ID: 1184775188

View in Genome Browser
Species Human (GRCh38)
Location 22:46619637-46619659
Sequence CAGAGTGAACAGGAGGACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184775188 Original CRISPR CAGAGTGAACAGGAGGACCG GGG (reversed) Intronic
900672967 1:3867313-3867335 CGGAGTGAACAGACGGAGCGTGG - Intronic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
903891833 1:26574906-26574928 CAGAGTTCACAGGAGGCCAGTGG + Intronic
904296993 1:29526230-29526252 CAGAATGTACAGGAGGAGAGTGG + Intergenic
904840743 1:33370370-33370392 CAGAGGCACCAGGAGGACAGAGG - Intronic
905288978 1:36908385-36908407 GAGAGGGAGCAGGAGGACCCAGG - Intronic
905929465 1:41777058-41777080 CCGAGTCAACAGGAGGGCCGTGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906201832 1:43965558-43965580 AAGAGTGCACAGGGGGACTGTGG + Intronic
907310755 1:53537736-53537758 CAGAGTGAAGAGGAGGTTTGGGG + Intronic
907816031 1:57919087-57919109 CATAGTGAATGGGAGGACCCAGG - Intronic
914889052 1:151606751-151606773 CAGAGTGAACTGGAGTCCCCAGG + Intergenic
918558523 1:185835200-185835222 CAGAGTGAAGAGGAGAAGCATGG + Intronic
922435368 1:225599980-225600002 GAGAGAGAAGAGGAGGACCCAGG - Intronic
923790306 1:237106015-237106037 CAGAGTGTGCAGCAGGACTGGGG + Intronic
1063703683 10:8410306-8410328 CATAGTGCACAGGAGGCCCAAGG + Intergenic
1063936963 10:11088260-11088282 CAGAGTGAACAGCATGAGTGAGG + Intronic
1064577613 10:16762010-16762032 CAGGGGGAACAGCAAGACCGGGG - Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072032666 10:91536499-91536521 CAGAGACACCAGGAGGACCGTGG - Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1074968187 10:118511985-118512007 CATATTGAACAGGATGACCCTGG - Intergenic
1075449976 10:122544548-122544570 GAGACTGACCAGGAAGACCGTGG + Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075913592 10:126147357-126147379 CAGAGGGAACAGGAGGGGAGAGG - Intronic
1077268958 11:1666211-1666233 CAGAGGGTCCAGGAGGACAGGGG - Intergenic
1078840363 11:15072072-15072094 GAGAGCGAACCGGAGGCCCGGGG + Intronic
1079481527 11:20885790-20885812 CAGAGTGAACTGGATAACCTTGG - Intronic
1080637567 11:34137303-34137325 GAGAGTGGACAGGAGGATCAAGG + Intronic
1082228965 11:49741477-49741499 CAGAGTGGAGAGGAAGACAGTGG + Intergenic
1083147701 11:60771350-60771372 GAGTGTGAACAGGGGGACCCAGG + Intronic
1084703327 11:70801725-70801747 CAGAGAGAACAGGAGTCCCCGGG - Intronic
1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG + Intergenic
1086621106 11:88887646-88887668 CAGAGTGGAGAGGAAGACAGTGG - Intronic
1089402126 11:118170429-118170451 CAGAGGGAGCAGAATGACCGAGG + Intronic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094086636 12:26600465-26600487 CAGAGAGGAAAGGAGGACAGAGG - Intronic
1095120676 12:38414548-38414570 CAGAGGGAAGAAGAGGACCAAGG + Intergenic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG + Intronic
1102504345 12:113374359-113374381 CAGACAGAGCAGGAGGCCCGGGG - Intronic
1103344833 12:120242288-120242310 CAGAGTGTTCAGGAAGACCATGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104523263 12:129495300-129495322 CAGAGTGAGGAGGAAGACCTCGG - Intronic
1105751399 13:23425164-23425186 CAAGGTGAACAGGAGGCCCCAGG - Intronic
1106439890 13:29757020-29757042 GAGAGAGAACAGGTGGACCAGGG - Intergenic
1107904908 13:45052924-45052946 CAGAATGAAAAGGAGGACATAGG + Intergenic
1108544595 13:51480229-51480251 CAGAGGGAACAAGAAGACTGAGG - Intergenic
1113394457 13:109933719-109933741 CAGGGTGAAGAGGAGGAGTGTGG - Intergenic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113847027 13:113398054-113398076 CAGAAGAAACAGGAGGTCCGAGG - Intergenic
