ID: 1184796436

View in Genome Browser
Species Human (GRCh38)
Location 22:46736069-46736091
Sequence TGGTCCCTCTTGGAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184796436_1184796442 -10 Left 1184796436 22:46736069-46736091 CCCTCCCTCTCCAAGAGGGACCA 0: 1
1: 0
2: 4
3: 23
4: 213
Right 1184796442 22:46736082-46736104 AGAGGGACCAAGCTCCTGGCAGG 0: 1
1: 1
2: 3
3: 13
4: 181
1184796436_1184796444 -1 Left 1184796436 22:46736069-46736091 CCCTCCCTCTCCAAGAGGGACCA 0: 1
1: 0
2: 4
3: 23
4: 213
Right 1184796444 22:46736091-46736113 AAGCTCCTGGCAGGCCAGTCAGG 0: 1
1: 0
2: 0
3: 11
4: 202
1184796436_1184796446 8 Left 1184796436 22:46736069-46736091 CCCTCCCTCTCCAAGAGGGACCA 0: 1
1: 0
2: 4
3: 23
4: 213
Right 1184796446 22:46736100-46736122 GCAGGCCAGTCAGGCAGCTCAGG 0: 1
1: 0
2: 1
3: 33
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184796436 Original CRISPR TGGTCCCTCTTGGAGAGGGA GGG (reversed) Intronic
903340182 1:22648978-22649000 TGGTCCTTCTTGGAGGATGATGG + Intergenic
905268786 1:36773118-36773140 TGGTCCCTGTGGCAGAGGGAAGG - Intergenic
905874230 1:41422181-41422203 GGGTCCAGGTTGGAGAGGGAGGG + Intergenic
912234436 1:107834646-107834668 TGGTCTCTCTTGGTGGGAGAGGG - Intronic
912607456 1:111006471-111006493 TGGTCCCACATTGGGAGGGAGGG - Intergenic
912680350 1:111725370-111725392 TGTTCCCTACTGGAGTGGGAGGG + Exonic
918776542 1:188638936-188638958 AGGTACCTCTTGCTGAGGGAGGG + Intergenic
919400639 1:197112346-197112368 TGGGGCCTATTGGAGAGTGAAGG + Intronic
920171323 1:204073918-204073940 TGGGTCCTTGTGGAGAGGGATGG + Intronic
920780006 1:208980408-208980430 TGGTTGCTTCTGGAGAGGGAGGG - Intergenic
921158835 1:212458654-212458676 TGCTCACACTTGGTGAGGGAGGG - Intergenic
924062519 1:240189710-240189732 TGGTGGCACTTGGAGAGGCACGG + Intronic
924609039 1:245558595-245558617 AGGTCCCTCCTGGACAAGGAAGG + Intronic
924610807 1:245572273-245572295 TGATCCCTTTTGGAGACAGAAGG + Intronic
1062777811 10:169003-169025 TTGTGCTTCTTGGAGCGGGAGGG + Intronic
1064000677 10:11661541-11661563 TGGTCCCTGGTGGACAGGAAGGG - Intergenic
1066066790 10:31767264-31767286 TGGGGCCTATTGGAGAGTGAAGG - Intergenic
1067282144 10:44880763-44880785 GGGTCCCTTTTGGGCAGGGAAGG + Intergenic
1069797869 10:71064756-71064778 TGCTGCCTCTTGGGGAGGGGTGG - Intergenic
1070311828 10:75279357-75279379 GGGTCTCTCTTGGACTGGGAAGG + Intergenic
1070553217 10:77507699-77507721 AGCTCCCTCTTGAAAAGGGAAGG + Intronic
1071021402 10:81061208-81061230 TGGTCCTTCTTGGGGAGGGAAGG + Intergenic
1072635689 10:97176432-97176454 TGGAGTCTCTTGGGGAGGGAAGG - Intronic
