ID: 1184775475

View in Genome Browser
Species Human (GRCh38)
Location 22:46620850-46620872
Sequence CAGGTTCTGAGGGGCTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 299}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184775475_1184775488 15 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775488 22:46620888-46620910 GGGAGGCCGATCTGAGAGGGAGG 0: 1
1: 0
2: 6
3: 50
4: 710
1184775475_1184775490 19 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775490 22:46620892-46620914 GGCCGATCTGAGAGGGAGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 373
1184775475_1184775482 -6 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775482 22:46620867-46620889 AACCTGACAGGACGAGAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 168
1184775475_1184775487 12 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775487 22:46620885-46620907 GAAGGGAGGCCGATCTGAGAGGG 0: 1
1: 0
2: 2
3: 20
4: 185
1184775475_1184775481 -10 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775481 22:46620863-46620885 TCAGAACCTGACAGGACGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 96
1184775475_1184775485 -2 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775485 22:46620871-46620893 TGACAGGACGAGAGGAAGGGAGG No data
1184775475_1184775483 -5 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775483 22:46620868-46620890 ACCTGACAGGACGAGAGGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 159
1184775475_1184775489 16 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775489 22:46620889-46620911 GGAGGCCGATCTGAGAGGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 251
1184775475_1184775486 11 Left 1184775475 22:46620850-46620872 CCCAGGAAGCCCCTCAGAACCTG 0: 1
1: 0
2: 4
3: 32
4: 299
Right 1184775486 22:46620884-46620906 GGAAGGGAGGCCGATCTGAGAGG 0: 1
1: 0
2: 3
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184775475 Original CRISPR CAGGTTCTGAGGGGCTTCCT GGG (reversed) Intronic
900006294 1:55653-55675 CAGGTTCTGGGAGGCCTCCCTGG - Intergenic
900399843 1:2468426-2468448 GAGCTTCCGAGGGGCATCCTGGG + Intronic
901020502 1:6252846-6252868 GAGGTCCAGAGGGGCTGCCTGGG - Intronic
901190977 1:7409529-7409551 CAGGCTCCCAAGGGCTTCCTGGG + Intronic
902372657 1:16015882-16015904 CAGGTGCCGAGGGGCTGCCCAGG + Intronic
902780382 1:18701009-18701031 CAGGTGCACAGGGGCTGCCTTGG - Intronic
902880974 1:19371663-19371685 GAGGTGCTGGGGGGCTTCCCAGG - Intronic
903423668 1:23237029-23237051 CTGGTTCTTAGTGGCTTCCTTGG + Intergenic
904783657 1:32969282-32969304 CAGGATCTGGGGGCTTTCCTGGG - Intergenic
904934081 1:34114214-34114236 GAGGTTCTGGGGGCTTTCCTTGG - Intronic
905169001 1:36098943-36098965 CTGGTTTGGATGGGCTTCCTGGG - Exonic
905175191 1:36130921-36130943 CTGGCTCTGGGGGGCTTCCTGGG + Intergenic
905922979 1:41731334-41731356 CAGGTTCACGGGGGCTTACTGGG - Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906051901 1:42881109-42881131 CAGGGGCAGGGGGGCTTCCTGGG + Intergenic
910179352 1:84464158-84464180 CAAGGACTGAGGGGCATCCTTGG - Intergenic
912189018 1:107315940-107315962 CAGGTTCTGGAGAGCTTTCTTGG + Intronic
912588226 1:110786826-110786848 CAGGACCTGAGGGTCTTCCATGG + Intergenic
