ID: 1184779402

View in Genome Browser
Species Human (GRCh38)
Location 22:46638968-46638990
Sequence GTGCGCTCACCTGGTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184779399_1184779402 3 Left 1184779399 22:46638942-46638964 CCTTGGTTACCAGTGCTCTCATG 0: 1
1: 0
2: 2
3: 14
4: 117
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131
1184779400_1184779402 -6 Left 1184779400 22:46638951-46638973 CCAGTGCTCTCATGTCTGTGCGC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131
1184779397_1184779402 9 Left 1184779397 22:46638936-46638958 CCCTGTCCTTGGTTACCAGTGCT 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131
1184779398_1184779402 8 Left 1184779398 22:46638937-46638959 CCTGTCCTTGGTTACCAGTGCTC 0: 1
1: 1
2: 0
3: 19
4: 168
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184779402 Original CRISPR GTGCGCTCACCTGGTGCTCA AGG Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
903066825 1:20704306-20704328 CTGCGCTCACATGGGGCTGAGGG + Intronic
905816147 1:40952593-40952615 GGGCACTCACCTGGCGCTCTCGG - Intergenic
907911062 1:58826397-58826419 GTGAGGTCATCTGATGCTCAAGG - Intergenic
913521294 1:119647902-119647924 GTCCGCTCCCCTGGGGCGCAGGG - Intergenic
914490214 1:148146909-148146931 TCGCCCTCACCTGGTGCGCAGGG - Intronic
916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG + Intronic
921390322 1:214608304-214608326 TTGCCCTCACCTGGTGCGCAGGG + Intronic
921594721 1:217041979-217042001 GAGCCCTCACATGGTACTCATGG - Intronic
922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG + Intergenic
1062760299 10:12277-12299 GTGCGCACACCTGGAGGTGAAGG + Intergenic
1067437343 10:46287393-46287415 GTGGGCTCTCCTGGAGCCCAGGG - Exonic
1067441277 10:46310355-46310377 GTGCTCTGTCCTGGTGCTCCAGG + Intronic
1071518382 10:86314218-86314240 CTGCTTTCAGCTGGTGCTCAGGG + Intronic
1074772888 10:116744726-116744748 GTGGTCTCACCTAGTTCTCATGG + Intergenic
1076378390 10:130008319-130008341 GTGAGCAAAACTGGTGCTCATGG - Intergenic
1077525278 11:3060506-3060528 GTTCACTCACCTGCTGCCCATGG - Intergenic
1078515602 11:12019480-12019502 GTGTGCTCAGCTGGGGCTCATGG + Intergenic
1094807892 12:34108834-34108856 GTGCGCACACCTGGGGGTGAAGG + Intergenic
1096520665 12:52182836-52182858 GTCCTCTCCCCTGGGGCTCAGGG - Intronic
1096953064 12:55495666-55495688 GTGTGCTGGCCTGGTACTCAGGG - Intergenic
1102415608 12:112759904-112759926 CTGCTCTCAGCTGGTTCTCAGGG - Intronic
1102571925 12:113831960-113831982 GTGCGCCCAAGTGGTGCACATGG - Intronic
1104368740 12:128203075-128203097 GTGCTCACACCTGGTGCCAACGG - Intergenic
1104929190 12:132329338-132329360 GCGCGCTGAGCTGGTGCTGAAGG - Intronic
1118642430 14:67805239-67805261 GTGGGCTCACCTGGAGGTCCTGG - Exonic
1118767710 14:68921255-68921277 GTGTGCTCACACGCTGCTCAGGG + Intronic
1122273363 14:100578240-100578262 GTGAGCTCCCATGGTGCACAGGG + Intronic
1122822010 14:104352310-104352332 GCGCCTTCTCCTGGTGCTCACGG + Intergenic
1124291761 15:28457602-28457624 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1128161283 15:65424172-65424194 GTGATCTCATCTGGTCCTCAAGG + Intergenic
1129719100 15:77868167-77868189 GTGCTTTATCCTGGTGCTCATGG - Intergenic
1129747507 15:78034680-78034702 GTGCTCTCACCTGCAGCTGAGGG + Intronic
1132554688 16:567279-567301 ATGAGCTCATCTGGGGCTCAGGG + Intronic
1132982621 16:2746279-2746301 CTGCATTCTCCTGGTGCTCAAGG - Intergenic
1135272993 16:21085024-21085046 TTGCTGTCAGCTGGTGCTCACGG - Intronic
1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG + Intronic
1136579756 16:31144034-31144056 ATGCACTCCCCTGGTGCTCTTGG - Intronic
