ID: 1184782939

View in Genome Browser
Species Human (GRCh38)
Location 22:46658179-46658201
Sequence TCCGGAGCTCCTCCTCTATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184782939_1184782944 12 Left 1184782939 22:46658179-46658201 CCCCATAGAGGAGGAGCTCCGGA 0: 1
1: 0
2: 3
3: 15
4: 82
Right 1184782944 22:46658214-46658236 AAACCAACGCGGAGATGCTGCGG 0: 1
1: 0
2: 1
3: 8
4: 78
1184782939_1184782947 22 Left 1184782939 22:46658179-46658201 CCCCATAGAGGAGGAGCTCCGGA 0: 1
1: 0
2: 3
3: 15
4: 82
Right 1184782947 22:46658224-46658246 GGAGATGCTGCGGCAGGAGCTGG 0: 1
1: 0
2: 4
3: 76
4: 759
1184782939_1184782943 1 Left 1184782939 22:46658179-46658201 CCCCATAGAGGAGGAGCTCCGGA 0: 1
1: 0
2: 3
3: 15
4: 82
Right 1184782943 22:46658203-46658225 GCTGCGAGAAGAAACCAACGCGG 0: 1
1: 0
2: 0
3: 5
4: 77
1184782939_1184782946 16 Left 1184782939 22:46658179-46658201 CCCCATAGAGGAGGAGCTCCGGA 0: 1
1: 0
2: 3
3: 15
4: 82
Right 1184782946 22:46658218-46658240 CAACGCGGAGATGCTGCGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184782939 Original CRISPR TCCGGAGCTCCTCCTCTATG GGG (reversed) Exonic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
902462955 1:16592891-16592913 TCCAGAGCTCTTCCTCTATGTGG + Intronic
903066563 1:20702955-20702977 CCCTGAGCTGCTCCTCTGTGTGG - Intronic
903158564 1:21467841-21467863 TCCAGAGCTCTTCCTCTATGTGG - Intronic
903287275 1:22285088-22285110 TCCAGACCGCCTCCTCCATGCGG - Intergenic
911662891 1:100523455-100523477 TCCGGGGCTGGTGCTCTATGGGG - Intergenic
913640118 1:120804698-120804720 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
914212394 1:145591930-145591952 TCCAAAGCTCTTCCTCTATGTGG + Intergenic
914278356 1:146145639-146145661 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914539403 1:148596587-148596609 TCCAAAGCTCTTCCTCTATGTGG + Intronic
914627276 1:149475041-149475063 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
914940389 1:152017763-152017785 TCCAAAGCTCTTCCTCTATGTGG - Intergenic
916257126 1:162800508-162800530 TCCAGAGCTCTGTCTCTATGAGG + Intronic
920367334 1:205455148-205455170 GCCAGAGCTCCTCCTCCAGGTGG + Intronic
921836588 1:219784802-219784824 TCTGGAGGGCCTCCTTTATGGGG + Intronic
1066696219 10:38080289-38080311 TCCTGAACTCCTGCTCTGTGAGG + Intergenic
1066723583 10:38366200-38366222 TCCAGAGCTCTGTCTCTATGAGG + Intergenic
1066996309 10:42567228-42567250 TCCTGAACTCCTGCTCTGTGAGG - Intergenic
1068676438 10:59774397-59774419 CTCTGAGCTCCTCCTCTAAGGGG - Intergenic
1074327792 10:112469830-112469852 TCTGGAGCTCCTTCTCTTTGTGG + Intronic
1075052262 10:119191524-119191546 TCTGGGGCTCCTCTTCAATGAGG - Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1084582755 11:70034323-70034345 TCCTGAGCCCCTCAGCTATGAGG - Intergenic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1096006972 12:48181349-48181371 ACCATAGCTCCTCCTGTATGGGG + Intergenic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1112285968 13:98104669-98104691 CCCTGAGCACCTCCTCTATGGGG - Intergenic
1115026973 14:28757292-28757314 TGCAGAGCTCTTCCTCTAGGTGG + Intergenic
1115755149 14:36521425-36521447 TCAGGAGCTCCTTCTCTACAAGG - Intergenic
1126473901 15:49046393-49046415 TCCGGACCTCCGCCCCTATCTGG + Exonic
1129671452 15:77610123-77610145 TCCAGGCCTGCTCCTCTATGAGG - Intergenic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1139430281 16:66907455-66907477 TCTGGAGCTGCCCCTCTCTGAGG - Intergenic
1152631944 17:81414387-81414409 GCCCGAGCTCCGCCTCTGTGGGG - Intronic
1153675740 18:7454594-7454616 TCTGCAGCACCTCCTCAATGTGG + Intergenic
1160965384 19:1744997-1745019 TCCGGGGCTTCTCCCCTTTGGGG - Intergenic
1162036829 19:7944764-7944786 TCAGGAGCTCCCCCTCAAGGTGG + Intergenic
1162301052 19:9845212-9845234 TCCTGAGTTCCTGCTCTGTGAGG - Intronic
1163453666 19:17393803-17393825 TCCCGAGCTCCCCCTCTACCCGG + Intergenic
1165365808 19:35363911-35363933 CCAGGAGCCCCTCCTCTCTGGGG + Intergenic
1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG + Exonic
