ID: 1184784038

View in Genome Browser
Species Human (GRCh38)
Location 22:46663213-46663235
Sequence CAGCCTCAGCCCAGGGACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 379}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184784038_1184784047 7 Left 1184784038 22:46663213-46663235 CCCCGGTCCCTGGGCTGAGGCTG 0: 1
1: 0
2: 2
3: 51
4: 379
Right 1184784047 22:46663243-46663265 TGGGCCATCCTTTATCACCGTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1184784038_1184784052 26 Left 1184784038 22:46663213-46663235 CCCCGGTCCCTGGGCTGAGGCTG 0: 1
1: 0
2: 2
3: 51
4: 379
Right 1184784052 22:46663262-46663284 GTGGGCCAAAGCTGTCTGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 139
1184784038_1184784048 8 Left 1184784038 22:46663213-46663235 CCCCGGTCCCTGGGCTGAGGCTG 0: 1
1: 0
2: 2
3: 51
4: 379
Right 1184784048 22:46663244-46663266 GGGCCATCCTTTATCACCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184784038 Original CRISPR CAGCCTCAGCCCAGGGACCG GGG (reversed) Intronic
900091143 1:921222-921244 CAGCCTCAGCCCAGCGGCGGAGG + Intergenic
900175020 1:1287794-1287816 CAGCGTCCGGCCAGGGACGGAGG + Exonic
900410504 1:2510482-2510504 CAGCCTGAGCCCAGGGGGCTCGG + Intronic
900494841 1:2971733-2971755 CAGCCTCAGCCCAGCCCCCAGGG - Intergenic
901510969 1:9717889-9717911 CAGGTTCAGCCCAGGGATCCGGG + Intronic
901686446 1:10946149-10946171 CAGCCGCTGCCCTGGGACGGCGG - Intergenic
902363918 1:15958619-15958641 CAGCCTTATCCCAGGGCCCCTGG - Intronic
902384148 1:16066987-16067009 CAGCCACAGACCAGGGAGCGAGG + Intronic
902402135 1:16163847-16163869 CAGCCTCAGGCCAGGTGCGGTGG + Intergenic
902984903 1:20149310-20149332 CATCCACAGCCCAGGGAGAGAGG - Exonic
903489983 1:23721022-23721044 GAGCCTCAGCCCAGGAATGGTGG + Intergenic
903575613 1:24337857-24337879 CAGCCTTTCCCCAGGGTCCGTGG - Intronic
904416982 1:30369018-30369040 CAGCCAGAGCCCAGGGCCCAGGG - Intergenic
904792007 1:33029698-33029720 CAGCATCAGGCCAGGCACTGTGG - Intronic
907280090 1:53341720-53341742 CAGCCCCAGCCTGGGGACCCAGG + Intergenic
907455795 1:54574680-54574702 CACCCTCAGTACAGGGAGCGGGG - Intronic
908084780 1:60619761-60619783 CAGCTTCAGCCTAGGGGCCTAGG - Intergenic
912393603 1:109322223-109322245 CAGCCTGAGGCCAGGCACGGTGG - Intronic
912491767 1:110066365-110066387 CAGCTACAGCCCAGGGACCAGGG + Intronic
913653348 1:120938937-120938959 GAGCCTCAGGCCAGGCACAGTGG - Intergenic
914250603 1:145918691-145918713 CAGCCGCAGCCCAGGCTCCGCGG + Exonic
915251376 1:154591403-154591425 CGGCCTTAGGCCAGGGACCCAGG + Intronic
915268616 1:154735811-154735833 CTGCCTCAGCACAGGGCCTGAGG - Intronic
916166583 1:161971476-161971498 CAGCCTGAGCCCAGGTGCTGAGG - Intergenic
917980647 1:180266894-180266916 CAGCCTCCACCCAGGGAAGGAGG - Intronic
919892652 1:201986907-201986929 CTGCTTCAGCCAGGGGACCGAGG - Intronic
919925234 1:202188685-202188707 CAGCCTGGGCCCAGGGAGGGAGG - Intergenic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920646305 1:207806695-207806717 CAGACTCAGTCCAGGCACGGGGG + Intergenic
922243310 1:223771183-223771205 CACCCTCATCCAAGGGACCTGGG + Intronic
922563477 1:226586216-226586238 TAGCCACAGCTCAGGGACCTGGG + Intronic
922721630 1:227902892-227902914 CAGCCTCAGCCTAGGGTTTGGGG - Intergenic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
923113278 1:230910227-230910249 CATCTTCAGCCCTGGGACCCTGG - Intronic
923230410 1:231981229-231981251 CAGCCTCAGGCCAGGCACAGTGG - Intronic
1063473390 10:6307198-6307220 GAGCCTCAGCCTAGAGACCCAGG - Intergenic
1063960633 10:11302559-11302581 CATCCGCAGCCCAGGGCCCTGGG + Intronic
1064318154 10:14277147-14277169 CAGCCTGGGGCCAGGCACCGTGG - Intronic
1065564602 10:26996159-26996181 CACCCTCAGCCCAGGCATGGTGG + Intronic
1066694313 10:38064361-38064383 AAGCCTCAGCCCTGGGCCCCAGG - Intronic
1066998206 10:42582815-42582837 AAGCCTCAGCCCTGGGCCCCAGG + Intronic
1067154092 10:43760473-43760495 CAGCCTGAGCTCAGGGAGTGGGG - Intergenic