913640282 1:120806228-120806250 CCTGTTCTGAGGGGCTTCAAGGG + Intronic
915038803 1:152950382-152950404 CTGGTTCTCAGTGGCTTCCCTGG - Intergenic
915622006 1:157091819-157091841 CAGGGCATGAGGAGCTTCCTGGG - Intergenic
917262429 1:173184873-173184895 CAAGTTCTGAGTGGCTGCCAAGG - Exonic
921526793 1:216228095-216228117 CAGGTTATGTGAGGCTTCCAGGG + Intronic
1062849129 10:729440-729462 CTGGTTCTGTGGGCCGTCCTGGG + Intergenic
1067437890 10:46291818-46291840 CTGGGACTGAGGAGCTTCCTGGG - Intronic
1067541801 10:47160365-47160387 CAGGGACATAGGGGCTTCCTGGG - Intergenic
1067765168 10:49080399-49080421 GAGGTTCTGCTGGGCTTCCCTGG - Intronic
1067807712 10:49404634-49404656 CCGGGGCTGAGGGGCTGCCTTGG - Intergenic
1068137613 10:52965830-52965852 CAGGGGCTGGGGGGCTTCCTGGG + Intergenic
1068443802 10:57095062-57095084 CAGGTTCAGGGGGGCCACCTAGG - Intergenic
1069096955 10:64270544-64270566 TAGGGTCTGAGGGGTTTCTTGGG + Intergenic
1070437035 10:76403471-76403493 CTGGCCCTGAGGGGTTTCCTGGG - Intronic
1070700557 10:78598714-78598736 CAGGTTCTGAGGGGCAGACTTGG - Intergenic
1070823913 10:79379986-79380008 CAGGTTGTGAGGAGCCCCCTTGG - Intergenic
1071011130 10:80941807-80941829 CAGTTTCTGAGGGTCTTACAAGG - Intergenic
1073422897 10:103438756-103438778 CAGCTTCTGAGGGGCTATGTAGG + Exonic
1074546209 10:114404075-114404097 CACCTTCTTCGGGGCTTCCTCGG + Intronic
1076124947 10:127966556-127966578 CAGGGACTGAGGGGTTTGCTGGG + Intronic
1076271081 10:129152714-129152736 CAGGCTCTGAGGGACTTCTAGGG - Intergenic
1076593578 10:131609277-131609299 CTGGGACCGAGGGGCTTCCTGGG - Intergenic
1076619862 10:131780157-131780179 GAGGCACTGAGGGGCTTCCCAGG + Intergenic
1076662518 10:132065008-132065030 CAGGTTCTGGGGGTCAGCCTGGG - Intergenic
1076882137 10:133244842-133244864 CAGCTTCTCAGGGGACTCCTGGG + Intergenic
1077297576 11:1833241-1833263 CAGGAGCTGAGGGGCTGCCGAGG + Intronic
1077929689 11:6718107-6718129 CAGGCTCTAATGGCCTTCCTGGG - Intergenic
1078196174 11:9138674-9138696 CAGGCCCTCAGGGGCATCCTGGG + Intergenic
1079345308 11:19646595-19646617 CAGGATCTGGGGAGCTTCCCAGG + Intronic
1079427180 11:20354804-20354826 TGGGGTCTGAGGAGCTTCCTGGG - Intergenic
1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG + Intergenic
1083406877 11:62463660-62463682 CTGGAACTGAGGGGGTTCCTGGG + Intronic
1083428810 11:62603011-62603033 CCGGTCCCGAGGGGCCTCCTGGG + Intronic
1084425226 11:69080707-69080729 TAAGTTCTGGGGGGCTTCCTAGG - Intronic
1084446888 11:69208991-69209013 CAGGGCAAGAGGGGCTTCCTGGG + Intergenic
1084547581 11:69822162-69822184 GGGGGTCTGGGGGGCTTCCTGGG - Intergenic
1085189239 11:74603537-74603559 CTGGGTCTGAGGGGTTTCTTGGG - Intronic
1085859396 11:80214458-80214480 CAAGTTATAAGGTGCTTCCTGGG - Intergenic
1086948420 11:92867011-92867033 CAGGTGCTCAGCGGCTTCCAGGG + Exonic
1089697372 11:120224536-120224558 CAGGCTCTGAGTGGCCCCCTTGG - Intronic
1089879835 11:121762978-121763000 CAGGTTCCACGGGGCTTGCTTGG - Intergenic
1093104947 12:15075086-15075108 CAGGTTCTGAGGTGGTTCTGGGG - Intergenic
1094592997 12:31838685-31838707 CAGATTCTCAGTGGCCTCCTGGG + Intergenic
1095107170 12:38248593-38248615 CATGTTTCCAGGGGCTTCCTTGG - Intergenic
1095990983 12:48034429-48034451 CAGGTTTTGAGGGGGTTCAAGGG + Intergenic