1072670639 10:97426516-97426538 TGCGCCCTCTCGGAGAGGGCCGG + Intronic
1074391813 10:113064241-113064263 TGCCTCCTCTGGGAGAGGGAGGG + Intronic
1075472186 10:122699463-122699485 TTTTCCCTCCTGGAGTGGGAAGG + Intronic
1075556164 10:123434172-123434194 AGGTCCCTCTTAGAAAGGTACGG - Intergenic
1076317348 10:129551861-129551883 GGGTCACTCTTGGACAGCGAGGG - Intronic
1076648957 10:131974023-131974045 TGCTACCTCTTGGAAATGGAAGG - Intronic
1076817246 10:132921039-132921061 TGGCGACTCTTGGAGCGGGAAGG - Intronic
1079837992 11:25358854-25358876 GGGTTCCTCATGGAGAGGAATGG + Intergenic
1079912705 11:26331171-26331193 TGGGGCCTGTTGGAGGGGGAGGG + Intronic
1081935092 11:46898767-46898789 TGGTCCCTCTTGGGAAGAGATGG - Intronic
1082081304 11:48014339-48014361 TGGTAACTCTTTAAGAGGGAAGG + Intronic
1083270221 11:61568490-61568512 TGCTCCCTCCTGGGGAGGCAGGG - Intronic
1083305349 11:61759185-61759207 TGGTCCCTGTGGGAGAGAGTAGG + Intronic
1083694430 11:64433208-64433230 TGGTCTGTCTTTGAGAGGAAGGG - Intergenic
1083723389 11:64614920-64614942 TGGTCTCCCTTGGGGAGGGGTGG + Intronic
1083729017 11:64643129-64643151 TGGTGCCGAGTGGAGAGGGAGGG + Intronic
1085171635 11:74454493-74454515 AGCTCCCTCCTGGAGAGGGCAGG - Intergenic
1086124017 11:83331273-83331295 TGGTCCTTCTTGACAAGGGAAGG + Intergenic
1088430891 11:109757534-109757556 TGTTCCCCCCTGGAGAGGGCCGG - Intergenic
1091702057 12:2669973-2669995 TGGACACTCTTGGAGAGAAATGG - Intronic
1091789822 12:3265520-3265542 TGCTTCCTCTTGGAGAGTGGTGG + Intronic
1092964054 12:13624790-13624812 TGGGCTCTCTTGGAGAGGCAGGG - Intronic
1096779825 12:53985410-53985432 TCGTCCCTCTTGGAGAGCGAGGG - Exonic
1104292617 12:127483782-127483804 TGGTTCCTCTGGAAGAGGAATGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106361893 13:29038879-29038901 TGGTCGAGCTTGGTGAGGGAGGG - Intronic
1107559849 13:41549369-41549391 TGGTCCCTGTTTGAGATGTATGG + Intergenic
1107993789 13:45841355-45841377 TGCAGCCCCTTGGAGAGGGAGGG - Intronic
1108360699 13:49665938-49665960 TCTTCCCTGTTGGTGAGGGATGG + Intronic
1110752930 13:79136811-79136833 TGGTCCATCTTGGTTAGAGAAGG - Intergenic
1111886320 13:94026427-94026449 TTGGCCCTCTTGGAGAGTGGTGG - Intronic
1118299332 14:64601430-64601452 TGGTACCTTTTGGAGGAGGACGG - Intergenic
1118608313 14:67519500-67519522 CCTTCCCTCTTGGACAGGGAAGG + Intronic
1118725099 14:68623375-68623397 AGGTGCGTGTTGGAGAGGGAAGG - Intronic
1119122610 14:72093156-72093178 TGGTCGTCCTTGAAGAGGGAAGG - Intronic
1120626745 14:86836804-86836826 TGGTCCATATTGGAGAGAGAAGG - Intergenic
