ID: 1184785678

View in Genome Browser
Species Human (GRCh38)
Location 22:46670547-46670569
Sequence CGCCCTCCACGGGGAGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184785669_1184785678 0 Left 1184785669 22:46670524-46670546 CCCTGGACAGCTCCGGGGCAGGC 0: 1
1: 1
2: 1
3: 23
4: 212
Right 1184785678 22:46670547-46670569 CGCCCTCCACGGGGAGCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1184785670_1184785678 -1 Left 1184785670 22:46670525-46670547 CCTGGACAGCTCCGGGGCAGGCC 0: 1
1: 1
2: 1
3: 81
4: 244
Right 1184785678 22:46670547-46670569 CGCCCTCCACGGGGAGCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 188
1184785662_1184785678 23 Left 1184785662 22:46670501-46670523 CCAGAGCTGCAGTGCACTTGCGG No data
Right 1184785678 22:46670547-46670569 CGCCCTCCACGGGGAGCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184785678 Original CRISPR CGCCCTCCACGGGGAGCCTG GGG Intronic
900254655 1:1691766-1691788 GTCCCTCCACGGGGTGCCTTTGG - Intronic
900263407 1:1745041-1745063 GTCCCTCCACGGGGTGCCTTTGG - Intronic
900378843 1:2373744-2373766 CAGCCTCCACGAGGAGCCCGGGG + Intronic
900549207 1:3245609-3245631 CGCCGTCCACAGGATGCCTGAGG + Intronic
900606297 1:3525126-3525148 GTCCTTGCACGGGGAGCCTGTGG - Intronic
900740080 1:4325762-4325784 CTCCCTGCAGGGGCAGCCTGAGG - Intergenic
901087790 1:6622193-6622215 CGCCCTTCCAGGGGAGCCCGAGG - Exonic
903449173 1:23441328-23441350 CTCCCTCCACGGTGGGCCTTGGG + Intronic
903646744 1:24900758-24900780 CGTCCTCCCAGGGGAGCCTGTGG + Exonic
904265036 1:29313250-29313272 CGCTCTCCAGGGGGAGACAGAGG - Intronic
907158813 1:52356942-52356964 CTTCCTCCACGGGGAGGCTGTGG + Intronic
913323343 1:117605962-117605984 CGCCCTCCCGGGGGAGCCAGGGG - Exonic
916188060 1:162152254-162152276 CACCCATCACAGGGAGCCTGGGG - Intronic
916923936 1:169498010-169498032 CTCCTTCCCTGGGGAGCCTGAGG - Intergenic
920414807 1:205791755-205791777 CTCTCTCCAGGGGGAGCCAGAGG + Intronic
920505590 1:206513230-206513252 TGCCCTCCATGGGGAAACTGAGG - Intronic
922674597 1:227542681-227542703 CGCCCGGCACCGGGACCCTGCGG + Intergenic
923569107 1:235098582-235098604 CCCACTCCACGTGGAGCCAGTGG - Intergenic
924945944 1:248847046-248847068 CACCCTGCACCGTGAGCCTGTGG - Exonic
1063458523 10:6201619-6201641 CGCCCTCCCTGTGGAGCATGCGG + Intronic
1064230700 10:13528186-13528208 AGCCCTCCTCGGGGCGCCTCCGG - Intronic
1067242578 10:44508964-44508986 CGCCACCCAGAGGGAGCCTGGGG + Intergenic
1072938096 10:99732442-99732464 GGCCCGCCCCGGGGAGCCTTCGG - Intronic
1075492099 10:122880057-122880079 CGCGCTCCTCGGGGAACGTGAGG + Intergenic