1096609766 12:52793443-52793465 CTGGGACTGAGGGGTTTCCTGGG - Intronic
1096701081 12:53383239-53383261 GAGGTTCTGGAGGGTTTCCTGGG - Exonic
1097065339 12:56316363-56316385 CCGGTGCTGCGGTGCTTCCTGGG - Exonic
1097450807 12:59734438-59734460 CAGGGGCAGGGGGGCTTCCTGGG + Intronic
1098488972 12:71052978-71053000 CAGGTTCTAAGGGCTTTCCAAGG - Intronic
1098739917 12:74160528-74160550 CAGTTTCTGATGTCCTTCCTCGG + Intergenic
1102866857 12:116381714-116381736 CAGTTTCTGAGGGGCCATCTCGG + Intergenic
1103958496 12:124593058-124593080 CATCCTCTGAGGGGCTTCCTGGG - Intergenic
1104560584 12:129840329-129840351 CAGGCTGGGAGGGGCATCCTCGG - Intronic
1104762823 12:131307558-131307580 AAGGGCATGAGGGGCTTCCTGGG + Intergenic
1104817102 12:131653825-131653847 AAGGGCATGAGGGGCTTCCTGGG - Intergenic
1104861770 12:131927822-131927844 CAGGTTGTGTGGGGCCTCGTGGG - Intergenic
1106370672 13:29129754-29129776 CTGGTTCTCAGGGGCAGCCTTGG + Intronic
1107837381 13:44422861-44422883 CAGGATGTGAGGAGCTTCCATGG - Intergenic
1110197907 13:72812043-72812065 CAAGTTTTGAGGGGCTTATTGGG + Intronic
1111771571 13:92603016-92603038 TAGGCTCAGATGGGCTTCCTAGG - Intronic
1112167461 13:96934940-96934962 GAGCAGCTGAGGGGCTTCCTTGG - Intergenic
1113965615 13:114151646-114151668 TCGGAACTGAGGGGCTTCCTTGG - Intergenic
1114494621 14:23124034-23124056 CAGGGTCTGAGGAGCTTGATGGG - Intergenic
1114645054 14:24250994-24251016 CTGGTTCTGAGGGGTTTCCCTGG + Intronic
1116666435 14:47781591-47781613 AAAGTTCTGAGGAGCCTCCTCGG - Intergenic
1118287136 14:64485730-64485752 CAGGATTTTTGGGGCTTCCTGGG - Exonic
1119654142 14:76404918-76404940 CCCCTTCTGAGGGGCTTCCTGGG - Intronic
1120956469 14:90087683-90087705 CAGGTGCTGAGGGTCATCATTGG + Intronic
1121418606 14:93796505-93796527 CAGGTTCTTAGAGGTTTCCTGGG + Intergenic
1121423677 14:93833262-93833284 CAGGCTTTGAGGAGCTTTCTGGG - Intergenic
1122201783 14:100127169-100127191 CAGGTGCTGAAGGCCTACCTTGG + Intronic
1122493945 14:102139272-102139294 AGGCTTCAGAGGGGCTTCCTGGG + Exonic
1122880053 14:104686721-104686743 CAGGCCCAGAAGGGCTTCCTGGG - Intergenic
1123216024 14:106810067-106810089 CAGGTCCTCCTGGGCTTCCTCGG + Intergenic
1129255443 15:74331502-74331524 TGTGTTCTGAGGGGCTTCCAGGG - Intronic
1129663825 15:77568181-77568203 CAGGTCCTCAGGGCCTTGCTAGG - Intergenic
1129677970 15:77642630-77642652 GGGGCTCTGAAGGGCTTCCTAGG - Intronic
1130564484 15:84981915-84981937 CATGTTCGGAGGGGCGGCCTCGG + Intronic
1131581142 15:93645088-93645110 CAAGTTCAGAAGGGCTTTCTTGG + Intergenic
1132447228 15:101935305-101935327 CAGGTTCTGGGAGGCCTCCCTGG + Intergenic
1132562553 16:603745-603767 CAGGGCCTGAGGGGCTTTCTGGG - Intronic
1133171511 16:3985081-3985103 CACCTTCTGAGGGGATTCCAGGG - Intronic
1134009165 16:10838526-10838548 CTGCTTCTGAGGGGCAGCCTGGG + Intergenic
1137484195 16:48878056-48878078 CTGATGCTGAGGGGTTTCCTGGG + Intergenic
1138134835 16:54512576-54512598 AAGGGTGTGAGGGGTTTCCTCGG - Intergenic
1139353209 16:66350842-66350864 CAGGTTCAGCGGGGCTGGCTGGG + Intergenic
1139356040 16:66367489-66367511 CTGCTTCTGGGGGACTTCCTGGG - Intronic
1139369292 16:66456392-66456414 CAGATTCTGGGGGGCTGGCTGGG - Intronic
1139654512 16:68379186-68379208 CAGGTTCTGCAGGGCCTCCCAGG - Intronic