1120679088 14:87457961-87457983 TGGTTTCAGTTGGAGAGGGAAGG + Intergenic
1121676791 14:95760048-95760070 TGTTCCCCTTTGCAGAGGGATGG - Intergenic
1121718333 14:96091762-96091784 TGGTCACTCACGGAGAGGGATGG + Exonic
1126108366 15:45161724-45161746 GGGTCACTCCTGGGGAGGGATGG - Exonic
1126695466 15:51321861-51321883 TGGGCCCTCATCGAAAGGGAAGG + Intronic
1129029429 15:72607716-72607738 GGGTCCCTCTAGGTGAGGCATGG - Intergenic
1130928798 15:88405577-88405599 TCTCCCCTCTTGGAGAGGAATGG - Intergenic
1132073276 15:98798337-98798359 TGGTGCATCTTGGTGGGGGATGG + Intronic
1132612732 16:825302-825324 TTGTCCCTCTCCGAGCGGGAGGG + Intergenic
1132888688 16:2193998-2194020 AGGGACCTCGTGGAGAGGGAGGG - Intronic
1135450131 16:22550485-22550507 TGGGGCCTATTGGAGAGTGAAGG + Intergenic
1135840892 16:25875293-25875315 TGGTCCCATTTGAGGAGGGAAGG + Intronic
1136539893 16:30923489-30923511 GGGTTCCTCTGGGAGAAGGAGGG + Intronic
1137584036 16:49653290-49653312 TGGTGGTTCTTGGGGAGGGAAGG - Intronic
1141643363 16:85354590-85354612 TGGTCCCTCCTGGAGCTGGGGGG - Intergenic
1142536902 17:624292-624314 TGGGCCCTCAGGAAGAGGGAGGG - Intronic
1143362263 17:6381890-6381912 TGGCCCCTCAGGGAGAGGGCAGG + Intergenic
1144539654 17:16128366-16128388 TGGTCTGTGGTGGAGAGGGAAGG - Intronic
1145911655 17:28546810-28546832 TGGCCCCTCATGGGGAGGGATGG + Exonic
1146299070 17:31674071-31674093 TGGTAGCTTTTGGAGAGGCAAGG + Intergenic
1146492238 17:33291664-33291686 AGGTCCCCCTTGGAGAGGCGCGG + Exonic
1146574666 17:33980598-33980620 AGGTCCCTCTTCAAGAAGGAAGG + Intronic
1147626056 17:41900882-41900904 TGGTGACTCTTGGAGAGGGAAGG - Intronic
1148736892 17:49870010-49870032 AGGTCCCTCCTGGAGGGGGAGGG + Intergenic
1148741833 17:49897481-49897503 GTTTCCCTCTTGGGGAGGGAGGG - Intergenic
1149387494 17:56156393-56156415 TGGTCCCTCTTTAAGAGGTGAGG - Intronic
1151229205 17:72670865-72670887 TGGTCCCTTTTGCTGAGGAATGG + Intronic
1153498254 18:5721991-5722013 TGCTGCCTCTTGGATAGGGCGGG - Intergenic
1156491584 18:37499520-37499542 AGGTCCCTCATGGGAAGGGAAGG + Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1160312147 18:77804691-77804713 TGTTCCCTGTTTTAGAGGGAAGG + Intergenic
1160706949 19:534322-534344 GGGCCCCTCCTGGACAGGGAGGG - Intronic
1161800391 19:6414317-6414339 TGCTCCCTGATGGAGAAGGAGGG + Intronic
1164305044 19:23998613-23998635 TGGTCCACCTTAGACAGGGAAGG + Intergenic
1164677687 19:30112656-30112678 TGAGCCCTGTTGCAGAGGGAAGG + Intergenic
1166617056 19:44259803-44259825 TGGTCCCTCTTGGCTGGGCAGGG + Intronic