1115175706 14:30559309-30559331 CAGAGAGAGAAGCAGGACCGTGG + Intronic
1116267026 14:42705479-42705501 CAGTGTGAATAGGAGGACACAGG + Intergenic
1121432522 14:93898053-93898075 CAGAGGCAACAGGAGGCCCAGGG + Intergenic
1121521069 14:94586650-94586672 CAGCCAGAACAGGAGGACGGTGG + Intronic
1121617131 14:95320348-95320370 CAGAGTGGACAGGGGACCCGCGG - Intergenic
1122061475 14:99139307-99139329 CGGAGAGCACAGGAGGACCCGGG + Intergenic
1122156175 14:99751775-99751797 CAGAGTGAACCCCAGAACCGGGG + Intronic
1122784807 14:104158718-104158740 CAGAGGGAACAGGAGAGCAGAGG + Intronic
1124231080 15:27946968-27946990 CAGAGAGGCCAGGAGGACCCTGG + Intronic
1124662370 15:31560765-31560787 CAGGCTGAACTGGAGGACAGTGG - Intronic
1125688036 15:41575256-41575278 CTGAATGAACAGGAGGGCCAGGG - Intronic
1125748763 15:42014703-42014725 TAGAGTGACCAGAAGGACCTGGG - Intronic
1126172943 15:45709168-45709190 CATAGAGAACAGGAGGCCAGAGG + Intergenic
1127819199 15:62640370-62640392 CAGAGAGAAGAGGGGGACGGTGG + Intronic
1128307855 15:66611768-66611790 CAGAGTGTACAGGAAGGCAGAGG + Intronic
1128443106 15:67731811-67731833 CAGAGTGGAAAGGAGAACAGGGG - Intronic
1129667617 15:77588288-77588310 CAGAAGGACCAGGAGGACAGAGG + Intergenic
1129684026 15:77674606-77674628 CAGAGGGAACAGCAGGTCTGAGG - Intronic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1130515957 15:84625927-84625949 CAGGGTGAACAGGGGCACTGAGG - Intronic
1131254735 15:90854608-90854630 CAGAGAGAACATGGGCACCGTGG + Intergenic
1132542076 16:514881-514903 CAGAGTGAACTGGGTGAACGTGG + Intronic
1132974616 16:2705132-2705154 CAGAGTGACGACGAGGACCAGGG + Intronic
1134002668 16:10794832-10794854 CAGAATCAACAGGAGGTCCTAGG + Intronic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138287429 16:55820960-55820982 CAGAGAGAAGAGGTGGACAGAGG - Intronic
1140241234 16:73202844-73202866 CAGAGTGTGCAGGAGGGCTGGGG - Intergenic
1141149267 16:81552866-81552888 CAGAGTGCACAAGAGGAATGAGG + Intronic
1141489106 16:84359869-84359891 CAGAGTGCACAGGGGGTCTGGGG - Intergenic
1143208837 17:5167902-5167924 TAGAGGGAACAGGAGGAAAGGGG - Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143763462 17:9121468-9121490 CAGAGAGAAAAGGAGCACCGGGG - Intronic
1144161203 17:12560618-12560640 CAGAGTGAATAAGATGACCAGGG - Intergenic
1144340493 17:14305662-14305684 CAGAATGGAAAGGGGGACCGAGG - Intronic
1145137683 17:20424562-20424584 TAGAGGGAACAGGAGGAAAGGGG - Intergenic
1145184947 17:20785951-20785973 CAAAGTGAAAAGGAGGACAATGG - Intergenic
1147154307 17:38535863-38535885 CAGAGGGAAAAGGACAACCGGGG - Intronic
1149291870 17:55225421-55225443 CAGAGGGCACAGGAGGAGCAGGG - Intergenic
1149871453 17:60185659-60185681 TAGAGGGAACAGGAGGAAAGGGG + Intronic
1149979916 17:61302187-61302209 CAGAGAGAACAGGAGAACCCTGG - Intronic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1151369108 17:73636258-73636280 CAGAGTGATAGGGAGGACTGAGG + Intronic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG + Intronic
1153460916 18:5332305-5332327 CAGAGTGAAGATGAAGACGGAGG + Intergenic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1156477493 18:37415206-37415228 GAGGGTGAACAGGAGGGCAGGGG + Intronic
1157689340 18:49668401-49668423 CACAGTGACCAGGAGGAACTTGG - Intergenic
1158016626 18:52791419-52791441 CAGAGTGGAAAGGAAGACAGTGG + Intronic
1161030670 19:2056461-2056483 CAGAGTGAAGAGGAGGGCCTGGG + Intergenic
1162718314 19:12647548-12647570 CAGCGTGAGCAGGTGCACCGAGG + Exonic
