ID: 1184778320

View in Genome Browser
Species Human (GRCh38)
Location 22:46634143-46634165
Sequence ACACTCCCCCAGCCCTCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 222}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184778320_1184778324 -8 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778324 22:46634158-46634180 GGGAGTGTGGCAGGTTCCCTCGG 0: 1
1: 0
2: 1
3: 28
4: 233
1184778320_1184778327 -3 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778327 22:46634163-46634185 TGTGGCAGGTTCCCTCGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 124
1184778320_1184778328 4 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778328 22:46634170-46634192 GGTTCCCTCGGTGGGGAGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 151
1184778320_1184778325 -5 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778325 22:46634161-46634183 AGTGTGGCAGGTTCCCTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 103
1184778320_1184778331 13 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778331 22:46634179-46634201 GGTGGGGAGCGAGGCTGCAGAGG 0: 1
1: 1
2: 8
3: 95
4: 670
1184778320_1184778333 27 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778333 22:46634193-46634215 CTGCAGAGGTGCCTGGCTGCTGG 0: 1
1: 0
2: 11
3: 51
4: 421
1184778320_1184778326 -4 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778326 22:46634162-46634184 GTGTGGCAGGTTCCCTCGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1184778320_1184778334 28 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778334 22:46634194-46634216 TGCAGAGGTGCCTGGCTGCTGGG 0: 1
1: 0
2: 6
3: 40
4: 341
1184778320_1184778332 20 Left 1184778320 22:46634143-46634165 CCTGCCGAGGGCTGGGGGAGTGT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1184778332 22:46634186-46634208 AGCGAGGCTGCAGAGGTGCCTGG 0: 1
1: 0
2: 3
3: 39
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184778320 Original CRISPR ACACTCCCCCAGCCCTCGGC AGG (reversed) Intronic
900494128 1:2968807-2968829 GCACTCTCCCAGGCCTCGCCAGG + Intergenic
900569768 1:3352431-3352453 CCCCTCCCCCAGCCCACTGCGGG - Intronic
900592996 1:3468113-3468135 ACACGCCCCCAGCTCCCAGCAGG - Intronic
901168590 1:7237313-7237335 CCATTCCCCCAGCCCTGGCCCGG - Intronic
901668551 1:10840177-10840199 ACACACACTCAGCCCTCTGCTGG - Intergenic
902696477 1:18143957-18143979 ACACAGCCCCAGCCCTGGGGAGG - Intronic
902862634 1:19257215-19257237 AGCCTCCCCCAGCCATTGGCAGG + Intronic
903023627 1:20411572-20411594 AAGCTCCCCCAGCCCCAGGCAGG - Intergenic
903223346 1:21881093-21881115 CCACTCCCCCATGCCTGGGCTGG - Intronic
904440534 1:30526692-30526714 ACCCTCTCCCAACCCTAGGCTGG - Intergenic
905338370 1:37260770-37260792 ACACACCACCACCCCACGGCAGG - Intergenic
906675025 1:47687324-47687346 ACACCCCACTAGCCCTTGGCTGG + Intergenic
907470493 1:54670667-54670689 ACCCGCCCCCACCCCTCGCCCGG + Intronic
907526296 1:55056102-55056124 GCACGACCCCAGCCCTCGCCAGG - Exonic
910266911 1:85347609-85347631 ACCCTCCCCCATCCCACGACAGG - Intronic
912804277 1:112743460-112743482 ACACTCGCCCCGCCCCAGGCTGG + Intergenic