1068955208 10:62815114-62815136 CCGCCTCAGCCCAAGGCCAGTGG + Intronic
1069036874 10:63654906-63654928 CAGTCTCAGGCCAGGCACAGTGG + Intergenic
1069624586 10:69860020-69860042 CAGCCTCACCCCAGGACCAGCGG + Intronic
1070902536 10:80043089-80043111 CAGCTGCGGCCCAGGGACTGTGG - Intergenic
1072190892 10:93075316-93075338 CAGCTTCAGACCAGGCACTGCGG + Intronic
1073052971 10:100681165-100681187 CAGCTTCTGCCCAAGGACCGGGG - Intergenic
1073841198 10:107501109-107501131 CAGCCCAAGGCCAGGGAGCGAGG + Intergenic
1074062241 10:109977454-109977476 CAGCTTCTGCCCAGGAACCGTGG + Intergenic
1075728684 10:124623556-124623578 CTGCCTGAGCGCAGGGACAGAGG - Exonic
1076243480 10:128928044-128928066 CAAACTCAGCCCAGGGAGCGCGG + Intergenic
1076480127 10:130779456-130779478 CACCCTCAGCCCAAGGACCACGG - Intergenic
1076618595 10:131772510-131772532 CAGCCTCAGCCCTGGGCAGGAGG + Intergenic
1076839910 10:133040787-133040809 GAGCCCCAGGCCAGGCACCGTGG + Intergenic
1077319530 11:1935059-1935081 CAGCCTCAGCCAGGGGTCCGTGG - Intronic
1078422688 11:11225083-11225105 CAGCCTCAGCCCAAAGCCAGTGG + Intergenic
1078660927 11:13284922-13284944 CAGCCACAGCCCTGTGCCCGAGG + Intronic
1080851654 11:36075459-36075481 CCACCTCAGCCAAGGGACCATGG - Intronic
1081538757 11:44014924-44014946 CATCCTCAACCCAGGGCCAGTGG + Intergenic
1081677589 11:44979961-44979983 CAGCCTGAGCACAGGGCCCTGGG + Intergenic
1081866782 11:46364631-46364653 CAGCTTCAGGCCAGGTACAGGGG - Intronic
1083278198 11:61609280-61609302 CAGCCTCATCCCAAGGAAGGAGG + Intergenic
1083649842 11:64196106-64196128 CAGCTTCAGGCCAGGCACGGTGG + Intronic
1083695922 11:64442337-64442359 CTGCCTCTGCCCTGGGACCTTGG + Intergenic
1084084216 11:66847495-66847517 CAGCCTCAGAGAAGGGACCTTGG - Intergenic
1084173503 11:67411598-67411620 CAGCCTCAGCCCTGGGCCGAGGG + Intronic
1084401645 11:68947338-68947360 CAGCCACAGGCCAAGGAACGTGG + Intergenic
1084488031 11:69462471-69462493 CATCCTCAGCCCAGCAACCCTGG - Intergenic
1085611704 11:77956119-77956141 CAGGCTCAGGCCAGGCACAGTGG + Intronic
1089559772 11:119338005-119338027 CAGCCTCAACCCAAGGAAGGGGG - Intergenic
1089582039 11:119487340-119487362 CAGCCTCAGCCACGACACCGAGG - Intergenic
1090039941 11:123281904-123281926 CAGTCTCAGCCCATGGACTTTGG - Intergenic
1090736486 11:129615889-129615911 CAGCCTCGGCCCTGGAACTGTGG - Intergenic
1090736808 11:129617850-129617872 CAGCCTCGGCCCTGGAACTGTGG - Intergenic
1091436940 12:480666-480688 CAGCCTTATCTCCGGGACCGCGG + Intronic
1091600563 12:1915426-1915448 CAGCCTCAGGCCAGGGCCGGAGG + Intronic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1094317412 12:29149152-29149174 CAGCCTCAGCCCGGGGCGGGAGG - Intronic
1094831273 12:34301356-34301378 CAGCCCCTGCGCAGGGCCCGGGG + Intergenic
1096469090 12:51865059-51865081 CAGCATCAGGCCAGGGGCCCAGG - Intergenic
1096629989 12:52920308-52920330 CAGCCCCAGCCCAGGCACGGTGG + Intronic
1096813168 12:54184409-54184431 CAGCCACAGCCCAGAGACCTGGG + Intronic
1097207262 12:57333400-57333422 CAGCTTCAGGCCAGGCACAGTGG + Intronic
1097578789 12:61428338-61428360 CAGCCTCAGCTCACTGACAGTGG - Intergenic
1098170447 12:67741763-67741785 CATCCACAGCCCAGGGATTGGGG - Intergenic
1100495879 12:95124197-95124219 CAGTCTCAGGCCAGGTACGGTGG - Intronic
1102587133 12:113931372-113931394 CAGCCACAGCTCATGGACCTGGG - Intronic
1103342967 12:120230832-120230854 CACCCCCAGCCCAGGGACCTAGG + Intronic
1104608356 12:130206133-130206155 CAGCCTCACCCACGGGACCCAGG + Intergenic
1104950538 12:132437874-132437896 CAGCCTCAGCCCTGGCTCAGGGG - Intergenic
1104952991 12:132450861-132450883 CTACATCAGCCCAGGGACCCTGG - Intergenic
1105292428 13:19061482-19061504 CAGCCTCAGCCCACAGAACAGGG + Intergenic
1105701894 13:22940406-22940428 CAGCTTCAGGTCAGGGACTGGGG - Intergenic
1106235044 13:27854183-27854205 TAGGCTCAGCCCAGGGAATGAGG - Intergenic
1106250804 13:27980370-27980392 CAGCCCCAGCCCTGTGCCCGGGG + Intronic
