTGGCTTTCCTGCCTCCAGAGG - Intergenic
928156523 2:28881882-28881904 CCTGTAGTTCCAGCTACCTGGGG + Intergenic
936041498 2:109153566-109153588 TCTGTCGGGCCCACCTCCTGGGG - Intronic
936385417 2:112024453-112024475 CCTGCCACCCCCGCCTCCTGTGG + Intronic
938949064 2:136240728-136240750 CCTGTCCTTCCAACCTCATGAGG - Intergenic
940209970 2:151246144-151246166 ACTTTCTTTCCCTCCTCCTGAGG - Intergenic
940321470 2:152381920-152381942 CTTGTAGTTCCAGCCTCCTCAGG - Intronic
946024794 2:216665276-216665298 CCTGTCACTCCCCTCTCCTGTGG + Intergenic
947534332 2:230931513-230931535 CCTGTGGGTCCTGCCTCATGGGG - Intronic
947792396 2:232875890-232875912 CCTGTCGGCCCCGTCACCTGGGG + Intronic
947952681 2:234161622-234161644 CCTGTCATTCCCGCCACATAGGG - Intergenic
948646141 2:239406381-239406403 TCTGTCACTCCTGCCTCCTGGGG - Intergenic
1169199389 20:3700629-3700651 ACTGTCCTTCCCTCCTCCTGAGG - Intronic
1169737867 20:8856490-8856512 CCTGTAGTTCCCAGCTACTGGGG + Intronic
1170348814 20:15417472-15417494 CCTGTAGTTCCCAACTACTGGGG + Intronic
1170486177 20:16818256-16818278 CCTGTAGTTCTCTCCTACTGGGG + Intergenic
1171567754 20:26209615-26209637 CCCCTCGCTCTCGCCTCCTGTGG - Intergenic
1174358319 20:50012804-50012826 CCGGCTGTTCCTGCCTCCTGGGG + Intergenic
1174607940 20:51774586-51774608 CCTGTAGTTCCAGCTTCTTGGGG - Intergenic
1183119229 22:35717278-35717300 CCTGTAGTCCCCGCCACTTGGGG + Intergenic
1183469061 22:37996217-37996239 CCTGTCCTTCCTGCCTGCTGGGG - Intronic
1184770697 22:46595017-46595039 CCTGTCGTTCCCGCCTCCTGTGG + Intronic
1184781588 22:46652326-46652348 CCTGCCTTTCCAGCTTCCTGAGG - Intronic
950097100 3:10336836-10336858 CCTGTCTTGCCTGCCTCTTGCGG - Intronic
950181846 3:10918928-10918950 CCTGTGTTGCCCGGCTCCTGTGG + Intronic
950403733 3:12791186-12791208 CCTGTAGTTCCAGCCACTTGTGG + Intergenic
950792664 3:15485834-15485856 CCTGTGGTCCCACCCTCCTGTGG + Intronic
951913461 3:27775249-27775271 CCTGTCCCTACCTCCTCCTGAGG + Intergenic
951963316 3:28353057-28353079 CCTGTAGTCCCAGCCACCTGGGG + Intronic
954109831 3:48427790-48427812 CCTGTCCTCCCAGGCTCCTGAGG + Intronic
954449821 3:50565783-50565805 CCTGTGGTTCCTGCCACCTGTGG + Exonic
956017744 3:64901788-64901810 GCTGAGGTTCCAGCCTCCTGGGG + Intergenic
963258795 3:143173326-143173348 CCTGTCTTTCCCTCCTCTTTTGG + Intergenic
970422809 4:15920839-15920861 CCTGTTGATCCAGCCTACTGCGG + Intergenic
971919184 4:32914414-32914436 CCTGTAGTCCCAGCCTACTGGGG + Intergenic
972323214 4:37991804-37991826 CCAGCCATTCCAGCCTCCTGTGG + Intronic
978460430 4:108945786-108945808 CCTGTAGTCCCAGCCTACTGGGG - Intronic
981094622 4:140765592-140765614 CCTGTCGTTCCAGCTACCTGTGG + Intergenic
981336542 4:143574631-143574653 CCTGTGGTACCAGCTTCCTGTGG + Intergenic
981603373 4:146517337-146517359 CCTGTAGTTCCCAGCTCCTTGGG + Intronic
985508365 5:298200-298222 ACTGTCCTTCCTGCCTCATGGGG + Intronic
985739678 5:1607471-1607493 ACTGTCCTTCCTGCCTCATGGGG - Intergenic
986470961 5:8074014-8074036 CCTGTTGTTCCCAGCTACTGGGG - Intergenic
992113132 5:73514822-73514844 CCTGTAGTCCCAGCCTACTGGGG + Intergenic
994101076 5:95893507-95893529 CCTGTGGTTCCCAGCTACTGAGG - Intronic
995409666 5:111841639-111841661 CCTGGGGTTCCCTCCTCCTTAGG + Intronic
999061334 5:148638921-148638943 CCTGTAGTTCCAGCTACCTGGGG + Intronic
1002134532 5:177099578-177099600 CCTGTCCCGCCTGCCTCCTGGGG + Intergenic