915499046 1:156301864-156301886 ACACTGGCTCAGCCCTTGGCTGG - Intergenic
917535619 1:175872351-175872373 ACACAGCCCGTGCCCTCGGCGGG + Intergenic
918284914 1:183042795-183042817 TCACACCCCCAGCCCTCTCCTGG + Intronic
920171222 1:204073532-204073554 GCACGCCCCCCGCCGTCGGCCGG - Intronic
920284627 1:204870686-204870708 CCACTCACCCCTCCCTCGGCCGG - Intronic
920673841 1:208025284-208025306 CCCCTCCCCCAGCCCTCTCCTGG + Exonic
922620947 1:226987777-226987799 TCACTGCCCCAGCCCCCGGGAGG + Intergenic
922722123 1:227904558-227904580 ACACGGCCCCAGCCCTGGACTGG + Intergenic
923092769 1:230752578-230752600 CCCCTCCCCCAGCCTTCTGCAGG - Intronic
924557943 1:245133329-245133351 ACACTGCCCCAGCTCTCGGTGGG - Intergenic
1063677521 10:8154658-8154680 ACCCTCCCCCAGCCCTGCCCTGG - Intergenic
1067768884 10:49109351-49109373 TCCCTCCCCCAGCCCACCGCAGG - Intronic
1068054251 10:51991528-51991550 CCACTCCCCCAGCCCATGACAGG + Intronic
1071606954 10:87000922-87000944 CCACTCCCCCACCCCACGACAGG + Intergenic
1072260985 10:93672880-93672902 ACACTCCTCCCGCCCCTGGCAGG - Intronic
1073491379 10:103855418-103855440 ACCCTCCCCCGTCCCTGGGCCGG - Intronic
1073512504 10:104051615-104051637 ACACTCACACAGCCCTCACCTGG - Intronic
1074085817 10:110208342-110208364 ACACTCCCCCGCTCCTCCGCTGG - Intronic
1075113813 10:119609264-119609286 ACACTCCACAATCCCTTGGCTGG + Intergenic
1075683502 10:124348669-124348691 AGACACCCCCAGCCCTCTGCAGG + Intergenic
1075721885 10:124592325-124592347 TCACTCACCCAGCCCCGGGCTGG + Intronic
1075835006 10:125445494-125445516 ACAATCCCCCAGGCTTTGGCTGG - Intergenic
1075862042 10:125685090-125685112 ACCCTCCCCCTGCCCTGGCCAGG - Intergenic
1076454009 10:130576723-130576745 ATACTCCCCTCGCCCTCGGTGGG - Intergenic
1076811596 10:132889114-132889136 GCCCTCCCCCAGCACTCTGCAGG + Intronic
1076888472 10:133273106-133273128 ACGCTCCCCCAGCACTGGACAGG - Intronic
1077253396 11:1570632-1570654 ACACTCGTGCAGCCCCCGGCTGG + Intronic
1077408556 11:2393211-2393233 CCACTCCCCTATCCCTCAGCAGG - Intronic
1078470394 11:11581552-11581574 TGACACCCCCAGCCCTTGGCAGG + Intronic
1080457263 11:32428687-32428709 ACACCCCCCCCGCCCGTGGCTGG - Intronic
1084195680 11:67522728-67522750 CCACTGCCCCAGCTCACGGCCGG - Intronic
1084625687 11:70304634-70304656 CCACTCCCCCAGTCCTTTGCAGG - Intronic
1084711086 11:70844109-70844131 ACACACACCCAGCCCTCGCCTGG + Intronic
1085052123 11:73385211-73385233 CCACTCCCCCTCCCCTAGGCAGG - Intronic
1085083099 11:73649521-73649543 ACAGTCCCCCAACCCCGGGCTGG + Intronic
1086634618 11:89066011-89066033 ATACTCCCGCAGCGCGCGGCGGG + Intergenic
1088078713 11:105883424-105883446 CCCCTCCCCCACCCCACGGCAGG + Intronic
1089079055 11:115760997-115761019 TCACTCCCCCAGCACCCAGCAGG - Intergenic
1089656124 11:119948129-119948151 CCACGCACCCACCCCTCGGCTGG - Intergenic
1089702505 11:120254070-120254092 AGACTCCCCCAGCCCCAAGCTGG + Intronic
1090882813 11:130849115-130849137 ACATTCGCCCAGCCCATGGCTGG + Intergenic
1096478088 12:51920919-51920941 CCACCCCCCCAGCCCCCTGCAGG - Exonic
1097107687 12:56635020-56635042 CTCCTCCCCCAGCCCTGGGCCGG + Intronic
