ID: 1184785160

View in Genome Browser
Species Human (GRCh38)
Location 22:46668134-46668156
Sequence GGGCGACGTCCAGCACCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184785160_1184785165 1 Left 1184785160 22:46668134-46668156 CCAGCTGGTGCTGGACGTCGCCC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1184785165 22:46668158-46668180 GAAAGCCCAGGTACTGCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 146
1184785160_1184785168 7 Left 1184785160 22:46668134-46668156 CCAGCTGGTGCTGGACGTCGCCC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1184785168 22:46668164-46668186 CCAGGTACTGCCACGGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 204
1184785160_1184785170 13 Left 1184785160 22:46668134-46668156 CCAGCTGGTGCTGGACGTCGCCC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1184785170 22:46668170-46668192 ACTGCCACGGGCGCCGGCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 73
1184785160_1184785171 14 Left 1184785160 22:46668134-46668156 CCAGCTGGTGCTGGACGTCGCCC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1184785171 22:46668171-46668193 CTGCCACGGGCGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1184785160_1184785164 0 Left 1184785160 22:46668134-46668156 CCAGCTGGTGCTGGACGTCGCCC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1184785164 22:46668157-46668179 AGAAAGCCCAGGTACTGCCACGG 0: 1
1: 0
2: 0
3: 18
4: 207
1184785160_1184785169 12 Left 1184785160 22:46668134-46668156 CCAGCTGGTGCTGGACGTCGCCC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1184785169 22:46668169-46668191 TACTGCCACGGGCGCCGGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184785160 Original CRISPR GGGCGACGTCCAGCACCAGC TGG (reversed) Exonic
900109588 1:999905-999927 GAGCGCCGGCCAGCGCCAGCCGG - Exonic
900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG + Intergenic
900854614 1:5170941-5170963 GGGCCAAGTCCAGCACCCTCAGG + Intergenic
905043943 1:34982024-34982046 GGCCGACATTCAGCAGCAGCAGG + Exonic
907240938 1:53080721-53080743 CGGCGATGTCCAGCAGCTGCAGG - Exonic
907276512 1:53319777-53319799 GGGCGCCCTCCAGCATGAGCTGG - Intronic
916028856 1:160859236-160859258 GAGCGAGGTCCAGGACCAGCAGG + Intronic
919756078 1:201066906-201066928 GGGACACGGCCACCACCAGCAGG + Exonic
920843629 1:209575654-209575676 GGGACACATCCAGCCCCAGCTGG - Intergenic
924953408 1:248906223-248906245 GCGCAACGTCCGGCACCAGAGGG - Exonic
1062988301 10:1790542-1790564 GGGAGGCTTCCAGCATCAGCCGG + Intergenic
1074977720 10:118594986-118595008 GCGCGATCACCAGCACCAGCAGG + Exonic
1076841977 10:133050217-133050239 GGGCTCCTCCCAGCACCAGCGGG + Intergenic
1076846260 10:133070979-133071001 GGGCAACGTCCATCACCACCAGG + Intronic
1077081265 11:725721-725743 GGCCGTCCTCCAGCACCTGCGGG - Exonic
1079128945 11:17736428-17736450 GGGCGACGGCGAGGACGAGCTGG + Exonic
1083924022 11:65795215-65795237 GGGCCACGTCCTGCACCTGAAGG + Exonic
1083960399 11:66012062-66012084 GGGCCAGGCCCAGCGCCAGCGGG - Exonic
1084063469 11:66690259-66690281 GGCCGTCGTCCTGCACCTGCTGG + Exonic
1084512313 11:69613882-69613904 GGGGGAAGTCCTTCACCAGCTGG + Intergenic
1084795193 11:71500766-71500788 GGGCTCCGTCCAGCCACAGCAGG - Intronic
1088883737 11:113991351-113991373 GCACCACGGCCAGCACCAGCTGG + Intergenic
1094058071 12:26286385-26286407 GGCCCACCTCCAGCACCAGTGGG + Intronic
1096529369 12:52233518-52233540 GGTCGGCGTCCAGCCGCAGCGGG - Exonic
1106411618 13:29514952-29514974 TGGAGACCTCCAGCACCTGCGGG - Intronic
1113557857 13:111253010-111253032 GGGCCAGGCCCAGCAGCAGCTGG + Intronic