1002698640 5:181107181-181107203 CCTGCTGTGCCCGCCTCCTTGGG + Intergenic
1003354571 6:5355125-5355147 CCTGTAGCTCCCACCTCCTTTGG + Intronic
1003503343 6:6720250-6720272 CCTGTGATTCTCGTCTCCTGTGG - Intergenic
1003512234 6:6791173-6791195 CCTCTCTTTCCAGCCTCCCGAGG - Intergenic
1003977514 6:11357921-11357943 CCTGTGGGTCCCGCCTCCAGAGG + Intronic
1005033033 6:21529242-21529264 CCTGTTGTTCCTGCCTCTTATGG + Intergenic
1021106634 7:16645838-16645860 TCTCTCGCTACCGCCTCCTGCGG - Intergenic
1022730173 7:33015437-33015459 CCTGTAGTTCCAGCTACCTGAGG + Intronic
1026874923 7:73873696-73873718 CCTGGCGATCCTGCATCCTGTGG + Intergenic
1026979727 7:74519282-74519304 CCTGTCCTGCCCTCCTCATGGGG + Intronic
1032109357 7:129062332-129062354 CCTGTGGTCCCCGCCACTTGAGG - Intergenic
1033684129 7:143623275-143623297 CCCGTCCCTCCCTCCTCCTGGGG + Intronic
1033687305 7:143702494-143702516 CCCGTCCCTCCCTCCTCCTGGGG + Intronic
1033700483 7:143834348-143834370 CCCGTCCCTCCCTCCTCCTGGGG - Intergenic
1034352910 7:150428922-150428944 GCTGTCACTCCCACCTCCTGTGG + Intergenic
1035196804 7:157228666-157228688 CCTGCCGTGCCCGCCACCTCTGG - Intronic
1035220401 7:157402988-157403010 CCTGTCGTCAGGGCCTCCTGAGG - Intronic
1035477857 7:159156317-159156339 CCTGGTGCTCCCGCCTGCTGTGG + Intergenic
1038404529 8:27311479-27311501 CCCGCAGTTCCCGCCTCCTCAGG + Exonic
1040423637 8:47262737-47262759 CCTGTGATCCCCACCTCCTGGGG - Intronic
1042484191 8:69333472-69333494 CCTGTCCTTCCTGCCTCATAGGG + Intergenic
1042509555 8:69597224-69597246 CCTGTGGTTGCCCCCTGCTGAGG - Intronic
1042559385 8:70061609-70061631 CCTGGCCTTCCTGCTTCCTGGGG + Intronic
1049542551 8:143215158-143215180 CCTGGCTTTCCCGCCGCCTGGGG - Intergenic
1050261811 9:3848965-3848987 TCTGTTGTTCACGGCTCCTGTGG - Intronic
1053276667 9:36788373-36788395 CCTGTTGTGCAAGCCTCCTGGGG + Intergenic
1056764693 9:89437508-89437530 CCTGTCGCTGCCGCCTGCTAGGG - Intronic
1059128415 9:111717467-111717489 CCTGTAATTCCAGCTTCCTGGGG + Intronic
1059982724 9:119790872-119790894 CCTCTTGTTCCTTCCTCCTGAGG - Intergenic
1061176681 9:129001863-129001885 CCTGTCTTTCCCTCCTCCCAGGG + Exonic
1062575635 9:137205953-137205975 CCTGGCGTGCCCGCCTCGCGGGG + Intronic
1062619282 9:137412120-137412142 CCTGTCCTTGCCGCATCCTGGGG - Intronic
1185445201 X:254187-254209 CCTGCCTCTCCCGGCTCCTGGGG + Intergenic
1185567966 X:1110092-1110114 CCCCTCGGTCCTGCCTCCTGGGG - Intergenic
1185599517 X:1329366-1329388 CCTGCCTCTCCCGCCTCCTGGGG - Intergenic
1185629059 X:1502863-1502885 CCTGTCTCTCCCAGCTCCTGGGG - Intronic
1185629117 X:1503190-1503212 CCTGTCTCTCCCAGCTCCTGGGG - Intronic
1185677442 X:1860183-1860205 CCTGCCTTTCCCAGCTCCTGGGG + Intergenic
1185813546 X:3132542-3132564 CCTGCCTCTCCCGGCTCCTGGGG + Intergenic
1185875007 X:3694874-3694896 CCTGCCTCTCCCGGCTCCTGGGG - Intronic
1186192857 X:7083049-7083071 CCTGCCTTTCCCAGCTCCTGGGG - Intronic
1186730361 X:12403238-12403260 CCTGCCTTTCCTGCCTCCTTGGG + Intronic
1189030007 X:37440886-37440908 CCTGTGGTTCCCACCTACTTGGG - Intronic
1190082363 X:47366347-47366369 CCTCTCGCCCCCGCCTTCTGTGG + Intergenic
1190287180 X:48969489-48969511 CCAGCCGTTGCCGCTTCCTGCGG - Exonic
1192527349 X:71859028-71859050 CCTGTAGTTCCAGCCACTTGCGG - Intergenic
1200690757 Y:6305211-6305233 CCTGCAGTCCCAGCCTCCTGGGG + Intergenic
1201044515 Y:9869505-9869527 CCTGCAGTCCCAGCCTCCTGGGG - Intergenic