1106394018 13:29362914-29362936 CAGCCTCAGCCCAGCGTCCAGGG + Intronic
1106931538 13:34670966-34670988 CAGCCTCAGCCCAGGCATGGAGG + Intergenic
1109044803 13:57395903-57395925 AAGCCTGTGCCCAGGGACTGCGG - Intergenic
1111079033 13:83277820-83277842 CGACCTCAGCCCTGGTACCGTGG - Intergenic
1111137512 13:84067937-84067959 TAACCTCAGGCCAGGTACCGTGG + Intergenic
1112402844 13:99090386-99090408 CAGCCTCATCCCAGGTAGCCAGG - Intergenic
1112941338 13:104866194-104866216 CAGCCTATGCCCACGGACCTAGG + Intergenic
1114317654 14:21523164-21523186 CAGCCTCAGCCAATGGAGCAGGG - Exonic
1116318043 14:43422997-43423019 CAGCCTCAGCCCAAGTAGCTGGG - Intergenic
1119407410 14:74407328-74407350 CAGCCCCAGAGCAGGGCCCGGGG - Exonic
1121225753 14:92320752-92320774 CAGTCTCAGCCCAGGGGAGGTGG - Intergenic
1121784390 14:96644793-96644815 CAGCATCAGGCCAGGGACAGTGG - Intergenic
1122014843 14:98786428-98786450 CAGCCTAAGCCCTGGGTCCTTGG - Intergenic
1122079289 14:99255960-99255982 CAGCCTCATGCCAGGCACTGGGG - Intronic
1122812088 14:104294062-104294084 CAGCCTCAGGACAGGGAGCACGG - Intergenic
1122863173 14:104591625-104591647 CAGCCTCACTCCCGGGACCCAGG + Intronic
1123135650 14:106025503-106025525 CTCCCTCAGCCCAGTGACTGGGG + Intergenic
1123195269 14:106610118-106610140 CTCCCTCAGCCCTGGGACTGGGG + Intergenic
1123399803 15:19973140-19973162 CTCCCTCAGCCCTGGGACTGGGG + Intergenic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1124685369 15:31777647-31777669 CACCCTCAGCCCAGGCCCCCAGG + Intronic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1125680086 15:41525022-41525044 CAGCCACAGCCCACAGACGGAGG + Exonic
1125720125 15:41841355-41841377 CTGCCTCAGCCTGGGGACCCTGG + Intronic
1128143889 15:65321629-65321651 CAGCCTCAGCCCAATAACTGGGG + Intergenic
1128390379 15:67178803-67178825 CAGCCTCACCTCAGGGGCCAGGG + Intronic
1129517497 15:76165604-76165626 CAGCCCCAGCCCCAGGGCCGTGG - Intronic
1129605514 15:77023116-77023138 CAGCCTGAGACCATGAACCGGGG + Intronic
1131177961 15:90221568-90221590 CAGAGTCAGCCCAGGAACCCTGG - Intronic
1131272319 15:90954930-90954952 CCACCTCAGTCCCGGGACCGCGG - Exonic
1131802968 15:96090959-96090981 CAGCCTCATATCAGGGACTGGGG - Intergenic
1132583787 16:697145-697167 CAGCCTCAGCCTTGGCACCTGGG - Exonic
1132978609 16:2722791-2722813 CATTCTCAGCCCTGGGTCCGTGG - Intergenic
1133231800 16:4370537-4370559 CAGCCCCAACCCAGGAACAGAGG + Intronic
1133286262 16:4692230-4692252 CAGCCAGCGCCCAGGGCCCGTGG - Intergenic
1135421296 16:22307287-22307309 CAGCCCCAGCCCAGGAAGCAGGG + Intronic
1136022857 16:27450982-27451004 CAGCCTCCTGCCAGGCACCGAGG - Exonic
1136458801 16:30397509-30397531 AAGCCTCAGCCTCGGGACAGAGG + Exonic
1136707786 16:32202936-32202958 CCGCCCCAACCCAGGGGCCGTGG + Intergenic
1136760123 16:32726475-32726497 CCGCCCCAACCCAGGGGCCGTGG - Intergenic
1136807981 16:33143911-33143933 CCGCCCCAACCCAGGGGCCGTGG + Intergenic
1137468460 16:48732783-48732805 CTGCCACAGCCCAGGGGCAGAGG - Intergenic
1139775784 16:69316384-69316406 CAGCGTCCGCCCAGGAACCTGGG + Intronic
1139971920 16:70781683-70781705 CAGCATCAGCCCCGGGTCCCTGG + Intronic
1140204522 16:72922559-72922581 CACCCTCAACCCAGGGACCATGG + Intronic
1141426783 16:83949426-83949448 AAGCCACAGACCAGGCACCGTGG + Exonic
1141704690 16:85658338-85658360 CAGGCCCAGCTCAGGGACCTAGG + Intronic
1141760425 16:86025515-86025537 AAGCCTCAGCCCTGGCCCCGGGG - Intergenic
1142122377 16:88393288-88393310 CAGGGTCAGCCCAGGGCCCGCGG + Intergenic
1142201010 16:88761175-88761197 CTGTCTCTGCCCAGGGAGCGGGG + Intronic
1142252860 16:89000709-89000731 AGGCCCCAGCCCAGGGACGGAGG - Intergenic
1203062279 16_KI270728v1_random:986797-986819 CCGCCCCAACCCAGGGGCCGTGG - Intergenic
1142679649 17:1539261-1539283 CAGCCTCCTGCCTGGGACCGAGG + Intronic
1143512875 17:7405588-7405610 CTGGCTCAGCCCTGGGGCCGTGG - Intronic
1143609731 17:8011089-8011111 CAGCTTCAGGCCGGGCACCGTGG + Intronic
1143870861 17:9956580-9956602 CAGCCCCACACCAGGGACAGCGG + Intronic