1167350237 19:48969691-48969713 GGGTCCCTCCTGGAGTGGGAAGG - Intronic
1167745202 19:51346807-51346829 TGGTCGCACGTGGGGAGGGAAGG - Intronic
1168260494 19:55191356-55191378 TGGTCCCTGTCGCAGAGGCATGG + Intronic
1168265495 19:55221779-55221801 TGGTCACTCTTGGGGAAGGGAGG + Intergenic
927711359 2:25328388-25328410 TGGGCCCTGTGGGAGAGGGTGGG - Intronic
927783552 2:25957177-25957199 TAGTCCCTCTTAGGGGGGGATGG - Intronic
927844596 2:26464917-26464939 TGGGCCCCCTGGGAGAGTGAAGG - Exonic
929993496 2:46810242-46810264 TGTTACCTCTAGGAGAAGGAAGG + Intergenic
931105252 2:59048223-59048245 GGTTCCCCCTGGGAGAGGGATGG + Intergenic
933850404 2:86361961-86361983 TGGTCCATTTTTTAGAGGGAGGG + Intergenic
935036418 2:99379641-99379663 GGCTGCCTCTGGGAGAGGGAGGG - Intronic
936042725 2:109161922-109161944 TGGTGCCTCCTGGGGAGGGGAGG + Intronic
936287350 2:111190983-111191005 TGGCCCCGCTTGCAGGGGGAAGG + Intergenic
936516804 2:113186095-113186117 TCTTCACTCTTGGAGACGGATGG + Exonic
937077348 2:119116903-119116925 AGGTCACTCTGGGAGAAGGAGGG + Intergenic
938036085 2:128036073-128036095 TGGTCACCCTTAGAGAGAGATGG + Intergenic
938233077 2:129678585-129678607 TGGTCCCTTTTGGCTAGAGAGGG + Intergenic
938938141 2:136145783-136145805 TGGTCCTTCCCAGAGAGGGAAGG + Intergenic
940781770 2:157940909-157940931 TGCTAACTCTTGGAGAGGGATGG - Intronic
942113634 2:172706810-172706832 TGGTACCTCTTTGACAGGGCAGG + Intergenic
944504902 2:200401252-200401274 GGGTCTCTCATGGAGATGGATGG - Intronic
944557038 2:200897471-200897493 TGGTTGCTGTTGCAGAGGGAGGG + Intronic
946406711 2:219495839-219495861 TGGTCCTCCTGGGAGTGGGATGG + Intronic
946415580 2:219538277-219538299 TGGGCCCTCACGGAGAGGAAGGG + Exonic
946823499 2:223653834-223653856 TGGTCTAAGTTGGAGAGGGAAGG - Intergenic
947462764 2:230317572-230317594 TGGTCACTGTTCTAGAGGGAAGG + Intergenic
1168956174 20:1835984-1836006 TGGACCCTGATGGAGAGAGAAGG - Intergenic
1169184835 20:3605736-3605758 TGGGGCCTATTGGAGAGTGATGG + Intronic
1170887608 20:20355045-20355067 TGGTCACACTGTGAGAGGGAAGG + Intronic
1170887612 20:20355068-20355090 TGGTCACACTGTGAGAGGGAAGG + Intronic
1171101025 20:22384232-22384254 AGGGCCCTCTTGGGTAGGGAGGG + Intergenic
1171195124 20:23190926-23190948 AGGTCACTGTTGCAGAGGGAAGG - Intergenic
1173150809 20:40565306-40565328 AGGTCCCTAGGGGAGAGGGAGGG + Intergenic
1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG + Intronic
1173874323 20:46360396-46360418 TGGACCCTCTAGGAGTGTGATGG - Intronic
1174189943 20:48733335-48733357 TGGTCACTTCTGGAGATGGAAGG - Intronic
1176120030 20:63450178-63450200 TCGTCCCTTTGGGTGAGGGAGGG - Intronic
