ID: 1184787459

View in Genome Browser
Species Human (GRCh38)
Location 22:46678783-46678805
Sequence TCTGCGGCCCCTCGTGAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184787459_1184787469 6 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787469 22:46678812-46678834 CGCTGGTGCCGGGGGTGCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 120
1184787459_1184787467 -3 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787467 22:46678803-46678825 AGAGTCACACGCTGGTGCCGGGG 0: 1
1: 0
2: 1
3: 177
4: 9374
1184787459_1184787473 10 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787473 22:46678816-46678838 GGTGCCGGGGGTGCTTTGGGGGG 0: 1
1: 0
2: 3
3: 25
4: 223
1184787459_1184787466 -4 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787466 22:46678802-46678824 CAGAGTCACACGCTGGTGCCGGG 0: 1
1: 0
2: 5
3: 705
4: 2794
1184787459_1184787465 -5 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787465 22:46678801-46678823 GCAGAGTCACACGCTGGTGCCGG 0: 1
1: 1
2: 0
3: 23
4: 194
1184787459_1184787471 8 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787471 22:46678814-46678836 CTGGTGCCGGGGGTGCTTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 169
1184787459_1184787468 -2 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787468 22:46678804-46678826 GAGTCACACGCTGGTGCCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 81
1184787459_1184787470 7 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787470 22:46678813-46678835 GCTGGTGCCGGGGGTGCTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 175
1184787459_1184787472 9 Left 1184787459 22:46678783-46678805 CCCCCTTCACGAGGGGCCGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1184787472 22:46678815-46678837 TGGTGCCGGGGGTGCTTTGGGGG 0: 1
1: 1
2: 2
3: 9
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184787459 Original CRISPR TCTGCGGCCCCTCGTGAAGG GGG (reversed) Exonic
900012989 1:132247-132269 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
900043055 1:488234-488256 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
900064491 1:723231-723253 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
900192052 1:1356018-1356040 TCTGAGGACCCTGGTGGAGGAGG + Intronic
900192091 1:1356114-1356136 CCTGAGGCCCCTCGTGGTGGGGG + Intronic
900627333 1:3614774-3614796 TCTGCTGTCCGCCGTGAAGGAGG + Intergenic
902653873 1:17854207-17854229 GCTGCTGCCCCTCGGGAATGGGG - Intergenic
907333798 1:53687708-53687730 TGTCCGTCCCTTCGTGAAGGAGG - Intronic
915228823 1:154430644-154430666 TCTGGGGGGCCTCGGGAAGGAGG - Intronic
918497460 1:185156667-185156689 GCTGCTGCCCCTGGAGAAGGAGG - Exonic
922099388 1:222469245-222469267 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
922261425 1:223948740-223948762 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
922735649 1:227977003-227977025 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
924342587 1:243050917-243050939 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1066733886 10:38454635-38454657 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1072614411 10:97039945-97039967 CCTGTGGACCCACGTGAAGGGGG + Intronic
1076135647 10:128044280-128044302 TCTAGGGCCCCTGGGGAAGGAGG + Intronic
1076969326 11:124451-124473 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1077957869 11:7040250-7040272 TCGGCGGCCCCTCGGGAATCAGG + Intronic
1079075949 11:17385759-17385781 TCTATGGCGCCTCTTGAAGGGGG + Intergenic