1076111931 10:127866470-127866492 CTCCCTCCACTGGGCGCTTGTGG + Intergenic
1076481295 10:130786752-130786774 GGCCCTCCAAGGGGACACTGGGG - Intergenic
1076722619 10:132399298-132399320 CGCCCACCTCAGGGAACCTGTGG + Intronic
1076862017 10:133142160-133142182 CGGCCTGCACGGGGTGTCTGTGG - Intergenic
1077052812 11:575456-575478 GCCCCTGCACGGGGAGCCCGCGG + Intergenic
1078081401 11:8207149-8207171 CTCCCTCCACCGGGAGCTCGAGG - Intergenic
1080643654 11:34173219-34173241 CGCTGTCCACGGTGAGGCTGCGG + Exonic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083599771 11:63939386-63939408 CGTCCCCCGCGGGGACCCTGGGG + Intronic
1084618407 11:70251826-70251848 CGGCTTCCCCGGGGAGGCTGTGG + Intergenic
1084860410 11:72014373-72014395 CGCCCTCAACGAGCAGCGTGTGG - Exonic
1085010949 11:73141701-73141723 CGCCCCCCACCTGGAGCCGGCGG + Intronic
1087105187 11:94401260-94401282 ACCCCTCCCCTGGGAGCCTGCGG + Exonic
1088469287 11:110176496-110176518 CCCCAGCCACGGGGTGCCTGGGG + Intronic
1089201491 11:116727210-116727232 AGCCCTCCCGGGGGAGCCAGAGG + Intergenic
1089305115 11:117521693-117521715 CGCCCTCCTCAGTGAGCCAGAGG - Intronic
1090665808 11:128914298-128914320 CTCCCTCCACTACGAGCCTGTGG - Intronic
1091330402 11:134727483-134727505 CTCCCTCCAAGGGGAGGCTGTGG + Intergenic
1095944803 12:47747843-47747865 CACCTTCCATGTGGAGCCTGCGG - Exonic
1099989777 12:89709366-89709388 CGCGATCCGCGGGGAGCCTGGGG + Intergenic
1113455601 13:110446421-110446443 GGCGCTCCACGGGGGTCCTGCGG + Intronic
1113483260 13:110637009-110637031 CACCCTCCAGGAGCAGCCTGAGG - Intronic
1113981547 13:114281294-114281316 CCCCGGCCACGGAGAGCCTGGGG + Intergenic
1116657027 14:47665867-47665889 CGCGCTCCTCAGGGAGGCTGAGG - Intronic
1117759793 14:59015039-59015061 AGCACTCCTCTGGGAGCCTGAGG - Intergenic
1118074259 14:62281183-62281205 AGCCCTCAACTAGGAGCCTGAGG - Intergenic
1119418910 14:74494307-74494329 CTCCCTCCACTTGCAGCCTGAGG - Exonic
1119705377 14:76779780-76779802 GACCCTCCGCAGGGAGCCTGTGG - Exonic
1120171031 14:81247494-81247516 CGCCCACAAGGGGCAGCCTGCGG + Intergenic
1120865333 14:89291498-89291520 CGCCATCCCCAGGGGGCCTGTGG + Intronic
1122242978 14:100381519-100381541 CGCCCTGCAGGGGGCCCCTGTGG - Exonic
1122389091 14:101368117-101368139 CGCCCTCCACGTGGAACCCAGGG - Intergenic
1123945260 15:25235844-25235866 CACCCTCCATGGGGAGAATGGGG - Intergenic
1128144498 15:65325208-65325230 AGCCATCCAAGGGCAGCCTGGGG - Intergenic
1128809329 15:70559323-70559345 CGTCCTCCACAGCAAGCCTGCGG + Intergenic
1132502234 16:289675-289697 CGCCTTACACTGGCAGCCTGAGG - Intronic
1132588252 16:715450-715472 CGCGCTCCGAGGGGCGCCTGGGG - Intronic