1176243778 20:64087809-64087831 TGGTCCCTCCAGAAGGGGGAAGG - Intronic
1176678892 21:9806994-9807016 TGATCCATGGTGGAGAGGGAGGG + Intergenic
1178784118 21:35636575-35636597 TGGTGCCTATCGGAGAAGGAAGG + Intronic
1178915261 21:36702357-36702379 CGGTCCCCCTCGGAAAGGGAAGG + Intronic
1180241187 21:46507513-46507535 TAGACCATGTTGGAGAGGGAAGG + Intronic
1180868839 22:19134741-19134763 TCGTTCCCCTTGGAGAGGGGTGG - Intronic
1182427525 22:30282827-30282849 CGGTCCCTCAGGGAGAGGGAGGG - Intergenic
1183625677 22:38999919-38999941 TGGTCCTGCCTGGAGACGGATGG + Intergenic
1184796436 22:46736069-46736091 TGGTCCCTCTTGGAGAGGGAGGG - Intronic
1185062765 22:48615703-48615725 GGGCCCCTCCTGGAGAGGGGGGG - Intronic
950462845 3:13135529-13135551 TGGTGCCCCTGGGACAGGGATGG + Intergenic
950702006 3:14757356-14757378 TGCTCCTCCTTGCAGAGGGAAGG + Exonic
952178329 3:30891381-30891403 TGTTTCCTCTTTGAGTGGGAAGG - Intronic
952327558 3:32334965-32334987 TGGGCCGTCTTGGTGAGGGAGGG + Intronic
953474913 3:43196831-43196853 TGGGGCATCTTGGAGAGGGAAGG + Intergenic
954412166 3:50375555-50375577 TGGTCACAGTGGGAGAGGGAGGG + Intronic
954785337 3:53088440-53088462 TTGTCCCTTTTGGAGGGAGAAGG + Intronic
955397290 3:58566359-58566381 TTATCCCTCTTGGAGCAGGAGGG + Exonic
960639172 3:119810371-119810393 TCGGCCCTCTGGGAGATGGAGGG + Intronic
961200430 3:125041255-125041277 TGGTCACCTTTGGAGAGGGATGG - Intronic
961764317 3:129196984-129197006 AGGTCAGTCTTGGAGAGAGAAGG - Intergenic
963005650 3:140724191-140724213 AGGTCACTGTGGGAGAGGGAAGG - Intergenic
963612216 3:147484523-147484545 TGGGGCCTGTTGGAGAGGGGTGG - Intronic
966818451 3:183907459-183907481 TGGTTTCTCATGGGGAGGGAAGG + Intergenic
967823820 3:193862800-193862822 TGGTTCCTCCTGGAGAAAGATGG + Intergenic
969062703 4:4450668-4450690 TGATCCGTGCTGGAGAGGGATGG - Intronic
969609898 4:8221161-8221183 TGGTCTCCCTTGGAGATGGTAGG - Intronic
975109473 4:70607754-70607776 TTCTTCCTCTTGGAGAGTGAGGG - Intergenic
977734484 4:100396962-100396984 TGGTGTCTCTTTGAGAAGGATGG - Exonic
979097462 4:116569035-116569057 TGGGGCCTTTTGGAGAGTGAGGG + Intergenic
983996420 4:174188215-174188237 TGGGACCTCTTGGAGAGTGGAGG + Intergenic
986967224 5:13288570-13288592 TGGAACCTGTTGGAGAGTGAGGG - Intergenic
987728952 5:21742717-21742739 TTGTCACTGTTGGAGTGGGAGGG + Intergenic
990346584 5:54877439-54877461 TGGATCCCCTTGGACAGGGAGGG + Intergenic
992554162 5:77886905-77886927 TGGTCCATCTGGGAGGGGGCGGG - Intergenic
992832377 5:80606689-80606711 TGGACTCTCTAGGATAGGGAGGG + Intergenic