1079499684 11:21089049-21089071 ACTGTGGCCCCTCATGAATGGGG + Intronic
1079991693 11:27253158-27253180 TCTGCTGCCACCCGTGAAGAAGG + Intergenic
1088911909 11:114198538-114198560 TCGGGGGCCCCTCCAGAAGGTGG - Intronic
1103122680 12:118393990-118394012 TCAGCGACCCCTGGGGAAGGTGG - Intronic
1104931003 12:132339436-132339458 TCTGCGGCCCCTCGGCCATGTGG + Intergenic
1115999097 14:39224061-39224083 TCTGCAGCCTCTGGTGAGGGCGG - Intergenic
1118608714 14:67522861-67522883 TCTGCAGCCTTTCCTGAAGGTGG - Intronic
1119545667 14:75469726-75469748 CCTGGGGCCCCACTTGAAGGAGG + Exonic
1122861283 14:104583458-104583480 TCTGCGGGCTCGCGTGAGGGTGG - Intronic
1126896060 15:53258318-53258340 TCTGAGGCTCCACGTGCAGGAGG + Intergenic
1128616550 15:69114919-69114941 CCTGCAGCTCCTCGTGAAGACGG - Intergenic
1129903522 15:79169962-79169984 TCTGGGGCCCAGCGTGGAGGTGG - Intergenic
1130764054 15:86852199-86852221 TCTCCTGCCCCTTGTGAAGAAGG - Intronic
1132229494 15:100171136-100171158 ACTGCAGCCCCTCCTGCAGGTGG - Intronic
1139916301 16:70430523-70430545 TCAGGCTCCCCTCGTGAAGGGGG - Intronic
1139975464 16:70806637-70806659 TCTCCTGCCCCTCTTGTAGGAGG + Intergenic
1142142868 16:88480306-88480328 TCTCTGGCACCTCGTGAGGGTGG + Intronic
1142451347 16:90174671-90174693 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1147237548 17:39068961-39068983 TCTGCAGCCCCGAGTGAAGGGGG + Intronic
1148351849 17:46946979-46947001 ACTGCTGCCCCTGGGGAAGGTGG + Intronic
1152258859 17:79255786-79255808 TCTGCGGCCCCTCTAGGAAGGGG - Intronic
1152705979 17:81843914-81843936 CCTGCGGCCTCGCTTGAAGGAGG - Exonic
1158589720 18:58768993-58769015 TCTGGGGCCCCTGGGGCAGGGGG + Intergenic
1160646131 19:194377-194399 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1164669024 19:30062628-30062650 ACAGCGGCCCCTCCTGAAGGGGG + Intergenic
1165825536 19:38703683-38703705 TCTGCCTGCCCTCGTGAGGGCGG - Intronic
1166368502 19:42289247-42289269 TTTGCAGCCCCTGGTGAGGGAGG + Exonic
1167736073 19:51295287-51295309 GCAGCTGCCCCTCCTGAAGGCGG + Intergenic
925785157 2:7424748-7424770 TCTGAGGCAGCTTGTGAAGGTGG - Intergenic
927640014 2:24840263-24840285 ACTGAGGCCCCTCGGGAAGTGGG - Intronic
927859710 2:26552990-26553012 TCTGCCGCCCCTGGTAAAGGAGG - Intronic
927883833 2:26706597-26706619 TCTCCGGCCCCTCCTGGAGGTGG - Intronic
932749291 2:74361254-74361276 CCTGAGGCCCCTCAGGAAGGAGG + Exonic
938757874 2:134397388-134397410 TCTGTGGCCCCTGGTGAGGCAGG - Intronic
943687570 2:190834907-190834929 TCTGCTGCTCCTCGTGGAGCAGG + Intergenic
948947694 2:241229467-241229489 CCTGCGGGACCTCGGGAAGGGGG + Exonic
1175286692 20:57841343-57841365 GCTGGGGCCCCTCGGGCAGGCGG - Intergenic
1175494504 20:59404291-59404313 TCTGCTGCCTCTGGTGAACGAGG - Intergenic
1175742664 20:61430989-61431011 CATGTGGCCCCTCGGGAAGGAGG - Intronic
1176279376 20:64291839-64291861 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1178856380 21:36253849-36253871 GCTGCTGCACCTGGTGAAGGAGG + Exonic
1179213824 21:39349297-39349319 TCTGGGGCCCCGCGAGACGGCGG - Intronic
1179908273 21:44435265-44435287 GCAGCCGCCCCTTGTGAAGGTGG - Intronic
1183520848 22:38295309-38295331 ACTGCCGCCCCTGGTGCAGGAGG + Intronic
1183831158 22:40418937-40418959 ACTGCAGATCCTCGTGAAGGAGG - Exonic
1184787459 22:46678783-46678805 TCTGCGGCCCCTCGTGAAGGGGG - Exonic
950101579 3:10360108-10360130 TCTGCAGCCCCCAGAGAAGGAGG - Exonic
963549509 3:146702409-146702431 TCTGCCGCCCGTTGGGAAGGAGG + Intergenic
968371550 3:198225149-198225171 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