1162788028 19:13047893-13047915 CAGACGGAACAAGAGGACCTGGG - Intronic
1163040289 19:14597052-14597074 GAGGGTGCACAGGAGGACCTGGG + Intronic
1165720202 19:38073645-38073667 CAGAATGAACACGAGGCCAGAGG + Intronic
925024881 2:599815-599837 CAGAGTCCACAGCAGGACCTGGG - Intergenic
929142395 2:38677622-38677644 CACAGTGAACAGGGGGAGCAGGG - Intronic
930148375 2:48031447-48031469 CAGGGAGAACAGGATGACCCTGG - Intergenic
930186976 2:48420350-48420372 CAGAGGGAACGGGAGGCCCAGGG + Intergenic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931534301 2:63255538-63255560 CAGAGAGAGGAGGAGGACCCAGG - Intronic
932169120 2:69537702-69537724 CAGGGTGAACAGGAGCACTTGGG + Intronic
932977816 2:76625228-76625250 CAGAGAGAACTGGGGGGCCGTGG + Intergenic
933803777 2:85983318-85983340 CAGAGCGGACAGGAAGACAGGGG - Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
936457637 2:112687442-112687464 CCGAGTGGACAGCAGGACCCTGG - Intergenic
946311387 2:218884131-218884153 TAAAGGGAACAGGAGGACAGAGG - Intronic
947403073 2:229748307-229748329 CAGAGTGCACAAGAGCACCTAGG + Intergenic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
948183730 2:236002891-236002913 GTGTGTGAACAGGAGGGCCGGGG + Intronic
949059777 2:241949970-241949992 CAGGGAGGACAGGAGGACCGAGG - Intergenic
1172025015 20:31942690-31942712 TGGAGTGAACATGAGGACTGGGG - Intronic
1172790636 20:37503067-37503089 CAGAGAGGTCAGGAGGACCAGGG - Intronic
1172872593 20:38144940-38144962 CAGGGTGACCAGGATGACCAGGG + Intronic
1174453466 20:50633759-50633781 CACACTGAGCAGGAGGACCTGGG - Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1175919013 20:62441349-62441371 CAGAGGGCACAGGAGAACCTAGG + Intergenic
1178209881 21:30517503-30517525 CAGAGTGAACAGCATGATTGTGG - Intergenic
1178749094 21:35283718-35283740 CAGAGTGATAAGGAGGTCCCAGG + Intronic
1179050922 21:37888041-37888063 CAGAGTGACCAGGAGTCCCATGG - Intronic
1180880980 22:19203444-19203466 CAGAGAGAATAGGAAGACAGGGG - Intronic
1180940483 22:19657289-19657311 CAAGGTGAACAGGAGGCCCCAGG + Intergenic
1182015129 22:27032767-27032789 CAGAGGGAAGAGGAGAACCAGGG - Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183811163 22:40258875-40258897 CAGAGTGACCTGCAGGACTGAGG - Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
950471589 3:13189763-13189785 CTGGGGGAACAGGAGGACCTGGG - Intergenic
952448737 3:33410260-33410282 CAGAGTTAACAGCAAGACCTTGG + Intronic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
954365846 3:50145565-50145587 CAGAGAGAAGAGGAGCACTGAGG + Intergenic
957976461 3:87451908-87451930 CAGAGAGAACAAGAGAACTGAGG - Intergenic
959893312 3:111580660-111580682 CAGAGGGAAGGGGAGGACAGAGG - Intronic
961001781 3:123379016-123379038 AAGAGTGTAGAGGAGGACAGGGG - Intronic
963317157 3:143771917-143771939 CAGGTTGAGCAGGAGGACAGAGG + Intronic
968052034 3:195661535-195661557 CAGGGTGGAAAGGAGGACCTGGG + Intergenic
968103778 3:195986803-195986825 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
968302080 3:197624396-197624418 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
969228867 4:5816112-5816134 CAGATTGGACAGGAGGCCTGGGG + Intronic
969372524 4:6742977-6742999 CGGAGTCAACAGCAGGAACGAGG + Intergenic
971760439 4:30758221-30758243 CAGAGAGAACAGGAAGATCCAGG + Intronic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
984868883 4:184309996-184310018 CTGTGTGCACAGGAGGCCCGTGG + Intergenic
985037245 4:185852916-185852938 GAGAGTGAACACCAGGACCAAGG - Intronic
985655668 5:1130335-1130357 CAGCGAGGACAGGAGGACCCAGG + Intergenic