1132724585 16:1333367-1333389 CGCCCTCCCCGTGGCGCGTGGGG - Intergenic
1132810451 16:1794368-1794390 CGCCATCCTCGGGGAGTGTGTGG + Intronic
1133473247 16:6095899-6095921 CAGACTCCACTGGGAGCCTGTGG - Intronic
1133810892 16:9160317-9160339 CGCCGTCCTCGGGGAGTCTCAGG + Intergenic
1134273277 16:12753727-12753749 CGTTTTCCACAGGGAGCCTGTGG + Intronic
1136515531 16:30766059-30766081 TGCCCTGCACGGGGTGCTTGGGG + Intronic
1138460257 16:57143743-57143765 CCTCCTCCCTGGGGAGCCTGGGG - Intronic
1139480952 16:67230450-67230472 CGCACTTCACGGGCCGCCTGCGG + Exonic
1139761612 16:69188111-69188133 CGCCCGCCCCGAGGAGCCAGAGG - Intronic
1140519424 16:75568554-75568576 GCTCCTCCACTGGGAGCCTGTGG + Intronic
1140648785 16:77064583-77064605 GGCCCTCCCTGGGGAGCCTAAGG + Intergenic
1141488608 16:84356849-84356871 CGCCCACCCCGGGAAGCCTGGGG - Intergenic
1141677449 16:85525112-85525134 TGGCCTCCACAGGGAACCTGAGG + Intergenic
1142142247 16:88477875-88477897 CGCCCTCCAGGCCAAGCCTGGGG - Intronic
1142685524 17:1575129-1575151 CCCCCTCCCCGGCCAGCCTGAGG - Exonic
1143078487 17:4365456-4365478 CGGCCTCCCCGAGGAGCCTGCGG - Intronic
1144467328 17:15506895-15506917 CGCCATCAACGGGGAGCCCTTGG + Intronic
1146256304 17:31392921-31392943 GGCCCTGCATGGGGGGCCTGGGG + Intronic
1146916555 17:36681880-36681902 CGGCCTCCACGTGGTGTCTGGGG - Intergenic
1147215855 17:38898636-38898658 TGCCCTCCAGGGTGGGCCTGGGG + Intronic
1148110757 17:45143778-45143800 CAGCCTCCCAGGGGAGCCTGGGG - Exonic
1148680446 17:49470512-49470534 CGGCTTCCGCGGGCAGCCTGGGG + Intronic
1148912529 17:50950458-50950480 AGCCGTCCAGGGGGTGCCTGCGG - Intergenic
1149599766 17:57885752-57885774 CGCTCTCCAAGGGCTGCCTGGGG - Exonic
1150003815 17:61457474-61457496 AGGGCTCCACGCGGAGCCTGAGG - Intronic
1150773327 17:68059942-68059964 CGCCCTCCAGGGTGTTCCTGGGG - Intergenic
1150775855 17:68080921-68080943 GGCGCTCCTCGGGGAGGCTGGGG - Intergenic
1151412911 17:73942955-73942977 TGCCCTCCATGAGGAGCATGGGG - Intergenic
1151718417 17:75843052-75843074 GGCCTTCCACGTGGAGCCCGAGG - Exonic
1152562623 17:81086135-81086157 CGCCCACCACTGAGAGCCAGAGG - Intronic
1152717103 17:81905470-81905492 AGCCCTCCCCGGGGAGGCAGCGG + Intronic
1152883022 17:82831210-82831232 CGGCCTCCCTGGGGAGCCCGTGG + Exonic
1157867018 18:51196654-51196676 CGCCCTGAACGGGGAGCAGGCGG - Exonic
1158534175 18:58292421-58292443 ACCCCTCCCAGGGGAGCCTGTGG - Intronic
1159045680 18:63367013-63367035 CGCCCTGCCCGGGGCGCATGTGG - Exonic
1160557092 18:79733031-79733053 CGCCCACCACGAGGAGACTCAGG - Intronic
1160686955 19:441376-441398 CGCCCTCCACAGGAAGTTTGCGG + Intronic