1097158286 12:57028341-57028363 ACACCCCCCCAGAGCTCAGCCGG + Intronic
1098283438 12:68884438-68884460 ACACTCCGCCTGCCCTTGCCAGG - Intronic
1101940745 12:109097736-109097758 ACACGCCCCCAGCCCCGAGCCGG + Exonic
1102097631 12:110252938-110252960 ACACTCAGCCATCGCTCGGCCGG + Intergenic
1103749684 12:123150599-123150621 TCCCTCCTCCAGCCCCCGGCGGG + Intergenic
1111654019 13:91130271-91130293 ACACCCATGCAGCCCTCGGCTGG - Intergenic
1112332816 13:98489687-98489709 ACACACCCCCTGCCCCAGGCTGG - Intronic
1113069186 13:106403060-106403082 AGAGTCTCCCAGACCTCGGCAGG + Intergenic
1113681450 13:112247775-112247797 CCACCCCCCCAACCCTCGCCTGG + Intergenic
1117097519 14:52313940-52313962 ACTCCCTCCCAGCCCTCTGCTGG + Intergenic
1117449842 14:55839739-55839761 AGCCTCCCCCAGCCCTCCGTGGG + Intergenic
1118313291 14:64708350-64708372 CCCCTCCCCCAGCCTCCGGCAGG + Intronic
1119228537 14:72962278-72962300 ACACTTCCCCAGCTATCAGCAGG + Intergenic
1119622106 14:76138927-76138949 AGGCTCCCCCAGGCCTCGCCGGG + Intergenic
1119720431 14:76886159-76886181 ACCATCCCCCATCCCTAGGCAGG - Intergenic
1123706015 15:22951596-22951618 ACACGCCCCCAGGCCTCTCCTGG - Intronic
1124597513 15:31102955-31102977 ACCCTCCCTCAGCCCCCGGAAGG - Intronic
1125757229 15:42071983-42072005 ACACTGCCCCTGCCCCCAGCAGG + Intronic
1126709375 15:51440721-51440743 ACACTGCCCAAGCCCTAGGTGGG + Intergenic
1128111273 15:65077653-65077675 AAACTCCAGCAGCCCGCGGCTGG - Exonic
1128497155 15:68205199-68205221 TCACGCCCCCAGCCCTGGCCAGG + Intronic
1129243788 15:74267838-74267860 ACCCTCCCCCATCCCTCCTCCGG + Intronic
1129378934 15:75153650-75153672 ACACACCCCCATCCCAAGGCTGG + Intergenic
1129653898 15:77510238-77510260 CCACACCCCCAACCCTCGGGAGG + Intergenic
1131266121 15:90916321-90916343 ACGCTCCTCGAGCCCTAGGCTGG - Intronic
1132503727 16:296629-296651 AGCCTTCCCCAGCCCTCAGCAGG + Intronic
1132570068 16:640687-640709 ACACTGGCCCAGGCCTCTGCAGG + Intronic
1132646187 16:1000329-1000351 GCACTCCCCGTGGCCTCGGCTGG + Intergenic
1132943365 16:2519422-2519444 GCAGTCCTCCAGCCCTGGGCAGG - Intronic
1135544954 16:23359397-23359419 CTATTTCCCCAGCCCTCGGCAGG + Intronic
1136146267 16:28318247-28318269 ACACAGCCCCAGCCCCTGGCTGG - Intronic
1136501117 16:30670037-30670059 CTCCTCCCCCAGCCCTCGGAGGG - Exonic
1136911217 16:34146143-34146165 ACCCTCCCCCAACCCCCGACTGG + Intergenic
1139283235 16:65787570-65787592 AAACTTCCCCAGCCCAGGGCTGG + Intergenic
1140415415 16:74770744-74770766 ACACTAGCCCAGCCCTCCACTGG - Intronic
1140664115 16:77212835-77212857 AGCCTCACCCAGCCCCCGGCAGG + Exonic
1143682694 17:8489182-8489204 ACGCTCCTCCAGCCCTGGTCAGG + Intronic
1143697182 17:8629909-8629931 ACCCTCCCCACGCCCGCGGCCGG + Intronic
1143772433 17:9177264-9177286 TCACTCCGCCAGACCTCAGCTGG + Intronic
1144501902 17:15795458-15795480 CCACTCCCCCACCCCACGACAGG + Intergenic
1147142803 17:38468767-38468789 ACACTGCCCCTGCCCTCAGGAGG + Intronic
1147988833 17:44321325-44321347 ACACCCCCCTATCCCTAGGCTGG + Intronic
1148124831 17:45231259-45231281 ACCCTCTCCCAGCGCTGGGCTGG + Intronic
1148480578 17:47957296-47957318 TCCCTCCCCCATCCCTCTGCAGG + Intronic