1144241746 17:13319448-13319470 CAGTCTTAGGCCAGGGACAGTGG - Intergenic
1144697287 17:17313618-17313640 CAGCCTCATCCCAGGGGCTGCGG + Intronic
1144698633 17:17322487-17322509 CACCCTGTGCCCAGGGACCCGGG + Intronic
1145208004 17:20994882-20994904 CAGCCTCAGCCCAGGGGAGGAGG - Intergenic
1146304719 17:31722184-31722206 CAGCCTCAGGCCAAGGATGGGGG + Intergenic
1147971183 17:44219756-44219778 CAGCCTCAGCCGCCGGAGCGGGG + Intronic
1148087140 17:45001113-45001135 CAGGCTCTGCCCAGGCACCTAGG - Intergenic
1148553463 17:48564290-48564312 CAGCCTGGGCCGAGGGTCCGGGG - Intronic
1150135123 17:62691173-62691195 CAGCCCCAGCCCAGGACCAGCGG - Intronic
1150473138 17:65454342-65454364 CAGCCTCAGGCCAGGCGCAGTGG + Intergenic
1151151256 17:72089365-72089387 CAGCCACAGCCCAGGAACGGTGG + Intergenic
1151230772 17:72683613-72683635 CAGCCTCAGGCCAGGCGCAGTGG - Intronic
1151657136 17:75501390-75501412 CATCCTCTGCCCAGGGATCATGG - Intronic
1152018846 17:77769995-77770017 GAGCCTCAGCCGAGTGACCAGGG + Intergenic
1152262466 17:79274549-79274571 CAGCCTCTGCCCAGGGCAGGTGG - Intronic
1152334416 17:79692288-79692310 TCCCCTCAGCCCAGGGACAGCGG - Intergenic
1152391722 17:80007588-80007610 CCTCCTCAGCCCAGGGTTCGGGG + Intronic
1152534283 17:80941412-80941434 CAGCCCCATCCCAGGGACCCTGG + Intronic
1153078974 18:1198041-1198063 CATCCTCGGCCCAGGGATTGGGG + Intergenic
1153842234 18:9017299-9017321 CAGGCGCAGCCAAGGGGCCGCGG - Intergenic
1154303975 18:13217726-13217748 CAGCCTCAGCGCGGGGAGAGAGG - Intronic
1156179544 18:34586819-34586841 CAACTTCATCCCAGGGACAGAGG - Intronic
1156522423 18:37733013-37733035 CAGCCAGTGCCCAGGAACCGAGG - Intergenic
1160208895 18:76859780-76859802 CAGCCCCAGCCCATGAACTGAGG - Intronic
1160819854 19:1052766-1052788 CCGGCTCAGCCCAGGGATGGGGG - Intronic
1160867245 19:1261331-1261353 CTCCCCCAGCCTAGGGACCGCGG - Intronic
1160932275 19:1576439-1576461 CTGGCTCAGCCTAGGGATCGTGG - Intronic
1162354790 19:10175878-10175900 CAGCCTCAGACCAGGTGCAGTGG + Intronic
1162395847 19:10417762-10417784 CAGCCTGAGCCCTCGGACCCTGG + Intronic
1162410547 19:10502836-10502858 CCGCCTGAGGCCAGGGCCCGGGG - Intronic
1162502244 19:11060475-11060497 CGGCCTCAGCCCAGGAGCCCTGG - Intronic
1163311919 19:16520022-16520044 CAGCATTAGCCCGGGGACAGTGG - Intronic
1163418428 19:17200949-17200971 CAGGCTCAGGCCGGGGACAGTGG + Intronic
1163613996 19:18315959-18315981 CAGCCTCAGCACAGGGGCGGTGG - Intronic
1163639098 19:18451406-18451428 CTCCCTCCGCCCAGGGACCAAGG - Intronic
1164058638 19:21645517-21645539 CAGGTTCAGGCCAGGCACCGTGG - Intergenic
1164647042 19:29866194-29866216 CAGCCTCAGCCCAGCCTCAGAGG + Intergenic
1164649087 19:29879294-29879316 CAGCCTCAGCTCAAGGAGAGGGG - Intergenic
1165003682 19:32787230-32787252 CAGCCTCTGCCCAGGGAAACAGG - Intronic
1165080254 19:33302602-33302624 CCGCCGCAGCCCGGGGACAGAGG - Intergenic
1165455480 19:35908118-35908140 CAAGCTGAGCCCAGGGACCCGGG + Intronic
1165661646 19:37585936-37585958 AAGCCACACCCCAGGGATCGTGG + Intronic
1165704608 19:37966752-37966774 CAGCCTCTGTCCAGGCACTGGGG + Intronic
1166074979 19:40408713-40408735 TCGCCTGAGCCCAGAGACCGAGG - Intronic
1166700517 19:44879207-44879229 CAGCCTCTGTCCTGGGACCCAGG - Intronic
1167607528 19:50489445-50489467 CAGCGTCAGCCCAGAGACCGGGG + Exonic
1167713370 19:51125616-51125638 CATCCTCATCCCAGGCACCCTGG + Exonic
1168274815 19:55271770-55271792 CAACCTCAGGCCAGGCACAGTGG + Intronic
1168692526 19:58385713-58385735 CAGGCCCAGCCCTGGGACCTGGG + Intergenic
925055227 2:852084-852106 CGGCCTCTGCCCAGGGCCCCAGG - Intergenic
925145950 2:1583449-1583471 CAGGCTTAGCACAGGGACTGGGG - Intergenic
925292146 2:2755157-2755179 CAGCCTCAGACCAGCGGCTGTGG - Intergenic
926303053 2:11617952-11617974 CACCCTCAGCCCAGAGCTCGGGG + Intronic
926740001 2:16102951-16102973 GAGCCTGAGCCCAGGGGCCGAGG + Intergenic
927086621 2:19678943-19678965 CAGCCACAGGCCAGGTACTGTGG + Intergenic
