ID: 1184776691

View in Genome Browser
Species Human (GRCh38)
Location 22:46626958-46626980
Sequence GACGAGGACAGGTACTCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184776691_1184776706 20 Left 1184776691 22:46626958-46626980 CCCTGTGAGTACCTGTCCTCGTC 0: 1
1: 1
2: 0
3: 6
4: 106
Right 1184776706 22:46627001-46627023 TCGTCCCCGTCCTCTGTGGCCGG 0: 1
1: 1
2: 0
3: 11
4: 106
1184776691_1184776700 -5 Left 1184776691 22:46626958-46626980 CCCTGTGAGTACCTGTCCTCGTC 0: 1
1: 1
2: 0
3: 6
4: 106
Right 1184776700 22:46626976-46626998 TCGTCCCCCGGTGTGGGCTGGGG 0: 1
1: 0
2: 3
3: 8
4: 116
1184776691_1184776707 21 Left 1184776691 22:46626958-46626980 CCCTGTGAGTACCTGTCCTCGTC 0: 1
1: 1
2: 0
3: 6
4: 106
Right 1184776707 22:46627002-46627024 CGTCCCCGTCCTCTGTGGCCGGG 0: 1
1: 1
2: 1
3: 4
4: 146
1184776691_1184776698 -7 Left 1184776691 22:46626958-46626980 CCCTGTGAGTACCTGTCCTCGTC 0: 1
1: 1
2: 0
3: 6
4: 106
Right 1184776698 22:46626974-46626996 CCTCGTCCCCCGGTGTGGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 128
1184776691_1184776705 16 Left 1184776691 22:46626958-46626980 CCCTGTGAGTACCTGTCCTCGTC 0: 1
1: 1
2: 0
3: 6
4: 106
Right 1184776705 22:46626997-46627019 GGTGTCGTCCCCGTCCTCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 93
1184776691_1184776699 -6 Left 1184776691 22:46626958-46626980 CCCTGTGAGTACCTGTCCTCGTC 0: 1
1: 1
2: 0
3: 6
4: 106
Right 1184776699 22:46626975-46626997 CTCGTCCCCCGGTGTGGGCTGGG 0: 1
1: 0
2: 3
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184776691 Original CRISPR GACGAGGACAGGTACTCACA GGG (reversed) Exonic
900466857 1:2829979-2830001 GCCCAGGACATGGACTCACACGG - Intergenic
900747050 1:4367605-4367627 GATGGGGACAGGCACCCACATGG - Intergenic
902243325 1:15102872-15102894 GCCGAGGACAGGGAGTGACAAGG + Intronic
907831358 1:58067250-58067272 GACGAGGAGAGGGACTCCCACGG + Intronic
913214993 1:116612821-116612843 GCTGAGGGCAGGTTCTCACATGG - Intronic
916214421 1:162383451-162383473 GATTAGGTCAGGTACTGACAGGG - Exonic
916479367 1:165201352-165201374 GACCAGGAGACATACTCACAGGG - Intergenic
918143681 1:181738027-181738049 GAGGAGGACAGGAGCTGACAAGG + Intronic
918626162 1:186658173-186658195 GACAAGGGCAGGGCCTCACAAGG - Intergenic
919835507 1:201570476-201570498 CATAAGGACAGGTACTCCCAGGG - Intergenic
924627226 1:245705636-245705658 GAGGAGGACAGGTTCACACAAGG - Intronic
1068968031 10:62933379-62933401 GGGGTGGTCAGGTACTCACATGG - Intergenic
1075175883 10:120160747-120160769 CCCGAGGACAGGGACTCAGACGG - Intergenic
1076226096 10:128776961-128776983 GACAAGGAAAAGTGCTCACACGG - Intergenic
1076721616 10:132395793-132395815 GAGGAGGACAGACACTCACTGGG + Intergenic
1079571181 11:21945088-21945110 GATGGGCACAGGTACTGACAAGG + Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1082005166 11:47415178-47415200 GAAGAGGACTGCCACTCACAGGG + Intronic
1085271795 11:75274055-75274077 TAGGAGGGCAGGTCCTCACAGGG + Exonic
1087222161 11:95558242-95558264 GAGGAGAACAGTTACTCAAATGG - Intergenic
1090886664 11:130883027-130883049 GATGGGGACAGGACCTCACATGG + Intronic
1090974146 11:131667580-131667602 GACCAGGATTAGTACTCACATGG - Intronic
1101815686 12:108144310-108144332 GAGGAAGACAGGTGCTCCCATGG - Intronic
1102614860 12:114144760-114144782 GACTGGGACAGAGACTCACATGG - Intergenic