1139672906 16:68503946-68503968 CTGGGTCTCAGGGGTTTCCTGGG - Intergenic
1139917960 16:70439537-70439559 CAGCATCTGAGAGGCGTCCTCGG - Intergenic
1140407215 16:74718893-74718915 CAGGTGCTGCGGAGCCTCCTGGG - Intronic
1141135244 16:81460516-81460538 CCAGGACTGAGGGGCTTCCTGGG - Intronic
1141447297 16:84069321-84069343 CAGCTTCTGAAGGGCTGCATGGG + Intronic
1141514290 16:84533109-84533131 GAGTCTCTGATGGGCTTCCTTGG - Intronic
1142102828 16:88284709-88284731 CAGGTGCTAAGGGCCTTCCGTGG + Intergenic
1142513830 17:413955-413977 TAAGTTCTCAGGGGCCTCCTCGG - Exonic
1142603051 17:1066434-1066456 CAGTTTCTGAGAGGCCTCCCAGG + Intronic
1142866097 17:2792495-2792517 CAGGGTGTGAGAGTCTTCCTAGG - Intronic
1143580092 17:7820393-7820415 CAGGTCCTGAGGGCTTTCGTGGG - Intronic
1143645264 17:8225902-8225924 CAGGTTCTAGGGGACGTCCTAGG + Intergenic
1145818333 17:27811697-27811719 CCACTTCTGAGGGGTTTCCTTGG + Intronic
1147050467 17:37790533-37790555 GAGGGGCTGAGGGGCTTGCTGGG + Intergenic
1147266292 17:39236830-39236852 CAGATTCTGAGGGGCCTGCCTGG - Intergenic
1147442747 17:40457443-40457465 TAGGGGATGAGGGGCTTCCTGGG + Exonic
1148083694 17:44981445-44981467 CAGGTCCTGAGCTGCGTCCTGGG + Intergenic
1148344038 17:46891512-46891534 CAAGATCTGAGAGGCTTCCAAGG + Intergenic
1148444980 17:47732248-47732270 CATGCTCTGAAGGGCTGCCTCGG - Intergenic
1148582250 17:48752248-48752270 CAGGTGAGGAGGGGCTGCCTGGG + Intergenic
1150481865 17:65517027-65517049 CAGGTGGTGAGGGGCTGCCCTGG - Intergenic
1151227450 17:72657614-72657636 CAGGGACTGAGGGGTTTCCCAGG + Intronic
1151430515 17:74059472-74059494 CGGATTCACAGGGGCTTCCTGGG - Intergenic
1151674596 17:75590991-75591013 GTGGTGCTGAGGGCCTTCCTGGG - Intergenic
1152031024 17:77843155-77843177 CCAGGCCTGAGGGGCTTCCTGGG + Intergenic
1152432585 17:80257608-80257630 GTGGTTCTGACGGGCCTCCTGGG - Intergenic
1152456672 17:80421124-80421146 CAGGTCCTGGGGGGCTCCCGCGG + Intronic
1153428067 18:4987957-4987979 CAGGGTCAGGGGGGCTTCCCAGG + Intergenic
1153617604 18:6948921-6948943 CGGGTTCTGAGGGGCGGCCCTGG + Intronic
1156965599 18:43087434-43087456 CAGGTGCTGAGGTGCCTCCCAGG - Intronic
1157001551 18:43532515-43532537 CAGGATCTACGGAGCTTCCTGGG + Intergenic
1157522290 18:48353647-48353669 AAGGTTCTCAGGGCCTTTCTGGG + Intronic
1158706617 18:59798064-59798086 CAGATTCTGGGGGGCCTCCTTGG + Intergenic
1160134702 18:76262373-76262395 CAGGCTCTCAAGGGGTTCCTGGG + Intergenic
1160406983 18:78652907-78652929 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407200 18:78653509-78653531 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407231 18:78653595-78653617 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407384 18:78654012-78654034 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407489 18:78654289-78654311 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407675 18:78654776-78654798 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407688 18:78654811-78654833 CCGGGACTGAGGGGGTTCCTGGG - Intergenic
1160407728 18:78654916-78654938 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407786 18:78655073-78655095 CTGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407792 18:78655091-78655113 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407816 18:78655160-78655182 CCGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407876 18:78655317-78655339 CTGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407901 18:78655388-78655410 CTGGGACTGAGGGGTTTCCTGGG - Intergenic