1160755098 19:752829-752851 CGCCCTCCCCGGGGAGCTCCAGG + Intronic
1161326692 19:3667650-3667672 CACCCACCACGGAGGGCCTGGGG + Intronic
1161400800 19:4065709-4065731 CGCCCTCCCCGGGGAGCGCGGGG + Intronic
1161487474 19:4543778-4543800 CGCCCCCGACGGGCAGCCTGAGG - Exonic
1161499791 19:4607550-4607572 CGCCCTCCAGTGGGGGCCAGGGG + Intergenic
1162555698 19:11384215-11384237 CCCCCGCCACGGGGAGCCCAGGG + Exonic
1163593752 19:18208844-18208866 CTCCCTCTAGGGGGAGTCTGAGG + Exonic
1165940769 19:39413698-39413720 CGCCCTCCCCTGGGACCCCGCGG + Intronic
1166121978 19:40691684-40691706 CGCCTTCCACGGGAGGCTTGAGG + Exonic
1166390639 19:42407162-42407184 CGCCCTCCTTGGTGAGCCTCAGG - Exonic
1166698074 19:44865563-44865585 CGTCCTCCACCGTGAGCCCGTGG - Exonic
1167125318 19:47545073-47545095 GGGCCTCCGCGGGGACCCTGAGG + Exonic
929533889 2:42768559-42768581 AGGCCTCTACGGGAAGCCTGTGG + Intronic
932125794 2:69144548-69144570 TCCCCTCCACGGGGCACCTGGGG - Intronic
932616325 2:73233776-73233798 CGCCATCCACGAGGAGCCTCTGG + Intronic
937119794 2:119433213-119433235 CGCCCTTCACCTGGAGCCTGTGG - Intronic
942681272 2:178480351-178480373 CGCCCTCCTCGCGCAGCCTCCGG + Intergenic
946196612 2:218035931-218035953 GGCCCTCCATGGGGAACATGGGG + Intronic
947591539 2:231388768-231388790 TGCCCACCCCAGGGAGCCTGGGG - Intergenic
1169072609 20:2742628-2742650 CACCCTCCATGGGGATCCTCAGG + Intronic
1170498570 20:16951058-16951080 GGCCCTCCACCTGGAGCCTTGGG + Intergenic
1171186326 20:23126661-23126683 CCCCCACCCCCGGGAGCCTGGGG + Intergenic
1175851533 20:62096708-62096730 AGCCCTCCCCTGGGGGCCTGCGG + Intergenic
1175915663 20:62424624-62424646 AGCCCTCCATGGGGAGCCTGAGG + Intronic
1176038453 20:63051792-63051814 GGCCCTCCATCGGGATCCTGTGG + Intergenic
1176171176 20:63697043-63697065 CGTCCTCTGCGGGGAGCGTGAGG + Exonic
1176205496 20:63885927-63885949 AGCCCTCCTCGGGGAGCCCCAGG - Intronic
1179982771 21:44905241-44905263 CGCCCTGCTCTGGGAGCCTGTGG + Intronic
1180046619 21:45309198-45309220 CTCCCTCCAGGGGGCGCCAGGGG - Intergenic
1180071600 21:45439556-45439578 CGGCCGCCAGGGGGAGCCAGAGG - Intronic
1180160663 21:45997509-45997531 CGCCCACCCAGGGGGGCCTGAGG + Intronic
1181964160 22:26645121-26645143 CTCCCTCCACCTGCAGCCTGAGG + Intergenic
1182485194 22:30635169-30635191 CGCCCTGGACTGGGAGGCTGGGG + Intergenic
1184513749 22:44947624-44947646 CACCTTCCACGCGGACCCTGTGG + Intronic
1184785678 22:46670547-46670569 CGCCCTCCACGGGGAGCCTGGGG + Intronic
1185126073 22:49011571-49011593 TGCCGGCCCCGGGGAGCCTGTGG + Intergenic
1185213675 22:49586401-49586423 GGCCCTCCTCGGGAGGCCTGTGG - Intronic