994387968 5:99154660-99154682 TGGTGCCTATTGGAGAGTGGAGG + Intergenic
997357921 5:133276287-133276309 TGGACCCCAGTGGAGAGGGAGGG + Intronic
997520788 5:134523968-134523990 TCTTCAGTCTTGGAGAGGGAAGG + Intergenic
998142656 5:139709073-139709095 CGCTCCCTCCGGGAGAGGGAGGG + Intergenic
998561328 5:143174483-143174505 TGGTTACTTCTGGAGAGGGAAGG + Intronic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
1000164547 5:158635138-158635160 TTCTCCCTCTTGCACAGGGAAGG + Intergenic
1001367865 5:171162379-171162401 AGGTCCCTCTTGGCTAGGGAAGG + Intronic
1001514086 5:172342846-172342868 TGGCCCTTCTGGGAGAGGGATGG + Intronic
1002789737 6:428274-428296 TTGTCCCAGTTGGAGAGGGGTGG + Intergenic
1005261297 6:24063746-24063768 AAGACCCCCTTGGAGAGGGATGG + Intergenic
1005344642 6:24877306-24877328 TGCTCTCTCCTGGAGAGGGAGGG - Intronic
1006144020 6:31947484-31947506 AGGTGGCTCTTGGAGCGGGACGG + Exonic
1006466055 6:34195711-34195733 TGGTCCCTGTTGGAGAGAAGGGG - Intergenic
1008070135 6:47091201-47091223 TGGTCTATCTTGGAAAGGTAGGG - Intergenic
1008324168 6:50156733-50156755 TGGTACCTCTGTGAGAGGGAAGG + Intergenic
1008356182 6:50556071-50556093 TAGGCACTCTTGGAGATGGAGGG + Intergenic
1008412515 6:51196544-51196566 TGGTCACTCTTGGACATGAATGG + Intergenic
1008562476 6:52736216-52736238 TGGACCCTCTGGCAGAGAGAGGG - Intergenic
1014129092 6:117810840-117810862 TGGTCCAGCTAGGTGAGGGAGGG - Intergenic
1015200973 6:130580545-130580567 TGGGGACTATTGGAGAGGGAGGG - Intergenic
1017926478 6:158915405-158915427 TTATCCCTCTTGTTGAGGGAGGG + Intergenic
1019496949 7:1345250-1345272 TGGTACGTCTTGCAGAGGCATGG + Intergenic
1020700950 7:11482569-11482591 TGATCCCAGTTGGAGAGGGAGGG + Intronic
1020748708 7:12111940-12111962 TTCTCCCTCTTGGGCAGGGAAGG - Intergenic
1022089870 7:27101114-27101136 GGGGCCCTTCTGGAGAGGGAAGG - Exonic
1023789856 7:43745156-43745178 TGGTTTCTCTTGGAGAGGAATGG - Intergenic
1024569015 7:50709206-50709228 GGGTCACCCTAGGAGAGGGAGGG - Intronic
1028522378 7:91746795-91746817 TGGTCCTTCTTTGAGGGGGGAGG - Intronic
1029645055 7:101849333-101849355 TGGGGCCTTTTGGAGAGTGAAGG - Intronic
1031640728 7:124161161-124161183 TGGGCCCTCATGGAAAGGGTAGG + Intergenic
1032311523 7:130791583-130791605 TGGGCCATCTTGGAGAGTGGAGG + Intergenic
1033807694 7:144973311-144973333 TTCTCCCTCTTGGGGAGTGAGGG + Intergenic
1035136036 7:156703778-156703800 TGCTCCACCTTGGAGAGGCATGG - Intronic
1036097647 8:5741476-5741498 TGCTCAGGCTTGGAGAGGGAGGG + Intergenic
1036924555 8:12891947-12891969 TGCTAGTTCTTGGAGAGGGACGG + Intergenic
