ID: 1184790163

View in Genome Browser
Species Human (GRCh38)
Location 22:46695275-46695297
Sequence TGTCCCTTCATAGCAGTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184790159_1184790163 5 Left 1184790159 22:46695247-46695269 CCGTGTGTTGTGCAGGGAGGAAG 0: 1
1: 0
2: 2
3: 25
4: 282
Right 1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1184790151_1184790163 25 Left 1184790151 22:46695227-46695249 CCTATCCCTTGGAGATCCCACCG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1184790157_1184790163 8 Left 1184790157 22:46695244-46695266 CCACCGTGTGTTGTGCAGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1184790153_1184790163 19 Left 1184790153 22:46695233-46695255 CCTTGGAGATCCCACCGTGTGTT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1184790156_1184790163 9 Left 1184790156 22:46695243-46695265 CCCACCGTGTGTTGTGCAGGGAG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1184790152_1184790163 20 Left 1184790152 22:46695232-46695254 CCCTTGGAGATCCCACCGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184790163 Original CRISPR TGTCCCTTCATAGCAGTGGT GGG Exonic
903209867 1:21811887-21811909 TGTCCCCCCATAGCAGTGCACGG - Intergenic
903813100 1:26045766-26045788 TTTGCCATCCTAGCAGTGGTTGG - Intronic
904575750 1:31504063-31504085 TGTCCCCACATAGCTGGGGTGGG + Intergenic
905533123 1:38697938-38697960 AGTCCCTTGATAGCAGTGTTTGG - Intergenic
906184223 1:43849076-43849098 TTGCCCTTCATAGCAGTTTTGGG + Intronic
910598668 1:89006593-89006615 TGAGTCTTTATAGCAGTGGTTGG - Intergenic
911150572 1:94593901-94593923 TGTCCCTTCAGAGTTGTGCTGGG - Intergenic
911853886 1:102853696-102853718 GGCCCCTTCAGCGCAGTGGTGGG - Intergenic
918778304 1:188666326-188666348 TGTCCCTTCCCAGGAGTGGGCGG - Intergenic
919203898 1:194395390-194395412 TGTCCCTTCATAGCTGAGTGTGG - Intergenic
921404579 1:214765001-214765023 ACTCCCATCACAGCAGTGGTAGG + Intergenic
921478576 1:215637590-215637612 TTTCATTTAATAGCAGTGGTAGG - Intronic
922033065 1:221823167-221823189 TGGCCCAGCATATCAGTGGTAGG + Intergenic
922684775 1:227630672-227630694 TGTCCCCTCCAAGCAGTGGGAGG - Intronic
1070187837 10:74083527-74083549 TGTCCTTACAGAGCAGTAGTGGG + Intronic
1070381410 10:75883563-75883585 TTTCCTTTCATTGCAGGGGTGGG + Intronic
1070492135 10:76987393-76987415 TGTACCTTCACAGCAGAGGTTGG + Intronic
1085620515 11:78034660-78034682 GGTCCCTTCAGTGCAGAGGTGGG + Intronic
1087526043 11:99314659-99314681 TGTTACTTAATAGCAGTAGTAGG - Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1094358699 12:29606921-29606943 GGTGCCTTCATCTCAGTGGTGGG + Intronic
1096503119 12:52077395-52077417 TGTCTCTCCATAGCCCTGGTGGG + Exonic
1097303458 12:58043199-58043221 TGTACCGTCAAAGCAGTGGGGGG + Intergenic
1100105327 12:91164082-91164104 TTTACCTTTTTAGCAGTGGTAGG - Intronic
1101051234 12:100866269-100866291 TGCCTCTTCAAAGCAGTGGCAGG + Intronic
1101446393 12:104739679-104739701 TGTCCCTTAAGAGCAGCTGTGGG + Intronic
1101480032 12:105087797-105087819 TGTCCCTGGAATGCAGTGGTGGG + Intergenic
1109931672 13:69224687-69224709 TGCCCCTTCCAAGCAGTGGGAGG + Intergenic
1112356210 13:98676599-98676621 TGTCCCTGCTTTGCAGTGGCTGG - Intergenic