1185232889 22:49693503-49693525 CTCCCTCCACTGGGAGCCTCAGG - Intergenic
950535900 3:13577958-13577980 CCTCCTCCACTGGGAGACTGGGG - Intronic
950649023 3:14395855-14395877 TGCCATCCATGGGGAGACTGAGG + Intergenic
952968564 3:38636623-38636645 CGCCCACCAGGAGCAGCCTGGGG - Intronic
953027378 3:39152996-39153018 CTCCCCCCTCGGGGAGGCTGCGG - Intronic
953228692 3:41044233-41044255 CACTCTCCACGGGGATCCAGTGG - Intergenic
954108160 3:48420143-48420165 CACCCTTCCCGTGGAGCCTGGGG - Exonic
961746684 3:129068361-129068383 GGCCCTTGACGGGGAGGCTGGGG + Intergenic
966915367 3:184581626-184581648 CGGCTCCCACGGGGACCCTGAGG + Exonic
967877549 3:194277362-194277384 CGCGCTCCCCGGGCTGCCTGTGG - Intergenic
968336648 3:197919241-197919263 GGCCCTCCACGGTGACCGTGTGG + Intronic
968502475 4:957332-957354 CTCCCTCCACAGGGAGGCTGTGG - Intronic
969153238 4:5187993-5188015 CGCCCTACACGAGGAAACTGAGG - Intronic
969674709 4:8608265-8608287 GGCTCTCCACGCGAAGCCTGGGG - Intronic
974824077 4:67104350-67104372 CGCCCTGCACAGCAAGCCTGTGG - Intergenic
975148383 4:70994097-70994119 CCCGCTCCACGGGGTGACTGCGG + Intronic
975744983 4:77466651-77466673 CGCACTCCTCGGGGAGGCTCCGG - Intergenic
980299749 4:130973225-130973247 CAAGCTCCATGGGGAGCCTGTGG - Intergenic
983940270 4:173529504-173529526 CGCGCCCCATGGGGAGCCGGCGG - Exonic
986705989 5:10455379-10455401 CACCCCCCAGTGGGAGCCTGAGG + Intronic
987193194 5:15500232-15500254 CGCCCTCCCCGGGGAAGCCGCGG + Exonic
988998754 5:36739826-36739848 CTCCCTCCTCTGGGAGCCTGCGG - Intergenic
991265005 5:64707405-64707427 AGCCCTCTACGGGGACCGTGAGG + Intronic
997963205 5:138338146-138338168 CGCCCTCCATGGGTGGCTTGGGG + Exonic
998193064 5:140043174-140043196 AGCCCTCCACCGGCAGCCCGGGG + Exonic
1003114801 6:3276670-3276692 CGCCCTACCCAGGTAGCCTGTGG - Intronic
1007828816 6:44622315-44622337 CACACCCCACGGGGATCCTGAGG - Intergenic
1011603522 6:89081134-89081156 CTCCCGCCACGGCGAGGCTGCGG - Exonic
1011879892 6:92011798-92011820 CGGCCTCCTCGGGGAGGCTCAGG + Intergenic
1016732189 6:147438972-147438994 CGCTCTCCCCAGGCAGCCTGGGG + Intergenic
1017206315 6:151807748-151807770 GGCCCTGCCCCGGGAGCCTGCGG - Intronic
1017696595 6:157021735-157021757 CCGCCTCCAGGAGGAGCCTGCGG - Intronic
1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG + Intronic
1024569048 7:50709360-50709382 CGCCCACCACTGGGGGCCAGAGG - Intronic
1024791024 7:52964892-52964914 TGCCCTCCTCGTGGAGCCTTGGG - Intergenic
1026595826 7:71733348-71733370 CTCCCTCCTCGGGGGGCCTGCGG - Intergenic
1026875603 7:73877365-73877387 GGCCCTGCATGGGGAGACTGAGG + Intergenic