986984146 5:13481002-13481024 CAGATTCAACAGGATGACGGGGG + Intergenic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
992386275 5:76287631-76287653 CAGAGGGAACAGCAGCACTGTGG - Intronic
995240865 5:109884525-109884547 CAGCCTGTACAGGAGGACGGAGG + Exonic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
1000028754 5:157383313-157383335 CAGAGGGACCAGGTGGAGCGGGG - Exonic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1002163594 5:177331660-177331682 CAGGGTGAACAGGAAGGCCTGGG + Exonic
1010975389 6:82307074-82307096 CAGAGTGAACAGGAAGGCCTGGG + Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1012239271 6:96853770-96853792 AAAAGTGTACAGGAGGACTGTGG - Intergenic
1015244627 6:131062841-131062863 AAGAGGGAAGAGGGGGACCGCGG + Intronic
1015897858 6:138034489-138034511 CAGAGAGAACTGGAGGAGCTCGG + Intergenic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1017600010 6:156070036-156070058 CAAAGAGAACAGCAGGAGCGAGG - Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1022493387 7:30837758-30837780 CAGAGAAAACAGGAGGGCCCAGG + Intronic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1037007946 8:13805620-13805642 GGGAGAGAACAGGAGGACAGAGG - Intergenic
1038665024 8:29530357-29530379 CAGAGGGAAGAGGAGGTCCTTGG + Intergenic
1039255676 8:35716395-35716417 CAGTGTGATCAGGAAGACAGAGG + Intronic
1039518465 8:38152131-38152153 CAGAGAGAAGAGGAGGGCCTGGG + Intergenic
1040526141 8:48226742-48226764 CAGAGTGGAGAGGAAGACAGTGG - Intergenic
1041252321 8:55946307-55946329 CAGAAAGAACAGGAGCACAGAGG - Intronic
1044501635 8:92965487-92965509 AAGAGTGAAGAGGAGTACCATGG + Intronic
1047019758 8:120762415-120762437 CAGAATGAAAAGCAGGACTGGGG + Intronic
1047288966 8:123512555-123512577 AATAGTGAGCAGGAGGACCAAGG - Intronic
1051025444 9:12605110-12605132 CAGATTGAACAGGAGAAATGTGG + Intergenic
1051209628 9:14728046-14728068 CAGGGTGAAAAGAAGGACCGTGG - Intergenic
1052215695 9:25963640-25963662 CAGAGTGGAGAGGAAGACAGTGG + Intergenic
1056153979 9:83817341-83817363 CAGAGGGCACGGGAGGGCCGCGG - Intronic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057255199 9:93540751-93540773 CAGAGTGAAGAGGAGGTCACAGG - Intronic
1057299539 9:93869949-93869971 GAGAGTGAACAGAAGGCCCTAGG - Intergenic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1058541194 9:106014251-106014273 GAGGGTGAAGAGGAGGACAGAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1059397972 9:114050700-114050722 AAGAGGGAAAAGGAGGACCGGGG - Exonic
1059949597 9:119448574-119448596 CAGACTGAAGAGGAGGATTGAGG - Intergenic
1060218476 9:121752322-121752344 CAGAGGGAACGGGAGGTCAGTGG - Intronic
1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG + Intergenic
1061989852 9:134152950-134152972 CAGAGTGAAAATGAGGCCCAAGG - Intronic
1062219650 9:135408308-135408330 CAGAATGGCCAGGAGGACAGAGG - Intergenic
1185569716 X:1124194-1124216 CGGAGTGAGCAGAAGGACAGAGG + Intergenic
1185648085 X:1629295-1629317 CAGAGAGGACAGGAGGAGAGAGG + Intronic
1188988058 X:36785563-36785585 CAGACTGAAGAGGAAGACCTTGG + Intergenic
1190335859 X:49261320-49261342 CAGAGTGGACAGGGAGACTGAGG - Intronic
1194784811 X:98069653-98069675 TAGAGTGAACAGGGGCAACGGGG + Intergenic
1195299653 X:103515159-103515181 CAGACTGAACAGGAGACCTGGGG - Intronic
1196021133 X:110992204-110992226 CAGAGAGAACAGGAAGAGCAAGG + Intronic
1196235553 X:113275477-113275499 CAATGTTAACAGGAGGACCAAGG + Intergenic
1200072153 X:153534523-153534545 CAGGGAGAACAGCAGGCCCGAGG - Intronic