927206827 2:20616380-20616402 CAGCTTCAGCCCTGGGACCCAGG - Intronic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
928130298 2:28644249-28644271 CAGCCTGAGCCCAGTGTCCCAGG + Intergenic
929429197 2:41872314-41872336 CAGCTTCAGGCCAGGCACAGTGG + Intergenic
931254458 2:60557700-60557722 CAGTCCCAGCCCTCGGACCGAGG + Intergenic
932402094 2:71487794-71487816 CAGCATCAGACCAGGCACAGTGG - Intronic
932419628 2:71593873-71593895 CCGCCTGAGCCCAGTGACCTGGG - Intronic
932575123 2:72958605-72958627 CAGCCTGAGCCCAGGGTCCTAGG - Intronic
932832679 2:75006313-75006335 CAGCCTCAAGCCAAGGACTGTGG - Intergenic
932882625 2:75518104-75518126 CAGCCACAGCCCAGAGCACGTGG - Exonic
934715152 2:96538724-96538746 CAACCTCAGCCGAGGGGGCGGGG + Intronic
934717583 2:96552495-96552517 CAGCCTGAGCCCAGGAGCAGAGG + Exonic
934915162 2:98295602-98295624 CAGCCTCTGCCCAGAGAAAGAGG + Intronic
937125227 2:119470986-119471008 CAGCCACAGGCCAGGCACAGTGG - Intronic
937246735 2:120498770-120498792 CAACCTCAGCCTTGGGGCCGAGG - Intergenic
937316855 2:120937191-120937213 CAGCCTCATGCCAGGCACTGGGG + Intronic
937398669 2:121562221-121562243 CAGCCACAGCACAGGAACCTGGG + Intronic
938389647 2:130894734-130894756 GAGCCACAGACCAGGGACAGAGG - Intronic
939200831 2:139031731-139031753 CAGCTTCAGCTCAGGGCCCAAGG + Intergenic
942658741 2:178241701-178241723 AAGCCTCAGGCCAGGCACAGTGG - Intronic
942929544 2:181473142-181473164 CATCCACAGCCCAGGGATTGGGG - Intronic
945064704 2:205939030-205939052 CAGCCTCAGCCTGGAGCCCGTGG + Intergenic
945290705 2:208124435-208124457 CAGCCTGCGCCCCGGGACCCCGG - Intronic
946529377 2:220555339-220555361 CAGCTTCAGCCCAGTGATTGTGG + Intergenic
946757174 2:222959513-222959535 CAGCCTGAGGCGAGGGAGCGTGG - Intergenic
947201426 2:227617822-227617844 CAGCCCCTGCCCAGAGGCCGGGG - Intronic
947301005 2:228688754-228688776 CAGGGTAAGCCCAGGGATCGGGG - Intergenic
947727167 2:232408025-232408047 CAGCCCCAGCCCTTGGCCCGGGG - Intronic
947736325 2:232457330-232457352 CAGCCCCAGCCCTTGGCCCGGGG - Intronic
948425254 2:237883202-237883224 CAGGCCCAGCCCAGGGCCCTGGG - Intronic
948568184 2:238899541-238899563 CAGCCTCAGGCCAGGCTCCAGGG + Intronic
948806431 2:240455332-240455354 CAACTTCAGCCCAGGGATCAGGG + Intronic
948860629 2:240751058-240751080 CACCCCCAGCCCAGGGCCCAGGG + Intronic
948896966 2:240932160-240932182 CATGCTCAGACCAGGGACAGAGG + Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1168754262 20:305184-305206 CAGCCTGTGCCCATGGACCTAGG + Intergenic
1169072233 20:2739651-2739673 TACCCTCAGCTCAGGGACAGAGG - Intronic
1169263593 20:4154648-4154670 CAGTCTCAGGCCAGGCACAGTGG - Intronic
1170026155 20:11891249-11891271 CCGCCTCAGCCGAAAGACCGCGG + Intronic
1171240925 20:23566447-23566469 TAACCTCAGCCCTGGGACAGAGG + Intronic
1171242697 20:23584927-23584949 TAACCTCAGCCCTGGGACAGAGG - Intergenic
1172099139 20:32475084-32475106 TGCTCTCAGCCCAGGGACCGGGG + Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172526056 20:35601177-35601199 CAGCCTGAGCCCTGGGGGCGGGG + Intergenic
1175183092 20:57162139-57162161 GAGACTCAGTCAAGGGACCGTGG + Intergenic
1175522115 20:59608661-59608683 CAGCGACAGCCAAGGGACAGGGG - Intronic
1175875317 20:62226765-62226787 CAGCCTCTGCCCTCGGACCCAGG - Intergenic
1175996069 20:62812881-62812903 CAGCCTCAGGACGGGGACCCAGG + Exonic
1176018660 20:62951879-62951901 CAGCCACCACCCAGGGGCCGAGG - Intergenic
1176102663 20:63371668-63371690 CAGCCTCACCGCAGGCACCACGG - Intronic
1176286433 21:5021560-5021582 GAGCCTCAGCCCAGAGGCGGGGG + Intergenic
1176869029 21:14072262-14072284 CAGCCCCTGCCCTGGGCCCGAGG - Intergenic
1177264400 21:18764715-18764737 CAGCCTGTGCCCATGGACCTAGG + Intergenic
1179593510 21:42427197-42427219 CAGACTCAGGCCAGGGTCCAGGG + Intronic
1179731297 21:43369185-43369207 CAGGCTCATCCCAAGGACAGTGG + Intergenic
1179870748 21:44241915-44241937 GAGCCTCAGCCCAGAGGCGGGGG - Intergenic
1179909980 21:44442435-44442457 CAGCCTCGTCCCAGGGTCCCTGG - Exonic