1136707019 16:32200061-32200083 TCGCCCTCACCTGGTGCGCAGGG - Intergenic
1136760891 16:32729356-32729378 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1136807212 16:33141030-33141052 TCGCCCTCACCTGGTGCGCAGGG - Intergenic
1138207343 16:55134578-55134600 CAGCTCTCACCTGGGGCTCAGGG - Intergenic
1139334378 16:66220922-66220944 GCTTGCTCAGCTGGTGCTCAGGG - Intergenic
1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG + Intronic
1203063043 16_KI270728v1_random:989670-989692 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1143670211 17:8391740-8391762 GTGCCCTCAGCTGCTCCTCAAGG - Exonic
1144810131 17:17993734-17993756 GTGGGATCACCTGGGGCACATGG + Intronic
1145190806 17:20841512-20841534 TCGCCCTCACCTGGTGCGCAGGG - Intronic
1146242671 17:31244541-31244563 CAGAGCTCAGCTGGTGCTCAAGG - Intronic
1148100892 17:45090525-45090547 GTGCACTCACCTGGTTTCCATGG + Intronic
1148856260 17:50580736-50580758 GTCCGCATACCTGGTGCTGAGGG + Intronic
1149833717 17:59893529-59893551 CTGCGCTGACCTGGGGCTAAGGG - Intronic
1150621541 17:66811675-66811697 ATGCTCTCCCCTCGTGCTCATGG + Intergenic
1152743178 17:82027432-82027454 GCCCGCTCACCTGCTGCTCTTGG - Exonic
1152953207 18:12631-12653 GTGCGCACACCTGGAGGTGAAGG + Intergenic
1154042180 18:10866679-10866701 ATGCTCTCACCTGGTGACCAGGG + Intronic
1160995398 19:1879911-1879933 TCGCCCTCACCTGGTGCGCAGGG + Exonic
1161267458 19:3370939-3370961 GTGCGCCCAGCGTGTGCTCATGG - Intronic
1161319572 19:3634685-3634707 CTGGGCTCACCTGGAGCACAAGG - Intronic
1163632869 19:18426071-18426093 CTGCCCCCACCTGGTCCTCATGG - Intronic
1165066618 19:33232854-33232876 GTGGTCTCCCCTGGTTCTCATGG + Intergenic
1165161178 19:33817377-33817399 TTGCCCTCACCTGGAGATCAGGG + Intergenic
1165831093 19:38730820-38730842 ATGGGCGCACCTGCTGCTCAGGG - Exonic
925265572 2:2564157-2564179 ATGCTCTCACCTGGTTATCAGGG + Intergenic
926304946 2:11631141-11631163 GTGCATGCAGCTGGTGCTCATGG - Intronic
926310282 2:11669952-11669974 GTCCGCGCACGTGGTGCTGAAGG - Exonic
926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG + Intergenic
935413318 2:102788404-102788426 GTGTGCTCACCTGGTCCCCTGGG + Intronic
936271418 2:111052294-111052316 GTGTGCTCTCATGGTGCTGAAGG - Intronic
936863878 2:117055662-117055684 GTGCGCTCCCCTAGAGCTCCGGG - Intergenic
937043987 2:118841492-118841514 GTGCGCCCACCTCGGGTTCAAGG + Intergenic
937337629 2:121071585-121071607 GTGCACCCACCTGGTGCTGATGG - Intergenic
938794390 2:134705894-134705916 GTGGGCTCATCTCATGCTCAGGG - Intronic
940468689 2:154064979-154065001 GTGGGCTCCCCTGTGGCTCAAGG - Intronic
940515963 2:154684304-154684326 CTGCCCTGACCTAGTGCTCATGG - Intergenic
948738972 2:240030566-240030588 CTGCTCTCTCCTGGTGCTCTGGG - Intergenic
948869918 2:240792619-240792641 GCCCTCACACCTGGTGCTCAAGG - Intronic
1169665317 20:8027858-8027880 GTGTTCTCATCTGGAGCTCAGGG - Intergenic
1175363215 20:58431505-58431527 GTGGGCTCACCTGGGTCCCATGG - Intronic
1175583782 20:60121374-60121396 GTGCACAGAGCTGGTGCTCAGGG - Intergenic
1176906102 21:14503438-14503460 GTGATCTCACCTGAGGCTCAGGG - Intronic
1179482779 21:41689096-41689118 GTGGGCTGACCTGGTGATGAGGG - Intergenic
1181121471 22:20670451-20670473 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1181334430 22:22117475-22117497 TCGCCCTCACCTGGTGCGCAGGG + Intergenic
1182512087 22:30826837-30826859 GTGCACTCCCCTGGTGCACTGGG + Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
949943245 3:9170965-9170987 GTGCGCTGTCCTGCTGCTGAGGG - Intronic
956450183 3:69366454-69366476 GTGATCTCACCTCGTGATCATGG + Intronic