1160638048 19:97228-97250 CAGGTTCTGGGAGGCCTCCCTGG - Intergenic
1160949246 19:1657821-1657843 CAGGTGCAGAGGGGCTGCGTGGG - Intergenic
1161007616 19:1944371-1944393 CCCGTGCTGTGGGGCTTCCTGGG + Intronic
1161299700 19:3536846-3536868 CAGCTTCTGAGGGGCTTCCCAGG + Intronic
1162524820 19:11201173-11201195 CAGAATCTGGGGGCCTTCCTGGG + Intronic
1162895568 19:13763116-13763138 CAGTCTGTGAGGGGCCTCCTGGG - Exonic
1162985178 19:14265310-14265332 CAGCTTCAGAGGAGCTGCCTTGG + Intergenic
1166703465 19:44895400-44895422 CAGGTGCAGAGAGGCCTCCTAGG + Intronic
1167344494 19:48936810-48936832 CAGGTTTGTAGGGGGTTCCTTGG - Intronic
1167649797 19:50723070-50723092 ATGGTTCTGAGCGGGTTCCTGGG + Intergenic
1168517552 19:57020381-57020403 CAGGTTCTTAGGGGCTGCCAAGG + Intergenic
924986015 2:270702-270724 ATGGCTCTGAGGAGCTTCCTGGG + Intronic
925798021 2:7567870-7567892 CCAGCTCTGAGGGGCTCCCTGGG + Intergenic
926637887 2:15203389-15203411 CATGTTTTGAGGGCCTTCCATGG - Intronic
927155091 2:20216713-20216735 CAAGTTCTAAAGGGCTTTCTGGG + Intronic
927462422 2:23310583-23310605 CAGGGTCTGGGTGTCTTCCTGGG - Intergenic
927870267 2:26618809-26618831 TAGGAGCTGAGTGGCTTCCTGGG - Intronic
928048270 2:27961565-27961587 CAGCTTATGATGGGCTTACTGGG + Intronic
928261085 2:29767438-29767460 CAGGGACTGATGGGTTTCCTGGG - Intronic
928371287 2:30741946-30741968 CATGTTCTGAAGGGCTTCCCTGG + Exonic
931690941 2:64834402-64834424 CTGGGACTGAGGGACTTCCTGGG - Intergenic
932345968 2:70995171-70995193 CAGGTTCTGGGGAGGTTGCTGGG - Exonic
932752371 2:74379579-74379601 CTGGTTCTGAGAGGCTTATTGGG - Intronic
934160180 2:89242133-89242155 GAGGCTCTGGGAGGCTTCCTGGG + Intergenic
934207095 2:89940301-89940323 GAGGCTCTGGGAGGCTTCCTGGG - Intergenic
937098405 2:119250509-119250531 GAGGCTCTGCGGGGCTCCCTGGG + Intronic
938580466 2:132641364-132641386 GAGGTTCCTTGGGGCTTCCTTGG + Intronic
939616979 2:144372791-144372813 CATGCTCTGAGGCTCTTCCTTGG + Intergenic
939725549 2:145716691-145716713 CTGGGACGGAGGGGCTTCCTAGG + Intergenic
942619611 2:177833440-177833462 CAGCTGCTGAGGGTCTGCCTAGG - Intronic
943977816 2:194506347-194506369 CAGGTTCTTTGGGGTTTTCTAGG - Intergenic
944580248 2:201125917-201125939 CTGGGACTGAGGGGTTTCCTGGG + Intronic
945088682 2:206159186-206159208 CCGGCTCTCAGGGGCTTCCGAGG + Exonic
947257560 2:228182338-228182360 CAGGTTCTGAGTGCTGTCCTCGG - Intergenic
947546514 2:231014545-231014567 CTGGCTTTGAGGGGCATCCTGGG + Intronic
947552634 2:231057287-231057309 CAGGACCCGAGGGGCTTCCTGGG + Intronic
947653019 2:231803252-231803274 CAGGATCAGAGGGGCAACCTGGG + Intronic
948142623 2:235685055-235685077 CAGGTTCTGAGGGCTTTGCTGGG + Intronic
948484589 2:238272359-238272381 CAGGGTTCTAGGGGCTTCCTGGG + Intronic
948986881 2:241531041-241531063 CCGGGTCTGAGGAGTTTCCTGGG - Intergenic
1168819560 20:763814-763836 CAGGTGCTGGGAGGCTTCCGTGG - Exonic
1168855707 20:1006153-1006175 CAGGGATTGAGGGGCTTCCTAGG + Intergenic
1171219943 20:23386640-23386662 CACGTTCAGGGGAGCTTCCTTGG + Intronic