1202678616 1_KI270711v1_random:30323-30345 TCCAGAGCTCTTCCTCTATGTGG + Intergenic
926144021 2:10385906-10385928 TCCGGAGCCTCTCCTCTCTGGGG + Intronic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
934054609 2:88241285-88241307 TCCTGGGCTCCTCCTCTGGGCGG - Intergenic
934167720 2:89310037-89310059 TCCACAGCTCCTGATCTATGGGG - Intergenic
934199565 2:89872546-89872568 TCCACAGCTCCTGATCTATGGGG + Intergenic
938135740 2:128755107-128755129 TCCGGAGCTCTGTCTCTTTGGGG - Intergenic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
1173788236 20:45810893-45810915 CCCGGATGTCCTCCTCGATGAGG - Exonic
1175355444 20:58362873-58362895 GCTTGAGCGCCTCCTCTATGTGG + Exonic
1180588403 22:16914371-16914393 TCCACAGCTCCTGATCTATGAGG - Intergenic
1181055090 22:20257037-20257059 TATGGAGCACCTCCTGTATGCGG - Intronic
1181329066 22:22075094-22075116 TCCATAACTCCTCCTCTGTGAGG + Intergenic
1182718161 22:32376588-32376610 TCTGTAACTCCTCCTCTGTGAGG + Intronic
1183356860 22:37364326-37364348 TCCGGAGCCCCTCATCCCTGAGG - Intergenic
1183448685 22:37878036-37878058 TCCGGAACTCCTGCTCTGTGAGG - Exonic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
952511819 3:34065863-34065885 TCTGGGGCTGCTCCTCCATGGGG + Intergenic
954695496 3:52422741-52422763 TCCTGGGCTCTTCCTCTAGGAGG + Exonic
956410163 3:68970913-68970935 ACTGGGGTTCCTCCTCTATGGGG - Intergenic
959565145 3:107826039-107826061 TCCTCCTCTCCTCCTCTATGCGG - Intergenic
961529931 3:127534203-127534225 TGAGGAGCACCTCCTCTCTGTGG + Intergenic
968644886 4:1735477-1735499 TCTGCAGCACCTCCTCTAAGTGG + Intronic
969696658 4:8738777-8738799 TCCACAGCTGCTCCTCTCTGGGG - Intergenic
973091805 4:46146794-46146816 TCAGGAGCTCCTACTCTTAGGGG - Intergenic
976717796 4:88141499-88141521 TCCAGGGCTCCTCCTCTGTTAGG - Intronic
980129269 4:128803341-128803363 TCTGGAGCTGCTGCTCTAAGGGG - Intergenic
985853667 5:2408295-2408317 TCTGGAGCTCTTCCTTTATTTGG - Intergenic
985869516 5:2542935-2542957 TCGGGAGCTCCTGTTCCATGGGG - Intergenic
986541140 5:8844895-8844917 TCCGGAAGTCCTCCTCTGGGAGG + Intergenic
991256680 5:64621938-64621960 TCCAGAGCTCCATCTCTATGGGG + Intergenic
993574291 5:89582159-89582181 GCCGGAGCTATTCCTGTATGTGG - Intergenic
993666158 5:90699039-90699061 TCAGGGGTTCCTCCTCAATGTGG + Intronic
995243437 5:109911239-109911261 TCCTCAGCTCCTCCTTTCTGGGG + Intergenic
1008228038 6:48946296-48946318 TCTGGAGATCCTTCTCTTTGCGG - Intergenic
1023880889 7:44320868-44320890 GCCGGACCTCCGCCTCTCTGTGG + Intronic
1034470760 7:151253250-151253272 TCAGCACCCCCTCCTCTATGGGG + Intronic
1034753196 7:153590312-153590334 TTTGGAGCTCCTGCTCTGTGTGG + Intergenic
1036237628 8:7054415-7054437 TTCTGAGCTCCTCTTCTATCTGG + Intergenic
1037987979 8:23301523-23301545 TCTGCAGATCCTCCTCTATGAGG + Intronic
1038758255 8:30361840-30361862 TCCCTAGCTCTTCCACTATGAGG - Intergenic
1039969462 8:42308856-42308878 ACCTGAGCTGCTCCTCTCTGGGG - Intronic
1047433609 8:124815735-124815757 TCAGTAGCTCCTCCTCTGTTGGG + Intergenic
1047625960 8:126656359-126656381 TCAGGAGTTCCTCATGTATGAGG + Intergenic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049701691 8:144017444-144017466 TCCTGTGTTCCTCCTCAATGGGG - Intronic
1053599418 9:39595197-39595219 TCCAAAGCTCTTCCTCTATCAGG - Intergenic
1053857123 9:42349382-42349404 TCCAAAGCTCTTCCTCTATCAGG - Intergenic
1054568170 9:66781352-66781374 TCCAAAGCTCTTCCTCTATCAGG + Intergenic
1054938052 9:70710284-70710306 TAGAGAGCTCCTCCTCTCTGAGG + Intronic
1054939743 9:70728277-70728299 TAGAGAGCTCCTCCTCTCTGAGG + Intronic
1058040691 9:100298445-100298467 CCCTGAGCTTCTCCTGTATGAGG - Intronic
1060024886 9:120162516-120162538 TCCGGGTCTCTTCCTCTGTGGGG + Intergenic
1062424014 9:136497807-136497829 AGCGGGGCTCCACCTCTATGGGG + Intronic
1185711581 X:2307988-2308010 TCCGGAGATCCTCCTGTGTTCGG - Intronic
1189286359 X:39854799-39854821 TCCAGAGCTCCTCCTTTGGGAGG + Intergenic
1193802928 X:85958494-85958516 TCCGGGCCTCCTCCTCTGTGTGG + Intronic
1197750218 X:129958731-129958753 CCAGGAGCTCCCCATCTATGGGG - Intergenic