976095406 4:81503285-81503307 TCTGTGGGCCCTCCTGAATGTGG + Intronic
979260234 4:118637624-118637646 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
984734403 4:183097671-183097693 TCTGCGGCCAATCTCGAAGGTGG - Intergenic
992638857 5:78751420-78751442 TCTGAGGCTCCTCATGAAGGAGG - Intronic
992694714 5:79274898-79274920 TCTGCTGCCTTCCGTGAAGGAGG - Intronic
999326655 5:150648305-150648327 GCTGCGGCACCTGGAGAAGGTGG + Exonic
1002303040 5:178268311-178268333 TCTGCGGCCCCTTGGGAGGAAGG - Intronic
1002730788 5:181330695-181330717 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1002753743 6:143409-143431 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1006802202 6:36766311-36766333 TCTGTGGCCCCTCCAGGAGGAGG + Intronic
1023056181 7:36291800-36291822 TCTGCCACACCTTGTGAAGGAGG - Intronic
1023401952 7:39797225-39797247 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1024075932 7:45817855-45817877 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1024240216 7:47429005-47429027 TCTGTGGCCCTGGGTGAAGGTGG - Intronic
1024647668 7:51383437-51383459 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1025051503 7:55737929-55737951 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1025128466 7:56363596-56363618 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1025176851 7:56806474-56806496 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic
1025694941 7:63769912-63769934 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1026335030 7:69386830-69386852 TCTGCAGCCCCTCTTGCAGCTGG + Intergenic
1028173624 7:87628486-87628508 GCTGAGGTCCCTCGGGAAGGAGG + Exonic
1031435749 7:121729814-121729836 TCTCCGGCCCCTAGTGAAGAAGG - Intergenic
1032052464 7:128657617-128657639 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1033725914 7:144118583-144118605 TCTGCTGCTCCTCGGGATGGCGG + Intergenic
1035413155 7:158662015-158662037 TCTGTTGCCCCTCTTGAGGGTGG - Intronic
1039727354 8:40233146-40233168 TCTGTGGCCCCACCTCAAGGTGG + Intergenic
1040876566 8:52158670-52158692 TCTGTGGCTCCTCTTGAAGTTGG - Intronic
1042532798 8:69832732-69832754 GCTTCGGCCCCTCGTGCCGGTGG - Exonic
1043092241 8:75920089-75920111 TCTGAGGCCACTAGTGAATGAGG - Intergenic
1047327307 8:123852151-123852173 TGTGTGGACCATCGTGAAGGTGG + Exonic
1048447118 8:134499803-134499825 TTTGAGGCCCCTTGTGAAGCAGG + Intronic
1049688135 8:143947190-143947212 TCTGTGGCCCTGCGTCAAGGAGG - Intronic
1053475042 9:38376571-38376593 CCCGGGGCCCCTCGTCAAGGAGG + Intergenic
1057220499 9:93255241-93255263 TCTGCAGCGCCCAGTGAAGGAGG + Intronic
1059869523 9:118556394-118556416 TCTACGGCCCCACGTGACCGTGG - Intergenic
1060661740 9:125408631-125408653 TCTGCGGGCCCTGGTCAGGGAGG + Intergenic
1061283701 9:129610814-129610836 TCTACGGCCCCTCCTCCAGGTGG - Intronic
1061734676 9:132645841-132645863 ACTGCGGCCCCACGTGGAGATGG - Intronic
1061858546 9:133456151-133456173 TGGGCGGCCCCTCGGGGAGGTGG + Exonic
1062755196 9:138283202-138283224 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1203579107 Un_KI270745v1:27374-27396 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1185817492 X:3169848-3169870 GCTGCGGACCCTCTTAAAGGTGG + Intergenic
1186465130 X:9779110-9779132 TCAGTGGCCCCTTCTGAAGGAGG + Intronic
1186785945 X:12956009-12956031 TCTGCTGCTCCTGGTGCAGGAGG - Intergenic
1201890228 Y:18935798-18935820 TCTGAGTCCCCTTGGGAAGGTGG + Intergenic
1202381720 Y:24279994-24280016 TTTGCAGCCCCTGGTGAGGGAGG - Intergenic
1202489065 Y:25390132-25390154 TTTGCAGCCCCTGGTGAGGGAGG + Intergenic