1151558829 17:74860334-74860356 TCGGTCCCCCAGCCCTCGGATGG - Intronic
1151655965 17:75496139-75496161 ACACACCCCCAGCCCCACGCAGG - Intronic
1151679657 17:75616646-75616668 ACAGTCCCCCTGCCTTGGGCTGG - Intergenic
1151969372 17:77450046-77450068 ACACTCCCCCGGCTCTGGCCTGG + Intronic
1152161920 17:78674368-78674390 AAACACGCCCAGACCTCGGCAGG + Exonic
1152229389 17:79106900-79106922 CCTCTCCCCCATCCCTGGGCTGG + Intronic
1152236427 17:79141401-79141423 ACCCTCCCGGAGCCCTAGGCAGG - Intronic
1152799005 17:82322489-82322511 GCACACTCCCAGCCCTCGCCTGG + Intronic
1158522872 18:58186242-58186264 CCACTCCCTCTGCCCTCTGCAGG + Intronic
1160945974 19:1644275-1644297 CCACTCCCCCAGGCCCCTGCAGG - Intronic
1161060254 19:2211154-2211176 GCACTCCCCCAACCCGCTGCTGG + Exonic
1161308242 19:3578837-3578859 ACCCACCCCCAGCACACGGCAGG + Exonic
1162307708 19:9885427-9885449 ACACTCCCCCAGCCCTAACGAGG - Intronic
1162370356 19:10275091-10275113 AGATTCCCCCAGGCCTCTGCAGG - Intronic
1162644153 19:12036198-12036220 CCACCCCCCCAGCCCACCGCCGG - Intronic
1163463824 19:17455078-17455100 ACCCCCCCCCAACCCTCCGCCGG + Intronic
1164813306 19:31175201-31175223 ACAGCCAGCCAGCCCTCGGCCGG + Intergenic
1166765361 19:45249776-45249798 AAACACCCCCAGCTCTCTGCAGG + Intronic
1167336295 19:48888093-48888115 CCGCTCCCCCTGCCCTGGGCTGG - Exonic
1168401087 19:56086779-56086801 CCTCTCCCCCAGCCCCTGGCTGG + Intergenic
925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG + Intergenic
925153459 2:1633319-1633341 ACACACCCTTGGCCCTCGGCAGG + Exonic
925359872 2:3270310-3270332 ACACACCCCAGGCCCTCTGCGGG - Intronic
927567898 2:24129960-24129982 CCTCACCCCCAGCCCTCGACTGG + Intronic
927721270 2:25384131-25384153 GCACGCCCCCAGCCCTGGTCAGG - Intronic
929825911 2:45309618-45309640 ACCCTGCCCCAGCCCTGGCCAGG - Intergenic
930520244 2:52456861-52456883 TCAGTTCCCCAGCCCTCTGCAGG + Intergenic
933992638 2:87644441-87644463 CCCCTCCCCCAGCCCCTGGCAGG + Intergenic
934716502 2:96547598-96547620 ACACTCCCCAAGCTCTCAGGAGG + Intronic
936301215 2:111306400-111306422 CCCCTCCCCCAGCCCCTGGCAGG - Intergenic
936351183 2:111713741-111713763 CCACTCCCCCACCCCACGACAGG - Intergenic
936407833 2:112223102-112223124 CCACTCCCCCACCCCACGACAGG - Intronic
937258891 2:120572999-120573021 ACCCACCCCCAGCCCCTGGCAGG + Intergenic
937436806 2:121887909-121887931 TAACTTCCCCACCCCTCGGCCGG - Intergenic
938254712 2:129847530-129847552 GCCCTGCCCCAGCCCTGGGCAGG + Intergenic
941805827 2:169711651-169711673 CCACTCCCTCAGCCCTCAGTTGG - Intronic
944251518 2:197583775-197583797 CCACTCCCCCACCCCACGACAGG + Intronic
948348965 2:237322743-237322765 AAACTCCTTCAGCCCTCTGCTGG + Intergenic
948401968 2:237691664-237691686 ACCCTCGCCCAGCCCCGGGCAGG + Intronic
949057577 2:241936834-241936856 CCTCTCCCGCAGCCCTCGGAGGG + Intergenic
1169351554 20:4872328-4872350 GTACCCCACCAGCCCTCGGCAGG + Intronic
1171121758 20:22574901-22574923 CCACTCCCCCCGCCCCCCGCAGG - Intergenic
1175554156 20:59835941-59835963 ACACTCCCCCTGTGCTGGGCTGG + Intronic
1176063491 20:63182430-63182452 ACACATCCCCAGCCCCGGGCTGG - Intergenic