1114444819 14:22780324-22780346 TGTCCAATCACAGCAGTGGGAGG + Intronic
1115783518 14:36798308-36798330 AGTCCCTTCATAGTTTTGGTGGG + Intronic
1118231160 14:63951170-63951192 TGTCACATCATAGCATTGTTAGG + Intronic
1122763050 14:104044043-104044065 TGTCCCATCCCTGCAGTGGTGGG - Intronic
1127322343 15:57859030-57859052 TGTCACTTCAGAGCAGTTTTTGG - Intergenic
1128792167 15:70441422-70441444 TGGCCATTTATAGCAGGGGTAGG - Intergenic
1130014221 15:80174839-80174861 TGTCCCTGGATAGCAGTAGGGGG - Intronic
1133876610 16:9740781-9740803 TGTCACTTCAGAGCAGAAGTAGG - Intergenic
1138312352 16:56038703-56038725 TGTTACTTCCTGGCAGTGGTAGG + Intergenic
1138814120 16:60184498-60184520 TGTCTCTTCATAGCTTTGGGGGG - Intergenic
1141149262 16:81552840-81552862 TGTTCCTTCATTGCTGTGGCTGG + Intronic
1141283731 16:82652075-82652097 TTTGCTTTCATAGCTGTGGTAGG - Intronic
1146266924 17:31458851-31458873 TGGCCCTTGATAGCAGTGTGGGG + Intronic
1147342172 17:39759482-39759504 TGTATCTTCATAACAATGGTGGG + Intergenic
1150671519 17:67203437-67203459 TGTTCTTTCATGGCAGTGCTGGG - Exonic
1153266216 18:3272397-3272419 TATGCCTTCATAACAGTGCTTGG + Intronic
1157643909 18:49247110-49247132 TCTCCCTTCAAAGCAAAGGTTGG + Intronic
1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG + Intronic
1166740148 19:45109652-45109674 TGAGCCTCCATAGCTGTGGTGGG - Intronic
1167013024 19:46821545-46821567 TGCCCCTTCTGAGCTGTGGTGGG + Intergenic
1168077301 19:53988177-53988199 TGTCAGTTCAGTGCAGTGGTGGG + Exonic
1168154785 19:54466898-54466920 TGCCCCTTGGTAGCAGTGATGGG - Intronic
925680120 2:6411637-6411659 TCTTCCTTCATGGCAGTGTTGGG - Intergenic
926935433 2:18083045-18083067 TGTCCCTTAATAATAGTGGCTGG - Intronic
927462981 2:23315258-23315280 TGTCCCATCATGGAAGTGGGAGG - Intergenic
931303055 2:61000059-61000081 TGTCCCTTGATATCTGTGGGGGG - Intronic
932491481 2:72125557-72125579 TGTACCTGCATTGCCGTGGTGGG + Intergenic
942102896 2:172603613-172603635 TGGCACTTTATAGCAGTGGTGGG + Intronic
944547718 2:200814051-200814073 TGTCCCCTTGTAGTAGTGGTGGG + Intronic
1168854821 20:1001316-1001338 TGTCCCTGCAGAGCAGGAGTTGG - Intronic
1177031814 21:15989715-15989737 TGTGGCTTCATGACAGTGGTGGG + Intergenic
1177263584 21:18757410-18757432 TGTCCCCTCCAAGCAGTGGTAGG - Intergenic
1178282227 21:31293313-31293335 TGACCCTTCATAACATTGGTAGG - Intronic
1178627192 21:34227977-34227999 TGTCCCTTCATAGCAGGACCTGG - Intergenic
1179083479 21:38195426-38195448 TGTCCCTTCTTTGCTGTGTTGGG + Intronic
1179315952 21:40244663-40244685 TGGTCCCTCACAGCAGTGGTAGG + Intronic
1181065209 22:20302603-20302625 TGGCCCTTCTGAGCAGTGCTTGG + Intergenic
1183008490 22:34924831-34924853 TGTCCCTGCATATCAGTAATTGG - Intergenic
1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG + Exonic
950591754 3:13941009-13941031 TGTTTCTTCATAGGAGTGGAAGG + Intronic
951200762 3:19873654-19873676 TGCCCCTTCCAAGCAGTGGGAGG - Intergenic
953828725 3:46277182-46277204 TTTCCCTTCCAGGCAGTGGTGGG - Intergenic
954317528 3:49809329-49809351 TGGCCCCTCAGAGCAGAGGTAGG - Intronic
957666381 3:83235014-83235036 TGTACATGCATAGCAGTGTTGGG + Intergenic