1172133177 20:32669553-32669575 TTGGTTCTAAGGGCCTTCCTTGG - Intergenic
1172631236 20:36379463-36379485 CAGGCTCTGAGCGGAATCCTGGG + Intronic
1172933004 20:38599614-38599636 CAGGCCCTGGGGGGCTTTCTGGG + Intergenic
1173207586 20:41007025-41007047 CAGGTTCTTATGGGCTTCAGAGG + Intergenic
1173789422 20:45818067-45818089 CAGGTTCTGAAGGTCTCCCACGG + Intergenic
1174727190 20:52875335-52875357 CAGGTTCTGAGAGGCTGCCTTGG + Intergenic
1175237480 20:57524898-57524920 CAGACGCTGAGGGGCTGCCTGGG - Intronic
1175541057 20:59747906-59747928 CTGTTTCTGATGGGCTTCCTGGG - Intronic
1176001393 20:62833027-62833049 CAGGTTCCGACGGTCTTCCTGGG + Exonic
1176043640 20:63081289-63081311 CAGGTTCTGCAGGGCTTCAGAGG - Intergenic
1177037512 21:16061303-16061325 CAGGGGCAGGGGGGCTTCCTGGG + Intergenic
1177344729 21:19854292-19854314 CAGGGTCAGAGGAGCTTCCCAGG + Intergenic
1177813956 21:25955633-25955655 CCGGATCTGAGCGGCTTTCTTGG + Exonic
1178101154 21:29270116-29270138 CAGGAACTGAGAGGGTTCCTGGG - Intronic
1178772152 21:35515542-35515564 CAGGGTCTCAGGGCCTTCATGGG - Intronic
1178908631 21:36656241-36656263 CAGGTGCTGACGGGCTTCCGTGG - Intergenic
1179359828 21:40695354-40695376 CTGGGACTGAGGGGTTTCCTAGG - Intronic
1179483143 21:41691334-41691356 CAGGTTCTGAGGGCTTGCATAGG - Intergenic
1180126089 21:45791131-45791153 CTTGTTGTGAGGGGCTTCCTGGG - Intronic
1181683902 22:24515384-24515406 TGGGGTCTGGGGGGCTTCCTGGG + Intronic
1181871505 22:25902967-25902989 CAGGTTCCGAGGTGCTTACCTGG + Intronic
1182322284 22:29485718-29485740 CAGCTGCTGAATGGCTTCCTGGG - Exonic
1182926556 22:34130673-34130695 GAGGTTCTGAGGGGCCACTTGGG - Intergenic
1183688169 22:39374022-39374044 CAGGTCCTAAAGGTCTTCCTGGG - Intronic
1183735552 22:39642973-39642995 CTGGCTCTGAGGGGCTCCCTAGG - Intronic
1184263399 22:43332739-43332761 GAGGTTCTGGAGGCCTTCCTGGG + Intronic
1184775475 22:46620850-46620872 CAGGTTCTGAGGGGCTTCCTGGG - Intronic
1185317182 22:50184296-50184318 CAGGTTCTGAGGAGCTGCCCCGG - Intergenic
949385915 3:3502164-3502186 CCAGGCCTGAGGGGCTTCCTGGG - Intergenic
950151681 3:10692492-10692514 CACGTTCTGGGGGGATCCCTGGG + Intronic
950719364 3:14871640-14871662 AAGGTTCTGGAGGGCGTCCTGGG + Intronic
951661687 3:25073399-25073421 AATGTTCTGAGGTGCATCCTTGG - Intergenic
952407779 3:33019934-33019956 CAGATTGGGTGGGGCTTCCTGGG - Intronic
954105419 3:48407213-48407235 CCGGGACTCAGGGGCTTCCTGGG - Intronic
954111337 3:48435049-48435071 CTGGTTCGGAGGGGCCTCCTTGG - Exonic
954287898 3:49631744-49631766 CAGGTCCTGCTGGGCTTGCTGGG + Intronic
955194174 3:56789611-56789633 CATGTTCTGAGGGGCTTTCTAGG - Intronic
955358735 3:58253951-58253973 CAGGCTGTGAGGTGCTTGCTAGG + Intronic
957964938 3:87310288-87310310 CATGTTCTGAGTGGTCTCCTGGG - Intergenic
959403540 3:105932682-105932704 CAGATGCTGAGTGGATTCCTTGG - Intergenic
963906202 3:150775081-150775103 CAGGGGCAGAGGGGCTTCCTGGG + Intergenic
967020888 3:185521450-185521472 CTGGTTCTTATGAGCTTCCTCGG + Intronic
968838426 4:2982088-2982110 CAGGGGCAGGGGGGCTTCCTGGG + Intronic
968915640 4:3496011-3496033 CCTGTTCTGAGGGGCCTCGTGGG - Intronic
968932224 4:3587212-3587234 CACTTTCTGAGGAACTTCCTTGG - Intronic
969675070 4:8610103-8610125 CAGTTTCCCAAGGGCTTCCTGGG + Intronic