1177782922 21:25639596-25639618 ACAGACCCCCATCCCTGGGCTGG + Exonic
1179178034 21:39022706-39022728 ACACTCACCCAGCCCCCTCCTGG - Intergenic
1179826312 21:43968300-43968322 ACTCACCCCCAGCCCTCCCCAGG - Intronic
1179950852 21:44708176-44708198 TCCCTCCCCCAGCCCCCAGCAGG + Intronic
1180949312 22:19714191-19714213 ACGCTCCCCCCGCCCTCGCTGGG - Intergenic
1181085606 22:20438034-20438056 TCCCTCCACCAGCGCTCGGCGGG - Intronic
1182023781 22:27101627-27101649 GCACTGCCCCATCCCTGGGCTGG + Intergenic
1184490719 22:44807237-44807259 ACCCTCCACCAGCACTCTGCAGG - Intronic
1184778320 22:46634143-46634165 ACACTCCCCCAGCCCTCGGCAGG - Intronic
1185169832 22:49286236-49286258 ACACTCCCCCGGCCCTCCAGGGG - Intergenic
950217874 3:11172336-11172358 ACACTGCCCCAGCCCTCAGAGGG + Intronic
950270437 3:11610457-11610479 GCAATCCCCCAGCCCTTGGGTGG + Intronic
951558620 3:23945221-23945243 TCCCTCCGCCCGCCCTCGGCCGG - Intronic
953777009 3:45828105-45828127 ACAGTCCCTCATCCCTCTGCAGG + Intronic
954138816 3:48594734-48594756 GCACACCCCCAACCCTCCGCGGG - Intronic
954410014 3:50366430-50366452 TCACTCCCCCAGTCCTGGGAAGG + Intronic
956460365 3:69465538-69465560 CCAGTCCCCCAGCCCCCGACAGG + Intronic
961390672 3:126550713-126550735 CCACTCCCCCAGCCCTGGCATGG + Intronic
961658658 3:128456991-128457013 ACCCTCCCCCAGCCCCCTCCAGG + Intergenic
962679409 3:137783184-137783206 ATAAGCCCCTAGCCCTCGGCTGG - Intergenic
966866735 3:184262384-184262406 AGACACCCCCAGCCCTAGTCCGG + Intronic
967452776 3:189645653-189645675 CCACTCCCCCACCCCACGACAGG + Intronic
968554971 4:1242246-1242268 ACGATCGCCCAGCCCTCGGGAGG + Intronic
970523414 4:16908182-16908204 CCACTCCCCCAGCCCGGGGCAGG + Intergenic
974047293 4:56908412-56908434 AAACGCCCCCAGCCCCCGGGCGG - Intronic
978409999 4:108416081-108416103 AACCTCACCCAGCCCTAGGCAGG - Intergenic
980431102 4:132697509-132697531 ACAGTCCCCCAACCCCCGACAGG + Intergenic
980930080 4:139176780-139176802 CCCTTCCCCCAGCCCCCGGCCGG + Intronic
982574799 4:157096173-157096195 TCACACCCCCATTCCTCGGCAGG + Intronic
982932764 4:161429266-161429288 AGTTTCCCCCAGCCCTGGGCAGG - Intronic
985557950 5:567097-567119 CCACTCTCCCGCCCCTCGGCAGG - Intergenic
985680533 5:1253535-1253557 ACACTCGCTCAGGCCTCAGCCGG + Exonic
987302116 5:16606357-16606379 ACTCTCCCCCAGCTCTCCCCAGG + Intronic
987973114 5:24976853-24976875 CCACTCCCCCAACCCACGACAGG + Intergenic
990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG + Intergenic
990618359 5:57531050-57531072 TCCCTCCCCCAGCCCCCGACAGG - Intergenic
991594523 5:68288888-68288910 ACACTCCCCCTGTCCTCGAGGGG + Intronic
993287316 5:86016130-86016152 CTCCTCCCCCAGCCCTTGGCTGG - Intergenic
997361460 5:133297892-133297914 ACAGTCCCCCATCCCTCATCTGG + Intronic
998868261 5:146527592-146527614 ACACCCCCGCAGCCCTCCGAGGG - Intergenic
999223186 5:149998569-149998591 ACAGTCCCCCTGCCCTACGCTGG + Intronic
999255148 5:150205872-150205894 ACACACCCCCAACCCACGGTGGG - Intronic
999758408 5:154682493-154682515 CCAGTCCCCCAGGCCTCCGCTGG + Intergenic
1003178539 6:3771954-3771976 ACACTCCCTCAGCCCTTGGGCGG - Intergenic