1038055522 8:23854120-23854142 CGTACCCTCTTGGAGGGGGAGGG - Intronic
1039891824 8:41690673-41690695 GGGTGTGTCTTGGAGAGGGAAGG - Intronic
1039943188 8:42108745-42108767 TGGTCCTCCTTCCAGAGGGAGGG + Intergenic
1040839880 8:51773404-51773426 TGGACCCTCTGGGAGAAGAAGGG + Intronic
1042653642 8:71070435-71070457 TAATCCCTTTTGGAGAAGGATGG + Intergenic
1045816335 8:106281160-106281182 TGGTGCCACATGAAGAGGGAGGG + Intronic
1049089690 8:140505310-140505332 TCTTCCTTCTTGGAGAAGGAGGG - Intergenic
1049388251 8:142355015-142355037 GGGTCCCTCTTGGGAGGGGAGGG - Intronic
1049399719 8:142419536-142419558 CGGGCCTTCATGGAGAGGGATGG - Intergenic
1050224974 9:3443358-3443380 TGGGGCCTGTTGGAGAGGGTTGG - Intronic
1052323399 9:27192555-27192577 TGGTCCGTCGTGGAGAGGGTGGG + Exonic
1053428728 9:38027891-38027913 GGGTGCCTCCTGGAGAGGGATGG + Intronic
1055646232 9:78364016-78364038 TGCTGCTTCTTGAAGAGGGAGGG + Intergenic
1057037008 9:91818474-91818496 GGGGCCCTTTTGGAGAGGGCTGG - Intronic
1058968894 9:110062246-110062268 TGGGGCCTCTTGGAGGGGGTGGG - Intronic
1060151433 9:121291361-121291383 TGATCCCGCGTGGATAGGGAGGG + Intronic
1060474131 9:123974428-123974450 TGGTCCCCACTGGAGAGGGCAGG - Intergenic
1061591973 9:131603583-131603605 CTGTCCCTCATGCAGAGGGAGGG - Intronic
1061733554 9:132636032-132636054 TGGTCCTTCTGGGGGAGTGATGG - Intronic
1061785908 9:133028377-133028399 AGGTCCCCCCTGGAGAGGGCAGG + Intergenic
1062174374 9:135152879-135152901 TGCTCCCTCTTGTGCAGGGAGGG + Intergenic
1062357068 9:136170065-136170087 TGGGGCCTGATGGAGAGGGAAGG + Intergenic
1203664063 Un_KI270754v1:9530-9552 TGATCCATGGTGGAGAGGGAGGG + Intergenic
1185591385 X:1279738-1279760 AGGTTCCTCTTGCAGAGGAACGG + Intronic
1188193585 X:27201742-27201764 TGGTAACTTTTGGAAAGGGATGG + Intergenic
1188234305 X:27708158-27708180 TGGTAACTATTAGAGAGGGAAGG - Intronic
1189456627 X:41196166-41196188 TGTTCCCTCTTGGGGAGGAGAGG - Intronic
1189863463 X:45297753-45297775 TGGTGGCTCCTGGGGAGGGAAGG - Intergenic
1189968007 X:46393956-46393978 TGGTACACCTTGGAAAGGGAAGG - Intergenic
1190925249 X:54897884-54897906 TGGTCCGTCTTAGAGAAGGAGGG - Intergenic
1191093841 X:56654352-56654374 TGATCCCTCCTGGAATGGGAAGG - Intergenic
1194041806 X:88950736-88950758 TGGTACCTCTAGGAGGGGGAAGG + Intergenic
1194659390 X:96612952-96612974 TGACCCCTCTTGGAGGGTGATGG - Intergenic
1194810234 X:98380199-98380221 TAGTTCCTCTTGGCGAGGGGAGG + Intergenic
1199345587 X:146734865-146734887 TGCTCTCTCTTGGGGAGGCAGGG - Intergenic
1201900140 Y:19040684-19040706 TGGTCCCTCCTCTAGAGGAAGGG - Intergenic