1026992572 7:74595638-74595660 GGGCCTCCCCAGGGAGCCTGAGG + Intronic
1029423472 7:100483570-100483592 CGCCCCCCAGCGGCAGCCTGGGG - Intergenic
1030980651 7:116182035-116182057 GGCGCTCCTCGGGGAGGCTGCGG + Intergenic
1032513724 7:132491958-132491980 GGCCTTCCAAGGGCAGCCTGGGG + Intronic
1033471242 7:141651543-141651565 TGCCCTCCACGTGCAGCTTGGGG - Exonic
1034159593 7:148983234-148983256 CCCCCTCCACGGGGAACCGGGGG + Intergenic
1034218046 7:149422834-149422856 CGCCCTCCATTTGGCGCCTGTGG - Intergenic
1034418958 7:150979131-150979153 CGCCCTCCCCCGGCAGCCCGGGG + Intergenic
1036616345 8:10390484-10390506 CGCCCACCACGGGAAGCCAGGGG + Intronic
1042499013 8:69488890-69488912 CACCTTCCCCGGGGAGCCTCAGG - Intronic
1047952332 8:129945176-129945198 TGTCATCCATGGGGAGCCTGAGG + Intronic
1048502774 8:134993855-134993877 CACCCTCCAAGTGGAGGCTGAGG - Intergenic
1049358700 8:142201616-142201638 CTCCTTCCAGGGGGAGGCTGGGG - Intergenic
1049377642 8:142296633-142296655 CGCCTCCCACGGGGAGTCTCTGG - Intronic
1049599311 8:143499726-143499748 CACCCTCCACGGAGGCCCTGGGG + Intronic
1049641742 8:143719064-143719086 CGACCTCCCCGAGGGGCCTGAGG + Exonic
1049680887 8:143917625-143917647 CCACCTCCACGGGCAGCCGGTGG + Exonic
1049748533 8:144273058-144273080 CGCCCTCCACAAGCAGCGTGGGG + Intronic
1052313460 9:27092918-27092940 TGCGCTCCTCGGGGAGGCTGGGG - Intergenic
1053149860 9:35736556-35736578 GGCTCTGCACTGGGAGCCTGAGG - Exonic
1054858192 9:69923719-69923741 CGCTCTCCACTGGGAGCTAGAGG - Intergenic
1059663925 9:116427834-116427856 CCCCCCCCAAGAGGAGCCTGAGG + Intronic
1060305341 9:122406252-122406274 GGCGCTCGACGGGGAGGCTGGGG + Intergenic
1060657042 9:125379124-125379146 GGCCCTCCATGGGGAGCCATGGG - Intergenic
1062005425 9:134236397-134236419 TGCCCTCCACTGGGACGCTGGGG - Intergenic
1062027588 9:134347638-134347660 AGCCCTCCAGGGGGATGCTGCGG + Intronic
1062476189 9:136728577-136728599 CGCCCACCCCGGGCAGCATGGGG + Intergenic
1062542075 9:137045948-137045970 CGCCCTCCCCGCGGCACCTGCGG - Exonic
1189353393 X:40293970-40293992 CTCCCTCCCCTGGGAGTCTGAGG - Intergenic
1190745069 X:53317653-53317675 CCTCCACCAGGGGGAGCCTGGGG + Intronic
1190927535 X:54922585-54922607 TGCCTCCCCCGGGGAGCCTGGGG + Exonic
1194299198 X:92163601-92163623 CGCCCTCACTGGGGAACCTGAGG - Intronic
1199050193 X:143228745-143228767 GGCGCTCCTCGGGGAGGCTGGGG + Intergenic
1200001934 X:153066606-153066628 TGTCCTCCAGGGAGAGCCTGGGG - Intergenic
1200005798 X:153083419-153083441 TGTCCTCCAGGGAGAGCCTGGGG + Intergenic
1200616802 Y:5388435-5388457 CGCCCTCACTGGGGAACCTGAGG - Intronic