962654931 3:137533458-137533480 GAGCCCTCTCCTGGGGCTCATGG - Intergenic
968577532 4:1374879-1374901 GGGTGCTCACATGGTCCTCAAGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
971149336 4:24014556-24014578 GTGTTCTCATCTGGAGCTCAGGG + Intergenic
972613115 4:40673442-40673464 GTGTCCTCACCTAGAGCTCAGGG + Intergenic
974236560 4:59188811-59188833 GTGACCTCACCTGAGGCTCAGGG - Intergenic
978074033 4:104506941-104506963 GTGCTCTCAAATGGTGATCATGG + Intergenic
990214517 5:53515335-53515357 GTGGTCTCATCTGGAGCTCAGGG + Intergenic
997379971 5:133428610-133428632 GTGTGACCACTTGGTGCTCAGGG - Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1004981635 6:21031103-21031125 GTGCTCTCATCTTGGGCTCAGGG + Intronic
1005670957 6:28105574-28105596 GAGACCACACCTGGTGCTCAGGG - Intergenic
1006378754 6:33685707-33685729 GTTCGCTCACCTCGTGCCCCCGG - Exonic
1006378851 6:33686241-33686263 GACAGCTCACCTGGTTCTCATGG - Exonic
1008542612 6:52558274-52558296 CTGCTCCCACCTGGTGCTCCCGG - Intronic
1016772977 6:147872660-147872682 GGGGACTGACCTGGTGCTCATGG + Intergenic
1018899473 6:168043967-168043989 ATGCCCACACCTGCTGCTCACGG - Intronic
1019135993 6:169908001-169908023 GAGACCCCACCTGGTGCTCAGGG + Intergenic
1019670346 7:2274685-2274707 GAGCGCTCCCATGGTGCCCATGG + Intronic
1022456812 7:30564864-30564886 GTGGGCTGACCTGGTGGTCCTGG - Intergenic
1023062920 7:36346164-36346186 GAACGCTCACATGCTGCTCATGG + Intronic
1023283249 7:38592766-38592788 GTGGTCTCACCTGGTGATCCTGG + Intronic
1024959986 7:54963954-54963976 ATTCGCTCGCCTGGTTCTCAGGG + Intergenic
1028475395 7:91248082-91248104 GGGCCTTCACCTGCTGCTCAGGG + Intergenic
1033658399 7:143388219-143388241 GTGCGCTCCCCTGGGGCCCCAGG + Exonic
1036616764 8:10393819-10393841 GTGTGCACACGTGGTGCACAGGG - Intronic
1038035519 8:23683034-23683056 GCGGGGTCACCTGGGGCTCAGGG - Intergenic
1049622183 8:143603519-143603541 CTGAGCTCACCTAGTGCCCAGGG + Intergenic
1049834001 8:144721346-144721368 GTGAGCCCAGCTGGTGCTCTGGG - Exonic
1050151214 9:2621535-2621557 GCGCGTTCGCCTGGGGCTCACGG - Intergenic
1057079302 9:92160325-92160347 CTGCGCCCACCTGGAGGTCAGGG - Intergenic
1057176625 9:93004859-93004881 GTCCCTTCACCTGTTGCTCAGGG + Intronic
1058071777 9:100608790-100608812 ATTGGCTCACCTGGTTCTCAGGG - Intergenic
1059802179 9:117761437-117761459 ACTCACTCACCTGGTGCTCATGG - Intergenic
1060130520 9:121093362-121093384 GAGCACTGACCTGATGCTCAAGG + Intronic
1060733569 9:126052451-126052473 CAGGGCTCACCTGGTCCTCAAGG - Intergenic
1061221297 9:129253720-129253742 CTGCGCTCACCAGGTGCCCGAGG + Intergenic
1062192375 9:135254624-135254646 TTGGGCTCAGCTGGTGCCCAGGG + Intergenic
1062211049 9:135364310-135364332 GAGCGCTCAGCGAGTGCTCAGGG + Intergenic
1062290421 9:135791915-135791937 CAGTGCCCACCTGGTGCTCAGGG - Intronic
1062428986 9:136518561-136518583 CTGCGCCCACCTGGGCCTCAAGG + Intronic
1194142543 X:90222868-90222890 CTGCGGTCACCTGGTGACCAGGG + Intergenic
1195172253 X:102281090-102281112 GTGGGCTCCCCTGTGGCTCAGGG + Intergenic
1195186607 X:102406003-102406025 GTGGGCTCCCCTGTGGCTCAGGG - Intronic
1197623520 X:128778934-128778956 GTGGGCTCCCCTGTGGCTCAAGG + Intergenic
1199034353 X:143032997-143033019 CTGCGGTCACCTGGTGACCAGGG + Intronic
1199388106 X:147246938-147246960 GTGATCTCATCTGGGGCTCAAGG - Intergenic
1199746010 X:150772318-150772340 CTGACCTCACCTGGTGCTCATGG - Intronic
1199995440 X:153021780-153021802 GAGGGCTCGCCAGGTGCTCAGGG + Intergenic
1200448649 Y:3297450-3297472 CAGAGCTCAGCTGGTGCTCATGG + Intergenic
1200488296 Y:3791969-3791991 CTGCGGTCACCTGGTGACCAGGG + Intergenic