1113603666 13:111589439-111589461 GGTAGACACCCAGCACCAGCAGG + Intronic
1114032534 14:18589054-18589076 GGGCGACATCCAGCCCCAGGCGG + Intergenic
1114077316 14:19168079-19168101 GGGCAACATCCAGCCCCAGGTGG + Intergenic
1114084848 14:19231484-19231506 GGGCGACATCCAGCCCCAGGTGG - Intergenic
1114655957 14:24315813-24315835 GGGCCAGGTTCAGCACCATCAGG - Exonic
1117802947 14:59464158-59464180 GGGCGGCGGCCAGCAGCACCAGG + Exonic
1120932885 14:89866475-89866497 GGGCCCCCTCCAGCACCTGCAGG + Intronic
1121283083 14:92713521-92713543 GGCCGAAGACCAGCAGCAGCAGG + Intronic
1122648042 14:103207795-103207817 GGGTGCCCACCAGCACCAGCAGG - Intergenic
1123102933 14:105818072-105818094 GGGTGGCGTCCAGGCCCAGCAGG + Intergenic
1202896445 14_GL000194v1_random:13295-13317 GGGCAACATCCAGCCCCAGGTGG - Intergenic
1126137191 15:45403173-45403195 GCGCCACGGCCCGCACCAGCTGG - Exonic
1132663115 16:1070329-1070351 GGGCGACGTCGAGACCCACCAGG + Intergenic
1133234442 16:4381387-4381409 GGCTGAGGTCCAGCAGCAGCAGG - Exonic
1133287776 16:4698503-4698525 GGGCGCGGTCCTGCTCCAGCAGG + Exonic
1133303319 16:4795961-4795983 GGGCGACGACCAGCAGCAGCAGG - Exonic
1133317165 16:4892042-4892064 GGGCCAAGTCCAGCAGCTGCAGG + Exonic
1137607384 16:49795770-49795792 GGGCAACGTCCAGCAGCCTCTGG + Intronic
1138545278 16:57715413-57715435 GGGCGACTGCCAGCCCCTGCGGG + Intronic
1141600728 16:85124435-85124457 TGACGACGTCCAGCCCCAGGGGG + Intergenic
1152479471 17:80540595-80540617 GGCTGACGTTCACCACCAGCAGG + Intergenic
1156376969 18:36523462-36523484 AGGCCACATCCAGCATCAGCAGG + Intronic
1157136650 18:45063383-45063405 CGGCGGGCTCCAGCACCAGCGGG - Exonic
1164605339 19:29593907-29593929 GGGGAACCTCCAGCACCGGCAGG + Intergenic
1165907803 19:39204218-39204240 GGGCCAGGGCCAGCAGCAGCGGG + Exonic
1166124126 19:40703574-40703596 GAGCGATGTCCAGAACCTGCTGG - Exonic
1168353560 19:55689317-55689339 GGACGACGCCCAGCTCCAGCTGG + Intronic
926062385 2:9812524-9812546 GGGAGACGCCCAGCTCCAGTGGG - Intergenic
926170700 2:10550910-10550932 GAGGGACATCCAGCACCAGGTGG + Intergenic
926426215 2:12740740-12740762 TGTTGACGTCCGGCACCAGCTGG - Exonic
929000698 2:37344773-37344795 GGGCGGCCACCAGCAGCAGCAGG - Exonic
933794957 2:85912256-85912278 TGGCTACATCCAGGACCAGCTGG - Intergenic
938296554 2:130182639-130182661 GGGCCACGTTCAGCTTCAGCAGG - Exonic
938371173 2:130769068-130769090 GGGCGAAGGCCAGCACAGGCAGG + Intergenic
938460194 2:131491990-131492012 GGGCCACGTTCAGCTTCAGCAGG + Exonic
938491769 2:131764883-131764905 GGGCGACATCCAGCTCCAGGTGG + Intronic
938495798 2:131797459-131797481 GGGCGACATCCAGCTCCAGGTGG - Intronic
948383318 2:237566603-237566625 GGGCCAGGCCCAGCATCAGCAGG - Exonic
948867859 2:240784519-240784541 GGCGGACCTCCAGCACCATCAGG + Intronic
1175036274 20:56004196-56004218 GGGCGAGCACCAGCGCCAGCCGG - Exonic
1175889719 20:62310778-62310800 GGGCCCCGTCCGTCACCAGCAGG + Exonic
1176616131 21:9029291-9029313 GGGCAACATCCAGCCCCAGGTGG - Intergenic
1176709027 21:10134446-10134468 GGGCAACATCCAGCCCCAGGTGG + Intergenic
1179600389 21:42473978-42474000 GGACGATGCCCAGTACCAGCGGG - Intronic
1180293123 22:10861709-10861731 GGGCGACATCCAGCCCCAGGTGG + Intergenic
1180456646 22:15516111-15516133 GGGCGACATGCAGCCCCAGGCGG + Intergenic
1180495927 22:15891131-15891153 GGGCGACATCCAGCCCCAGGTGG + Intergenic
1181478157 22:23181044-23181066 GGGCGACATCGAGCAGGAGCTGG + Exonic
1184785160 22:46668134-46668156 GGGCGACGTCCAGCACCAGCTGG - Exonic
950303241 3:11899675-11899697 GGGAGTCGTTCAGTACCAGCAGG - Intergenic
950506817 3:13400180-13400202 GGGAGTCGTTCAGTACCAGCAGG + Intronic