971238419 4:24864898-24864920 CAGGTTCTGCAGGGCTGACTGGG + Intronic
971325131 4:25637371-25637393 CTGGGTCTGAGGGGTTTCCTGGG - Intergenic
971746969 4:30594212-30594234 CAGGTTTTGAAGGGCTTCATAGG + Intergenic
972312120 4:37891282-37891304 CAGGTGCTTGGGGGCATCCTGGG - Exonic
974894835 4:67926701-67926723 CAGGCTCTGGGGGGCTCCCAGGG - Intronic
978279629 4:106994798-106994820 CAGGTGCTGAGGGCATTCCATGG - Intronic
980668489 4:135971746-135971768 AAGGTTCTGAGAGGATTCCTTGG - Intergenic
981910884 4:149980575-149980597 CAGAGACTGAGGGGCTTCCCAGG - Intergenic
982383752 4:154778022-154778044 CAGGTTCTGATTTGCTGCCTTGG + Intergenic
986080363 5:4385623-4385645 CAGCTTCTGGGAGGTTTCCTAGG + Intergenic
987335589 5:16895540-16895562 CAGGAGGTGAGAGGCTTCCTGGG - Intronic
989279352 5:39622583-39622605 CGGGTTCTGGGGGGCTCCCAAGG + Intergenic
990349294 5:54899754-54899776 CTGGTTCTGAGGGGCCCCCTGGG + Intergenic
991085768 5:62647157-62647179 CAGCTGCTGAGGGCCATCCTTGG + Intergenic
991978863 5:72211116-72211138 CAGGGACTGAGGGGTTTTCTGGG - Intergenic
992025152 5:72662773-72662795 CAGGTTCTGAGTGGTTTCTTGGG - Intergenic
994245644 5:97472170-97472192 CAGGCTCTGCGGGGCTCCCAAGG + Intergenic
997736473 5:136216134-136216156 CAGGTTCTGTGGGTCTCACTGGG - Intronic
997749120 5:136327629-136327651 CAGGTTCTGAGGGGTGACTTGGG + Intronic
998374166 5:141680466-141680488 CAGGTCCTGAGGGGCAGCCATGG + Exonic
999988351 5:157025722-157025744 CAGGTTCTAAGGAGCTTAGTAGG - Intergenic
1000829513 5:166085486-166085508 CCAGATCTGAGGGGTTTCCTGGG + Intergenic
1000952998 5:167508041-167508063 CATGTTCAGTGGGGTTTCCTTGG - Intronic
1001834951 5:174824100-174824122 CAGGCTCTGAGGGGCTCCTGAGG - Intergenic
1001938813 5:175726951-175726973 CTGGGTCTGAGGGGGGTCCTGGG - Intergenic
1002769954 6:282244-282266 CACATTCTGAGGTGCTTCATAGG + Intergenic
1004296043 6:14411984-14412006 CAGCTTCTGAGGGGCTGACCAGG + Intergenic
1004467194 6:15897231-15897253 CTGGTACTGAGGGCATTCCTAGG - Intergenic
1005944607 6:30586204-30586226 CAGGAGCTCAGGGGCCTCCTGGG - Exonic
1006094735 6:31648891-31648913 CAGGTATTGAGGGGCCTCCGAGG - Exonic
1006163852 6:32053292-32053314 CAAGAGCAGAGGGGCTTCCTGGG + Intronic
1006419110 6:33922407-33922429 CATCTGCTGAGGGCCTTCCTGGG - Intergenic
1008483427 6:52009833-52009855 CAGCTTCTGAGGGGATTACGTGG - Intronic
1008854120 6:56060933-56060955 CAGGTCCTAAGGGGCAACCTGGG - Exonic
1009428775 6:63543233-63543255 CTGGGACTGAGGGGTTTCCTGGG - Intronic
1011055823 6:83202352-83202374 CTGGGACTGAGGGGTTTCCTGGG + Intergenic
1013353689 6:109328826-109328848 CAGGATCTGAGGGTGTTCCTGGG + Intergenic
1013365443 6:109434194-109434216 CTGGGACTGAGGGGTTTCCTAGG - Intronic
1016662794 6:146600341-146600363 CTGATTCTGAAGGGCGTCCTCGG - Intronic
1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG + Intergenic
1019538045 7:1538977-1538999 CCCGTCCTGAGGGGCTTCCCAGG - Intronic
1019594343 7:1851465-1851487 CAGTTCATCAGGGGCTTCCTGGG - Intronic
1019702418 7:2480367-2480389 CAGGAGGTGAGGGGCTTGCTGGG + Intergenic
1019933107 7:4236599-4236621 CAGGTCCTGGGGTGCTTCGTGGG + Intronic
1020049496 7:5072468-5072490 CAGGTTCTGAAGGCCTTCCTGGG - Exonic
1020772228 7:12409161-12409183 CAGGTTTAAAGGGGCTTTCTAGG - Intergenic