959123773 3:102265433-102265455 TGTCCTTACATAGCAGAGATGGG - Intronic
963617378 3:147559056-147559078 CATCCCTTCAAAACAGTGGTGGG - Intergenic
964862639 3:161219570-161219592 TGTCTCTTCAGAGTTGTGGTGGG + Intronic
965384540 3:168030243-168030265 TCTGCCTTAATAGCAGTAGTTGG - Intronic
968601138 4:1509818-1509840 TGTCCCTTCATAGGACAGGCAGG - Intergenic
974190780 4:58499673-58499695 TATCCTTTCAGAGCAGAGGTTGG + Intergenic
974925757 4:68295914-68295936 TGTCTTTTCATAGCGGTGGCCGG - Intergenic
976188100 4:82463111-82463133 TGTCCCCTCATAGCAGATCTGGG - Intergenic
981746215 4:148054877-148054899 TGTCCCTTTAGAGCTGTGCTTGG + Intronic
982090479 4:151876039-151876061 TGTCCCATCATCTCAGTGGGGGG - Intergenic
992112059 5:73504334-73504356 TTTCCTTTCATAGCTGTGGATGG + Exonic
997599580 5:135130182-135130204 TGCCCCTTCATGGCAGTTCTGGG + Intronic
998700460 5:144692938-144692960 TCTCCCTGCAGAGCAGTGCTAGG - Intergenic
1003145134 6:3504154-3504176 TGCCCCTTGGTAGCAGCGGTGGG + Intergenic
1008252777 6:49260578-49260600 GGTCCATTTATAGCAGTGATTGG + Intergenic
1008312582 6:49994631-49994653 TGTCCCCTCATAGAAGTGCTTGG - Intergenic
1012008887 6:93754523-93754545 TGTCGCTTCATACCTGTGGTAGG + Intergenic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1027056276 7:75052154-75052176 TTTCACTTCATAGCTGCGGTTGG + Intronic
1027867271 7:83663675-83663697 ACTCACTTCATAGCAGTGGCAGG - Intergenic
1030843567 7:114383316-114383338 TGCCCCTTCCAAGCAGTGGGAGG - Intronic
1032797854 7:135291847-135291869 TGTCCTTACATGGCAGGGGTGGG - Intergenic
1033244925 7:139709775-139709797 TATTTCTTTATAGCAGTGGTGGG + Intronic
1033284315 7:140027217-140027239 TGTCCCTTCACACCACTGGCTGG - Intronic
1033854265 7:145538262-145538284 TGTCCCTTCATATGTGTTGTAGG + Intergenic
1036495290 8:9264846-9264868 TTTCTCTACATAGCAGTAGTTGG + Intergenic
1036820736 8:11937317-11937339 TGGCTCGTCATATCAGTGGTGGG + Intergenic
1039717470 8:40125595-40125617 TGTCCCTTGAATTCAGTGGTGGG - Intergenic
1047700452 8:127444344-127444366 TGTGCCCTCATTGCAGTGGAAGG - Intergenic
1047760437 8:127950298-127950320 TCTCCCTGCATAGGAGTGGGAGG + Intergenic
1050922260 9:11218611-11218633 TCTCCATTCATAGAAGTTGTGGG - Intergenic
1052502379 9:29308170-29308192 TATTCCTTCATAGCAGTGTGAGG - Intergenic
1059063072 9:111053672-111053694 TGTCCATTCATAGCCATAGTTGG - Intergenic
1060254015 9:122010583-122010605 TGTCCCTCCATTGCAGAGGATGG - Intronic
1061403597 9:130381871-130381893 TGAGCCTTCATGGCAGTGCTGGG - Intronic
1061758529 9:132833351-132833373 TGTCCCATCATGGCAGTTGTCGG - Intronic
1189589940 X:42500139-42500161 TGTCCCTTCATACTTGTGGAGGG - Intergenic
1190648221 X:52543363-52543385 TGTCCCTGCAGAGCTGTGGAAGG + Intergenic
1190652141 X:52577720-52577742 TATACCTTCACAGCAGTAGTTGG - Intergenic
1190652674 X:52582491-52582513 TGTCCCTGCAGAGCTGTGGAAGG + Intergenic
1190681543 X:52830737-52830759 TGTCCCTGCAGAGCTGTGGGAGG - Intergenic
1190998620 X:55636777-55636799 TGTCCCTGCAGAGCTGTGGGAGG - Intergenic
1192772123 X:74203898-74203920 TGTCCCCACAGAACAGTGGTTGG - Intergenic
1192833772 X:74777992-74778014 TGTCCAATCAGAGCTGTGGTGGG - Intronic
1195132144 X:101863717-101863739 TCACCCTTCAAAGCAGTGGGCGG - Intergenic