1179979565 21:44889063-44889085 AAGCCTGATCCCAGGGCCCGCGG + Intronic
1180156742 21:45981779-45981801 CCGCCGCCGCCCAGAGACCGAGG - Exonic
1180165285 21:46022587-46022609 CAGCCTCAGCTCCGGGTCTGCGG - Intergenic
1180180676 21:46117479-46117501 CAGCCTCGGCCCAGGGGGTGTGG + Intronic
1181002928 22:19996203-19996225 CATCCCCAGCCCAGGCACCCCGG - Intronic
1181386159 22:22547322-22547344 CAGCCACAGGCCAGGGATGGAGG + Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182286893 22:29254068-29254090 CTGCCACAGCCCAGGGTCCATGG - Intronic
1182288810 22:29263805-29263827 TTGCCTGAGCCCAGGGCCCGTGG - Intronic
1182359456 22:29738153-29738175 CAGCCTCTGGCCAGGGCCTGGGG + Intronic
1182443368 22:30376746-30376768 CAGCCTCAGCCCTGGGCCACAGG - Exonic
1183286865 22:36971877-36971899 CAACCCCAACCCAGGGCCCGTGG - Intergenic
1183668058 22:39256463-39256485 CAGCCTCAGCAGAGGCCCCGGGG + Intergenic
1184074083 22:42165091-42165113 CAGCCCCAGCCCAGGCATTGTGG - Intronic
1184240182 22:43207712-43207734 CAGCCATAGCCCAGAGCCCGTGG - Intronic
1184309437 22:43631673-43631695 CAGCCCCACCCCAGGGAGCTCGG - Intronic
1184607245 22:45581229-45581251 CAGCCATAGCCCAGGGGCCCGGG - Intronic
1184665931 22:45989078-45989100 CAGCCTCAGCCCTGGGTGCTGGG - Intergenic
1184784038 22:46663213-46663235 CAGCCTCAGCCCAGGGACCGGGG - Intronic
1185099599 22:48830629-48830651 GAGCCTCATCCCAGGGCCGGTGG + Intronic
950115408 3:10447537-10447559 CAGCTTCTCCCCAGGGACTGGGG + Intronic
950125496 3:10507403-10507425 CAGCTCCACCCCAGGGACCAGGG + Intronic
952904483 3:38130811-38130833 CTGCCACAGCCCTGGGACAGGGG + Intronic
954437285 3:50503032-50503054 CAGCCAGAGCGCCGGGACCGCGG + Intronic
954628621 3:52036280-52036302 CACCCCCAGCCCAGAGACTGCGG + Intergenic
954707983 3:52491244-52491266 AAGCCTCAGCCCAGAGGCCAGGG - Intronic
954717659 3:52534291-52534313 CAGTCCGAGCCCAGAGACCGGGG - Intronic
956764169 3:72470093-72470115 CAGACTCAGGCCAGGCACGGTGG + Intergenic
959849698 3:111071936-111071958 CAGCCTCCGCCCAGAGCCTGAGG + Exonic
960036190 3:113105174-113105196 CAGCTTCAGCCCAGGGGCTCTGG - Intergenic
960269515 3:115658805-115658827 AAGCGTCAGCCCAGGGCCCCAGG + Intronic
960586313 3:119323677-119323699 CAGCCACAGCCCAGGTAACGAGG - Intronic
960615955 3:119596175-119596197 CAGCCTCAGCACAAAGACAGAGG - Intergenic
961140781 3:124554066-124554088 CAGGCACAGGCCAGGCACCGTGG + Intronic
961359942 3:126360690-126360712 GAACATCAGCCCAGGGACCTGGG + Intergenic
968510360 4:992902-992924 CAGGCTCAGCCCAGGCTCCAGGG - Exonic
968613604 4:1567769-1567791 CAGCCCCAGCCCAGGGCCCCCGG + Intergenic
968614377 4:1570835-1570857 CAGCCTCAGCCCAGCTAAGGAGG + Intergenic
968650515 4:1758518-1758540 CAGCCTCAGCCTAGGGCTCTGGG + Intergenic
968705928 4:2077480-2077502 CAGCCTCTGGCCAGGGGCCGTGG + Intronic
968809366 4:2793096-2793118 CCGCCTCGACCCAGGGCCCGCGG + Intronic
968975948 4:3822144-3822166 CAGCTTCAGCCCAGGCCCAGGGG - Intergenic
969336476 4:6513378-6513400 CTGCCTCTGCCCAGAGACCATGG - Intronic
969437748 4:7198533-7198555 CAGCCACAGCTCAGCCACCGGGG - Intronic
969616131 4:8253484-8253506 CAACCTCAGCCCAGACACCCAGG - Intergenic
969639577 4:8388823-8388845 CAGCAGCAGCCCAGGCACCAGGG + Intronic
969682225 4:8649748-8649770 CAGCCTCTGCCCGGGGCCCCCGG + Intergenic
970110377 4:12631015-12631037 CAGCCTCAGCCAAGTGACCTGGG + Intergenic
970194656 4:13542505-13542527 CGACCGCAGCCCAAGGACCGAGG - Exonic
970733840 4:19142110-19142132 GAGCCTCAGCTCAGGGACCAAGG - Intergenic
972573961 4:40335033-40335055 CAGCCTGAGTCCAGGGACTAAGG - Intergenic
973340410 4:48997624-48997646 CAGCCTCATCCCAGAGCCTGAGG + Intronic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
974299432 4:60044101-60044123 CAGCCTCAGCCCATGTCCCATGG - Intergenic
974576394 4:63729010-63729032 AAGCCTCAGCCCTGGGCCCTGGG - Intergenic
975739199 4:77412237-77412259 CAGCATGAGCCCAGGCACCAAGG - Intronic
982288729 4:153759737-153759759 CAGCGTGAGCCCCGGGACCCCGG + Intronic