1022535104 7:31093627-31093649 CTGGTTCTGAGGGCAGTCCTTGG + Intronic
1024557975 7:50620127-50620149 CAGTTTCTGAGGAGGTGCCTGGG - Intronic
1025035234 7:55589541-55589563 CCTGGTCTGAGGGGCTTCCCAGG + Intergenic
1026188950 7:68107058-68107080 CAGGTACTGAGGAGTTTCTTGGG + Intergenic
1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG + Intronic
1027133668 7:75609375-75609397 CAGATACTGAGGGGTTTCCAGGG + Intronic
1027163930 7:75821557-75821579 CAGGGGCTGTGGGGCTTCCAGGG + Intronic
1028297230 7:89149217-89149239 CAATTTCTCAGGGGCTTCCTAGG + Intronic
1029736348 7:102467910-102467932 CAGGACCTGGGGTGCTTCCTGGG - Intronic
1034456493 7:151173821-151173843 CAGCCTCTGAGATGCTTCCTAGG + Intronic
1035283710 7:157793472-157793494 AAGGATCTGAGGGGCCTCCAGGG + Intronic
1036648026 8:10624239-10624261 CAGGCTCTGGGTGGCATCCTGGG + Intronic
1038185699 8:25272875-25272897 GGGGTTCTGAGGGGCTTGCGGGG - Intronic
1038452827 8:27650847-27650869 CAGGGACTGAGGGGATTCCCAGG + Intronic
1038457755 8:27689028-27689050 CAGGTTCTAAGGAGGTGCCTTGG - Intergenic
1040014298 8:42688776-42688798 CAGGGACTGAGGGGATTACTGGG + Intergenic
1042346085 8:67729736-67729758 CAGGCTCTGAGCGGCTTACAGGG - Intronic
1042745367 8:72100868-72100890 AAGCAGCTGAGGGGCTTCCTAGG - Intronic
1042886218 8:73554810-73554832 CAGATTATTAAGGGCTTCCTAGG - Intronic
1045224875 8:100234794-100234816 CAGATCCTGAGGGGCTTGGTAGG + Intronic
1047058380 8:121193544-121193566 AAGGGTCTGAGGGGTTTCCCAGG - Intergenic
1049273387 8:141707852-141707874 CAGATACTGAGGGGAGTCCTGGG - Intergenic
1052553559 9:29984615-29984637 TAGGTTCTGAGTGGCTAACTGGG - Intergenic
1052849358 9:33367248-33367270 CAGGTTCTGAGAGTGATCCTAGG - Intronic
1053043063 9:34891097-34891119 AAGTTTCTCAGTGGCTTCCTGGG + Intergenic
1054457910 9:65444716-65444738 CACTTTCTGAGGAACTTCCTTGG + Intergenic
1056994526 9:91443669-91443691 CAGGGACAGAGGGGCTTCCTAGG + Intergenic
1059275650 9:113094719-113094741 CAGGTTCTGACTTACTTCCTTGG - Intergenic
1062062367 9:134503257-134503279 CCGGGACTGAGGGGCTTCCCAGG + Intergenic
1062238488 9:135523777-135523799 CAGGAGCTGCGGGGCTTGCTGGG + Intronic
1187274220 X:17804475-17804497 TAGGTTCTCAGGGCCTTCATGGG - Intronic
1189320397 X:40083844-40083866 CAGGGTCCGAGGGGTTACCTAGG - Intronic
1190157346 X:48004647-48004669 CAGGTGCTGTAGGGCCTCCTTGG + Intronic
1190173116 X:48127532-48127554 CAGGTGCTGTAGGGCCTCCTTGG + Intergenic
1190363203 X:49668125-49668147 GAGGTGCCGTGGGGCTTCCTGGG - Intergenic
1190460253 X:50666227-50666249 CAGGATCTGAGTAGCTTGCTTGG - Intronic
1195564698 X:106327045-106327067 CAGGTTCTTTGTAGCTTCCTTGG + Intergenic
1197891763 X:131276193-131276215 CAGGTCCTGTGGTGTTTCCTGGG - Exonic
1198129386 X:133678531-133678553 CTGGGACTGAGGGGTTTCCTAGG + Intronic
1200179297 X:154140674-154140696 CAGGTGCTGAGTGACTTTCTAGG + Intergenic
1201793368 Y:17866776-17866798 AAGATTGTGATGGGCTTCCTGGG + Intergenic
1201808186 Y:18039210-18039232 AAGATTGTGATGGGCTTCCTGGG - Intergenic
1202339221 Y:23843313-23843335 AAGATTGTGATGGGCTTCCTGGG + Intergenic
1202354755 Y:24034605-24034627 AAGATTGTGATGGGCTTCCTGGG + Intergenic
1202516023 Y:25635504-25635526 AAGATTGTGATGGGCTTCCTGGG - Intergenic
1202531545 Y:25826759-25826781 AAGATTGTGATGGGCTTCCTGGG - Intergenic