1105218725 13:18306298-18306320 GCTGAGGGCAGGTTCTCACATGG - Intergenic
1105356415 13:19663777-19663799 AAAGAGGACAGGTCCCCACAGGG - Intronic
1105706320 13:22969630-22969652 GACCAGGACAGGAGCTCAGAGGG + Intergenic
1105858970 13:24393088-24393110 GACCAGGACAGGAGCTCAGAGGG + Intergenic
1107815033 13:44237075-44237097 GAAGATGACAGGAACTCACTTGG - Intergenic
1113779304 13:112967020-112967042 GAAGAGGGCAGGTGCTCAGAGGG + Intronic
1115176697 14:30570027-30570049 GATGAGTACACATACTCACATGG - Intronic
1121598511 14:95185125-95185147 GAAGAGGGCAGGTGCTCACGTGG + Exonic
1129747793 15:78037174-78037196 GAGGAGGCCAGGGACTCCCAGGG - Intronic
1134127969 16:11629489-11629511 GCCGAGGACAGGTCCTCAGCAGG - Intronic
1136078146 16:27830996-27831018 GCCGAGGTCATGTGCTCACATGG - Intronic
1136448681 16:30339894-30339916 GCGGAGGGCAGGCACTCACAGGG + Intergenic
1136590223 16:31214158-31214180 AGCAAGGACAGGGACTCACAGGG - Exonic
1138947752 16:61872743-61872765 GAGGAGGGCAGGTACTCAGATGG + Intronic
1140674974 16:77319356-77319378 GAAGAGGACAGGAACCCAAATGG - Intronic
1142047181 16:87932969-87932991 GCGGAGGGCAGGCACTCACAGGG - Intronic
1143724349 17:8835229-8835251 GACGAGGGCTGGGACTGACAAGG + Intronic
1144729298 17:17517551-17517573 GACCAGGACATGTAGTCACCAGG + Intronic
1145316417 17:21737832-21737854 GACGCGGACACGTGCACACATGG - Intergenic
1149674591 17:58447764-58447786 AAGGAGGACAGGTACAAACAGGG + Intronic
1160495873 18:79374636-79374658 GACGAGGACAAGTGCACACGCGG - Intronic
1161048914 19:2151677-2151699 GACGACGACAGGTAGTCCAATGG + Intronic
1161681933 19:5684493-5684515 AAGGAGGACAGGTCCACACAGGG + Intronic
1161865919 19:6832197-6832219 GAGGAAGACGGGGACTCACATGG - Exonic
1164921830 19:32094027-32094049 GACCAGGACAGGTAATAACACGG + Intergenic
1166297939 19:41897753-41897775 GACGAGGACAGGGACAGAGACGG - Intronic
1167716424 19:51145109-51145131 GAAGAGGACAGGTGCTCAGGTGG - Intronic
932297487 2:70639211-70639233 GACGAAGAAAGTTATTCACAGGG + Intronic
934295590 2:91740332-91740354 GCTGAGGGCAGGTTCTCACATGG + Intergenic
937467285 2:122145555-122145577 GAAGAGGACAGATATTTACAGGG + Intergenic
946771307 2:223091954-223091976 GAGGAGGACAGGGAGTCACCAGG - Intronic
1169351888 20:4874557-4874579 GAAGAAGTCAGCTACTCACAGGG + Exonic
1171023521 20:21608298-21608320 GACGTGGAGAGGGACACACACGG - Intergenic
1173180275 20:40801352-40801374 AAAGAGGACAGGTAAGCACAAGG + Intergenic
1173207024 20:41003142-41003164 GCCGAGGACAGTTGCTCAAAGGG + Intergenic
1175897850 20:62347269-62347291 GTGGAGGACAGGGTCTCACAGGG + Intronic
1176227765 20:64011785-64011807 GAGGAGGACAGGAAGTCTCATGG + Intronic
1176227770 20:64011844-64011866 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227775 20:64011903-64011925 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227780 20:64011962-64011984 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227785 20:64012021-64012043 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227790 20:64012080-64012102 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227795 20:64012139-64012161 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227800 20:64012198-64012220 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227805 20:64012257-64012279 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227810 