ID: 1184777122

View in Genome Browser
Species Human (GRCh38)
Location 22:46628774-46628796
Sequence GCATCAGGGATCCCCTTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184777111_1184777122 5 Left 1184777111 22:46628746-46628768 CCTGGGGCAGAACATCTGGATTT No data
Right 1184777122 22:46628774-46628796 GCATCAGGGATCCCCTTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184777122 Original CRISPR GCATCAGGGATCCCCTTCGG GGG Intronic