ID: 1184779402

View in Genome Browser
Species Human (GRCh38)
Location 22:46638968-46638990
Sequence GTGCGCTCACCTGGTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184779399_1184779402 3 Left 1184779399 22:46638942-46638964 CCTTGGTTACCAGTGCTCTCATG 0: 1
1: 0
2: 2
3: 14
4: 117
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131
1184779397_1184779402 9 Left 1184779397 22:46638936-46638958 CCCTGTCCTTGGTTACCAGTGCT 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131
1184779400_1184779402 -6 Left 1184779400 22:46638951-46638973 CCAGTGCTCTCATGTCTGTGCGC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131
1184779398_1184779402 8 Left 1184779398 22:46638937-46638959 CCTGTCCTTGGTTACCAGTGCTC 0: 1
1: 1
2: 0
3: 19
4: 168
Right 1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG 0: 1
1: 0
2: 2
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184779402 Original CRISPR GTGCGCTCACCTGGTGCTCA AGG Intronic