957085485 3:75672627-75672649 GGGCGCCCCCCAGCAACAGCAGG - Intergenic
964227832 3:154428207-154428229 GGACGACGCCCATCTCCAGCAGG - Intronic
965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG + Intronic
968613461 4:1567286-1567308 GGGCAAGGTCCAGGACCGGCGGG + Intergenic
968944416 4:3655828-3655850 AGGTGACGTCCAGAAACAGCCGG + Intergenic
969577905 4:8047124-8047146 GGGCCACGTGCAGCAGCAGGAGG + Intronic
970583102 4:17491409-17491431 GGAAGGCTTCCAGCACCAGCAGG - Intronic
988547751 5:32174147-32174169 GGGCGACGTCCGTCGGCAGCAGG + Exonic
998256360 5:140591680-140591702 GGGACACGTCCAGCACCGACAGG + Intronic
1000954832 5:167530826-167530848 TTGCGACGTGCATCACCAGCAGG - Intronic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1002719109 5:181247064-181247086 GGGGGACGTCCTGCAGCCGCTGG + Intronic
1004289189 6:14350940-14350962 GGGCCAGGGCCAGTACCAGCAGG + Intergenic
1006071041 6:31498211-31498233 AGGCGACGGCCAGAAACAGCAGG - Exonic
1006121694 6:31810775-31810797 GAGCCACGTCCAGCAGCAGCAGG + Exonic
1006122720 6:31816926-31816948 GAGCCACGTCCAGCAGCAGCAGG - Exonic
1006124583 6:31829120-31829142 GAGCCACGTCCAGCAGCAGCAGG - Exonic
1006665301 6:35688957-35688979 CGGCGCCGTCCCGCCCCAGCCGG + Intronic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1013225240 6:108115894-108115916 CCTCGACGTCCAGCACCAGGTGG - Intronic
1018634876 6:165852157-165852179 GAGAGCCTTCCAGCACCAGCTGG - Intronic
1019176054 6:170160087-170160109 GGGCCTCGGGCAGCACCAGCAGG + Intergenic
1019219895 6:170464860-170464882 GGGCCCCCTCCACCACCAGCAGG - Intergenic
1019735465 7:2647977-2647999 TGATGACGTCCAGCAGCAGCAGG - Exonic
1022698069 7:32728912-32728934 CGGCGGCGGCCAGCACCGGCCGG + Intergenic
1034223273 7:149461194-149461216 TGGCCACTTCCAGCCCCAGCAGG - Intergenic
1039079720 8:33722739-33722761 GGGCGTCTTCCAGCACCACCAGG - Intergenic
1042569246 8:70144746-70144768 GGGAAAGGTCCAGCACCAGTTGG + Exonic
1044306441 8:90645845-90645867 GGGCGGCGTGCTGCAGCAGCCGG + Exonic
1047239386 8:123072641-123072663 GGCCTAGGTCCAGCACCAGCAGG - Intronic
1049265169 8:141664042-141664064 AGGCCACATCCAGCCCCAGCAGG - Intergenic
1053645999 9:40119965-40119987 GGGCAACATCCAGCCCCAGGCGG + Intergenic
1053759717 9:41343575-41343597 GGGCAACATCCAGCCCCAGGCGG - Intergenic
1054327011 9:63717862-63717884 GGGCAACATCCAGCCCCAGGCGG + Intergenic
1054538571 9:66256011-66256033 GGGCAACATCCAGCCCCAGGCGG - Intergenic
1057091597 9:92263024-92263046 GGGCCGTGGCCAGCACCAGCAGG + Exonic
1060964618 9:127705716-127705738 GGGCAATGTCCAGCAGGAGCAGG + Intronic
1061852897 9:133426226-133426248 GGGTGACGCCCCGCACCTGCCGG - Exonic
1062545894 9:137063650-137063672 GTGCGTACTCCAGCACCAGCGGG + Exonic
1062577074 9:137213855-137213877 GGGCGATGACCAGCATGAGCTGG + Exonic
1202793787 9_KI270719v1_random:103416-103438 GGGCAACATCCAGCCCCAGGTGG + Intergenic
1185457951 X:319866-319888 CGGCGACGTCCAGGACCCCCAGG - Intergenic
1186720716 X:12300768-12300790 GGGCCACCTCCACCACCACCTGG - Intronic
1193610913 X:83630881-83630903 GAGCGAAGGCCACCACCAGCGGG - Intergenic
1200951460 Y:8903089-8903111 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1201149515 Y:11088015-11088037 GGGCAACATCCAGCCCCAGGCGG - Intergenic
1202161487 Y:21940223-21940245 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202229869 Y:22646150-22646172 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202313287 Y:23550015-23550037 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202557515 Y:26120579-26120601 GGCCGACGTGGAGCAGCAGCAGG - Intergenic