20:64012316-64012338 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227815 20:64012375-64012397 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227820 20:64012434-64012456 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227825 20:64012493-64012515 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227830 20:64012552-64012574 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227835 20:64012608-64012630 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227840 20:64012667-64012689 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227845 20:64012726-64012748 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227850 20:64012785-64012807 GAGGAGGACAGGAAGTCTCACGG + Intronic
1176227855 20:64012844-64012866 GAGGAGGACAGGAAGTCTCATGG + Intronic
1176227860 20:64012903-64012925 GAGGAGGACAGGAAGTCTCATGG + Intronic
1178411313 21:32365895-32365917 GGGGAGGACAGGTATTCAGAAGG - Intronic
1178596684 21:33960646-33960668 CACGAGGTCAGGAGCTCACAAGG - Intergenic
1183664750 22:39240836-39240858 GACGTGGAGAGGTACTTACGAGG + Intronic
1184776691 22:46626958-46626980 GACGAGGACAGGTACTCACAGGG - Exonic
1184777008 22:46628291-46628313 GACAAGGACAGGTACTCACAGGG - Intronic
950741429 3:15055209-15055231 GACTAGGACTCGTACTCCCATGG + Intronic
955571324 3:60309985-60310007 GACAAGGACACGTCTTCACAGGG + Intronic
960630528 3:119726078-119726100 GAAGAGGAAAGGAACTGACAGGG + Intronic
961483569 3:127200187-127200209 GTCGATGACAGGTACACACACGG + Intergenic
961509407 3:127391838-127391860 CTCGAGGACAGACACTCACATGG + Intergenic
961974666 3:131010586-131010608 AAGGGGGACAGGTACTCACATGG + Intronic
964747582 3:160026637-160026659 CACCAGGACAGGCACTCGCATGG + Exonic
970564807 4:17321427-17321449 GCCTATGACAGATACTCACATGG + Intergenic
971032222 4:22651969-22651991 GATGAGGACAGGGAGGCACAGGG + Intergenic
985589195 5:755947-755969 GGCGAGGGCGGGCACTCACACGG + Exonic
985603874 5:848463-848485 GGCGAGGGCGGGCACTCACACGG + Exonic
992070557 5:73144792-73144814 GACTAGAACAGTCACTCACATGG + Intergenic
999140095 5:149355293-149355315 GACAAGGCCAGGCAGTCACAAGG - Intergenic
1004535198 6:16493751-16493773 GAAGAGGACAGGTGTTCAAATGG + Intronic
1005582813 6:27250471-27250493 GACGAGGACAGGGTCTCCCTTGG + Intronic
1009767066 6:68091939-68091961 GACGAGGACAGGTACTTTTCTGG + Intergenic
1023247318 7:38219022-38219044 TAGGAAGGCAGGTACTCACAAGG + Intronic
1033894263 7:146052646-146052668 TACGAGGACAGGGATGCACAAGG - Intergenic
1040598135 8:48859813-48859835 GCCCAGGACAGGGGCTCACAAGG - Intergenic
1043527295 8:81111348-81111370 GGAGAGGACAGGTACTCCTAGGG - Intronic
1048923879 8:139253558-139253580 GAGGAGGACAGGTCTCCACATGG + Intergenic
1053138458 9:35666501-35666523 GAAGAGGACAGATAATCCCATGG + Intronic
1053374921 9:37597595-37597617 ACCGAGGACAGGTATTTACATGG + Intronic
1056401140 9:86228615-86228637 GATGGGGACAGGTCCTCTCAGGG - Intronic
1056815288 9:89796679-89796701 GAGGAGGCCAAGTGCTCACAGGG + Intergenic
1056847507 9:90053656-90053678 GACGAGGAAAGGTACAGAGATGG - Intergenic
1059457041 9:114406303-114406325 GAAGAGGACAGGGACCCCCAAGG + Intronic
1197265317 X:124362949-124362971 CAAGAGGTCAGCTACTCACAAGG + Intronic
1199846543 X:151695735-151695757 GGCGAGGACAGGCACTTTCAGGG + Intronic