983908060 4:173205660-173205682 CAGACCCAGCCCAGTGACAGGGG - Intronic
985068438 4:186144968-186144990 GAGCCCCAGCCCCGGGGCCGCGG + Exonic
985812437 5:2099610-2099632 CAGGCCCAGCCCAGTGACAGGGG + Intergenic
985866614 5:2519246-2519268 AAGCCTCAGCCCTGGGTCCCTGG + Intergenic
986009348 5:3698345-3698367 CAGCCCCAGCCCTGGGAGTGGGG - Intergenic
987341411 5:16942708-16942730 CAGCCACAGGCCAGGTACCGTGG + Intergenic
987404626 5:17512259-17512281 CAGGCTCAGCCCAGTGACAAGGG - Intergenic
987411670 5:17620960-17620982 CAGGCTCAGCCCAAGGAGAGGGG - Intergenic
987415279 5:17655559-17655581 CAGGCTCAGCCCAAGGACAGGGG - Intergenic
987416784 5:17670604-17670626 CAGGCTCAGCCCAAGGACAGGGG - Intergenic
988527659 5:32000848-32000870 CATCCACAGCCCAGGGGCTGGGG - Intronic
989060894 5:37410324-37410346 CAGACTCAGGCCAGGCACAGTGG - Intronic
990492384 5:56315144-56315166 CAATCTCAGCCCAGGGGTCGGGG - Intergenic
991932292 5:71765658-71765680 CAGACTCAGGCCAGGGAGCTGGG + Intergenic
992091026 5:73317162-73317184 CAGCCTCAGGGGAGGGACTGAGG - Intergenic
997603642 5:135157168-135157190 CAGCCTCAGAGCAGGGAATGGGG + Intronic
998184644 5:139968863-139968885 CAGCCTCAGCCCAGGAGGAGAGG + Intronic
998371789 5:141666533-141666555 CAGCCAGAGACCAGGGGCCGGGG + Exonic
999893057 5:156000072-156000094 TAGCTTCAGCCCTGGGACCTAGG + Intronic
1001251265 5:170148810-170148832 CAGCCCCTGCCCTGGGACCTTGG + Intergenic
1001923996 5:175622967-175622989 CAGCCTCAGCCCAGGAAGTGGGG - Intergenic
1002271292 5:178074259-178074281 CAGCCTGTGCCCACGGACCTAGG + Intergenic
1002317308 5:178351433-178351455 CAGCCTCTGCCCAGGGAACTGGG + Intronic
1002862956 6:1096075-1096097 CAGCCTCAGAGCAGGCACTGAGG + Intergenic
1003502600 6:6714709-6714731 CAGCCCCAGCCCCGGGTCCCAGG - Intergenic
1003996745 6:11549374-11549396 AAGCCTCAGGCCAGGCACGGTGG + Intronic
1004891737 6:20107466-20107488 CTGCCTCAGCCTAGGCACTGGGG - Intronic
1007707389 6:43799185-43799207 CAGCCCCATCCCAGGGGCCCAGG - Intergenic
1008128931 6:47698668-47698690 CAGCCACTGACCAGGGACCGTGG + Exonic
1011414216 6:87100924-87100946 CAGCCAGAGCCCAGGGATAGAGG - Intergenic
1013181529 6:107720755-107720777 AGGCCTCAGCCCAGGTGCCGAGG + Exonic
1013227902 6:108133910-108133932 CTGCCCCAGCCCAGGGCCTGCGG + Intronic
1015795420 6:137006422-137006444 CAGGCTCAATCCAGGGACCAGGG - Intronic
1016020941 6:139235699-139235721 GAGCCTGTGCCCAGGGACCGAGG + Intergenic
1017539373 6:155384748-155384770 CAGGCTCAGCGCAGGCACCAGGG + Intergenic
1017655324 6:156622201-156622223 CAGCATAAGCCCAGGTACCTGGG + Intergenic
1017908003 6:158769974-158769996 AACCCTCAGCCCAGGGACCTAGG + Intronic
1018232161 6:161685920-161685942 GAGCCACAGGCCTGGGACCGGGG - Intronic
1018784619 6:167098468-167098490 CAGCCTGAGGCCAGGGAACCAGG - Intergenic
1018841158 6:167518106-167518128 CAGCCTCAGCCCAGAGGACAGGG + Intergenic
1018851604 6:167644554-167644576 CAGCCTCCGCCCAGGCTCTGAGG - Intergenic
1018906792 6:168080246-168080268 CAGTGTCAGTCCAGGGTCCGGGG - Intronic
1018928592 6:168224219-168224241 CAGGCTGTGCCCAGGGACAGTGG + Intergenic
1019154687 6:170031121-170031143 CAGCCTGAGGGCAGGGACCATGG + Intergenic
1019417872 7:935532-935554 GAGGCTCAGCCCAGGGACCCCGG + Intronic
1019520347 7:1458092-1458114 CAACCTCAGAGCAGGGGCCGAGG + Intronic
1020098660 7:5382330-5382352 CAGCCCCAGCCCAGGGCCCATGG + Intronic
1021100733 7:16584521-16584543 CAGCCTCAGCCCCGCCACGGTGG - Intergenic
1021638835 7:22718543-22718565 CAGCAGCAGCCCAGGGGCCTAGG - Intergenic
1023093848 7:36640621-36640643 CAGCCTCTGCCAAGGGGCAGTGG - Intronic
1024018621 7:45344117-45344139 CAGCCTCAGCCAGGTGACCAAGG + Intergenic
1024082735 7:45868539-45868561 AAGCCACAGACCAGGGACTGTGG - Intergenic
1024389033 7:48786186-48786208 CATAATCAGCCCAGGGCCCGTGG + Intergenic
1024984456 7:55183097-55183119 CAGCCACAGCCCAGGGATGCTGG - Intronic
1025852118 7:65252175-65252197 CACCCGCCGCCCAGGAACCGGGG + Intergenic
1026867476 7:73832457-73832479 CCGCTTCAGCCCAGGGCCCCTGG + Exonic