1005360509 6:25027317-25027339 ACAGCCACCCAGCCCTCTGCGGG + Intronic
1007844068 6:44739419-44739441 CCACAGCCCCAGCGCTCGGCTGG - Intergenic
1008591638 6:52999276-52999298 TCACTCCCCCACCCCCCGACTGG - Intergenic
1012544576 6:100403306-100403328 ACAGTCCCCCAGCTCTCCCCTGG + Intronic
1012937569 6:105384158-105384180 TCCCTCCCCCAGACCACGGCTGG + Intronic
1013323452 6:109019359-109019381 AGATTCCCCCAGCACTCTGCTGG - Intronic
1015149437 6:130020550-130020572 CGACGCCCCCAGCCCTCCGCGGG - Intronic
1019296958 7:282719-282741 ACCCTCCCCCAGCGCTCAGCAGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1021240285 7:18192112-18192134 ACACCCCCCCGCCCCCCGGCCGG - Intronic
1023284419 7:38604482-38604504 ACACTGCCCCAGCCCTGCACAGG + Intronic
1024524388 7:50336248-50336270 ACCCTCCCCCTGCCCCCGCCGGG - Intronic
1026371400 7:69703278-69703300 AACCTCCCCCAGCCCTTGACTGG + Intronic
1026641488 7:72130057-72130079 ACACTCCCCCACCCCCCACCAGG + Intronic
1032459861 7:132102575-132102597 ACCCTACCCCCGCCCTCCGCGGG + Intergenic
1035220335 7:157402618-157402640 CCACTCCCACAGCCCTCCCCTGG - Intronic
1035224267 7:157424955-157424977 ACCCTCCCCCAGCTCAAGGCAGG - Intergenic
1035753971 8:2017495-2017517 AGTTTCCCCCAGCCCTGGGCAGG + Intergenic
1037911325 8:22745334-22745356 TCACTCCCCCAATCCTCTGCGGG - Intronic
1038008708 8:23457305-23457327 GCGCTCCCCCAGCCCCTGGCAGG - Intronic
1039399932 8:37260953-37260975 ACACTCCCACCTCCCTCGGAGGG - Intergenic
1039808591 8:41024834-41024856 CCACTCCCCCAACCCCCGGCAGG - Intergenic
1039917316 8:41869704-41869726 AAGCACCCCCAGGCCTCGGCAGG - Intronic
1045117869 8:99003424-99003446 AAACTCCCTCAGCCACCGGCAGG - Intergenic
1048152153 8:131904331-131904353 CAACGCCCCCGGCCCTCGGCCGG - Intronic
1049448205 8:142641332-142641354 ACACCTCCCCTGCCCTCTGCAGG + Intergenic
1049457544 8:142701092-142701114 TCACTTCCACAGCCGTCGGCCGG + Intronic
1049478263 8:142806893-142806915 ACAGTCCCCCAGGCCTGGCCTGG - Intergenic
1049989178 9:976407-976429 CCGCTACCCCAGCCCGCGGCTGG - Intergenic
1050775418 9:9253888-9253910 ACTCTCCCCAAGCCCTCTGCAGG - Intronic
1052263728 9:26547768-26547790 CCAGTCCCCCAGCCCCCGACAGG - Intergenic
1057726800 9:97573721-97573743 ACACTCCAACAGCCCTAGGCCGG - Intronic
1058840519 9:108903224-108903246 ACCCTCCCCCACCCCACGACAGG + Intronic
1059594916 9:115709220-115709242 CCATTCCCCCACCCCACGGCAGG - Intergenic
1060930977 9:127489414-127489436 ACAGACCACCAGCCCTCAGCAGG - Intronic
1061083619 9:128386613-128386635 ACACGGCCCCAGCCTTGGGCAGG - Intronic
1061401482 9:130370719-130370741 AGTCTCCCCAAGCCCTCAGCGGG - Intronic
1061484650 9:130914215-130914237 ACCCTCCCCCAGCCCTCCCGAGG + Intronic
1185482197 X:455175-455197 ACAGCCCCACAGCCCTCGACAGG - Intergenic
1185604360 X:1359337-1359359 ACCCTCCCCCAGCCCCTGCCTGG + Intronic
1188207910 X:27381666-27381688 CCACTCCACTAGCCCTTGGCAGG + Intergenic
1190789553 X:53686358-53686380 CCCCTCCCCCAGGCCTCGGCAGG - Intronic
1197025073 X:121738371-121738393 ATATTCCCCCAGCCCTGGCCTGG - Intergenic
1200000945 X:153059471-153059493 AAACTCCCCCAGCCCTGAGCTGG + Intronic