1029584302 7:101460493-101460515 CAGCCTCAGGCCAGGCGCGGTGG + Intronic
1030266257 7:107625206-107625228 CATCCTCAGGCCAGGCACGGTGG - Intronic
1032062905 7:128739557-128739579 CAGCATCAGGCCTGGGACCCGGG - Intronic
1032706388 7:134423963-134423985 CAGCCTGAGCCAAGGCACAGGGG + Intergenic
1034805707 7:154087508-154087530 TAGCCGCAGGCCAGGGACCTTGG + Intronic
1034816832 7:154179103-154179125 GAGCCACAGCCCAGGGAAAGGGG - Intronic
1034819773 7:154205964-154205986 CAGCCTCAGGCAAGGGTCAGAGG - Intronic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1037786940 8:21908936-21908958 CAGCCTGGGCCCAGGCACCCAGG - Exonic
1037812331 8:22094531-22094553 CCTCCCCAGCCCAGGGACCCTGG + Intronic
1037914458 8:22764466-22764488 CAGCCAAAACCCAGGGACCAAGG + Intronic
1038481079 8:27902224-27902246 CAGCCTCCCCTCAGGGACTGAGG - Intronic
1039561239 8:38514051-38514073 CTGCCCCAGCCCAGGGAGGGAGG - Intronic
1041093441 8:54326167-54326189 CAGCATCTTCCCAGGGACAGAGG - Intergenic
1041472406 8:58225371-58225393 CAGCCGCAGCCCTGAGACCTTGG - Intergenic
1043434596 8:80226152-80226174 CAGCCTGAGGCCAGGCACAGTGG + Intronic
1046962616 8:120126227-120126249 CAGGCTCTGCCCTAGGACCGAGG - Intronic
1047312172 8:123701185-123701207 CAGCTTCAGGCCAGGCACGGTGG + Intronic
1048671773 8:136730593-136730615 CAGCCTGTGCCCAGGGACCGAGG - Intergenic
1048925093 8:139264445-139264467 CACCCTCAGGACAGGGACAGTGG + Intergenic
1049241191 8:141538136-141538158 CAGCCCCAGTCCAGGGAGCAGGG + Intergenic
1049283148 8:141760747-141760769 CTGCGGCAGCCCAGGGGCCGGGG - Intergenic
1049320025 8:141991357-141991379 CAGCCTCAGGCCAGAGGCCCAGG + Intergenic
1049453011 8:142672509-142672531 GAGCCCCAGTCCAGGGACCTTGG - Intronic
1049594225 8:143476059-143476081 GAGCCTCAGCCCAGGTGCCAAGG - Intronic
1049659493 8:143813411-143813433 GGGCCACAGCCCAGGGACCAGGG - Intronic
1049749486 8:144276547-144276569 CCGTGTCAGCCCAGGGACAGAGG - Intronic
1049775037 8:144400178-144400200 CAGCCTCACCACAGGAACCACGG - Exonic
1052926568 9:34021955-34021977 CACCTTCAGGCCAGGCACCGTGG + Intronic
1053412987 9:37927808-37927830 CAGCCTCAGCCAAGTGCACGTGG + Intronic
1057850843 9:98565713-98565735 AAGCCCCAGACCAGGAACCGAGG + Intronic
1057913088 9:99035227-99035249 CAGCCTCTGCCCTGAGACCAGGG - Intronic
1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG + Intergenic
1060770976 9:126332115-126332137 CAGCCTCAACAAAGGCACCGTGG - Intronic
1061493529 9:130959186-130959208 CAGATTCAGCCCAGGCCCCGAGG - Intergenic
1061727648 9:132590171-132590193 CAGCCTCAGCCCCGGTCCGGGGG + Exonic
1062268202 9:135696935-135696957 CAGCCTCTGCCCAGGGGCCCTGG + Intronic
1062280866 9:135751072-135751094 AAGGCTCAGCCCTGGGACCCGGG - Intronic
1062282574 9:135758623-135758645 CACCCGCAGCCCAGGCACTGTGG - Intronic
1062391862 9:136337083-136337105 CAGGGCCAGCCCAGGGACCGGGG + Intronic
1062410764 9:136423036-136423058 CAGCCTCAGCGTGGGGGCCGTGG + Intronic
1062501734 9:136854716-136854738 CAGCCACAGCCCAGTGGCCCTGG + Intronic
1062536529 9:137023541-137023563 CAGACTCAGCCCAGAAGCCGAGG + Intronic
1062537011 9:137025483-137025505 CGCCCCCACCCCAGGGACCGGGG - Intronic
1187172918 X:16869749-16869771 CCGCCTCCGCCCCGGGGCCGAGG + Exonic
1187179337 X:16929008-16929030 CAGCCTCAGCCCATGTAGCTGGG - Intergenic
1187354070 X:18550240-18550262 CAGCCTCAGGCCAGTGTCTGGGG + Intronic
1189800192 X:44684805-44684827 CAGCCTCATCCCTGGAACCTGGG + Intergenic
1190108296 X:47574104-47574126 CAGCCTCGGCCCAGCGGCCCGGG - Exonic
1192205808 X:69095294-69095316 CAACCTCTGCCCAGGGCCAGGGG - Intergenic
1195086372 X:101418050-101418072 CACCCTCAGCCCACAGATCGGGG - Intergenic
1196882372 X:120210101-120210123 AAGACTCAGGCCAGGCACCGTGG + Intergenic
1198480261 X:137034097-137034119 CCGCCGCAGCCCAGGGAGCGGGG + Intergenic
1201764761 Y:17566486-17566508 CAGCCTCTGCGCCGGAACCGAGG - Intergenic
1201836792 Y:18339504-18339526 CAGCCTCTGCGCCGGAACCGAGG + Intergenic