ID: 1184796776

View in Genome Browser
Species Human (GRCh38)
Location 22:46737733-46737755
Sequence GTCCCACCTCCCCGCGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184796759_1184796776 20 Left 1184796759 22:46737690-46737712 CCTGCGGACAGACCGCACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 178
1184796762_1184796776 8 Left 1184796762 22:46737702-46737724 CCGCACCGGGGGCCACGACCCCG No data
Right 1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 178
1184796755_1184796776 30 Left 1184796755 22:46737680-46737702 CCAGAGGTGCCCTGCGGACAGAC 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 178
1184796767_1184796776 -10 Left 1184796767 22:46737720-46737742 CCCCGCGCCCCGGGTCCCACCTC 0: 1
1: 0
2: 1
3: 35
4: 309
Right 1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 178
1184796766_1184796776 -4 Left 1184796766 22:46737714-46737736 CCACGACCCCGCGCCCCGGGTCC 0: 1
1: 0
2: 5
3: 62
4: 463
Right 1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 178
1184796757_1184796776 21 Left 1184796757 22:46737689-46737711 CCCTGCGGACAGACCGCACCGGG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 178
1184796763_1184796776 3 Left 1184796763 22:46737707-46737729 CCGGGGGCCACGACCCCGCGCCC 0: 1
1: 0
2: 1
3: 15
4: 280
Right 1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184796776 Original CRISPR GTCCCACCTCCCCGCGGGGA TGG Intronic
900125534 1:1067483-1067505 GTGGCTCCTCCCCGCGGGGCAGG + Intergenic
900137226 1:1122694-1122716 GCCCCACCTCCCCACGGGCGAGG - Intergenic
900366749 1:2314759-2314781 GCCCCACTTCCCCACGCGGAGGG + Intergenic
900589870 1:3454790-3454812 GTCCCTCCGCCCCGCGGCGCAGG + Exonic
900665382 1:3811526-3811548 GCCACACCTCCCCGCAGGGTAGG + Intergenic
901861866 1:12079575-12079597 GTCCCAGCTCCCGGTGGAGAAGG - Intronic
902335332 1:15751273-15751295 GTCCCACCCACCCGAGGGGAGGG + Intergenic
902340156 1:15777937-15777959 GCCCCACCTCCCCACAGAGAAGG - Intronic
906471214 1:46132714-46132736 GTCCCCCCTCCCGGCGCGGTTGG - Intronic
908544075 1:65147748-65147770 GGCCCACCTCCGCCCGGGGTTGG - Intronic
910825623 1:91404526-91404548 GGCCCAGCTCCCCGCGAGGTGGG - Intronic
911950899 1:104172551-104172573 CACCCACCTCCCCGTGGGGCAGG + Intergenic
914725993 1:150328264-150328286 TTCCCTTCTCCCCACGGGGAGGG + Intronic
915331895 1:155117856-155117878 CTCCCACCTGCCTGCAGGGACGG + Intergenic
918144428 1:181743092-181743114 TGCCCACCTCCCTGCAGGGACGG - Intronic
918542674 1:185649065-185649087 CAGCCACCTCCCCGCGGGGCAGG - Intergenic
924593133 1:245422362-245422384 TTCCCACCTCCCAGCGAGGGAGG + Intronic
1063117745 10:3084232-3084254 GTCCCAGCCCCGCGCAGGGAAGG + Intronic
1067015553 10:42754675-42754697 GTCCCGCCGCCCTCCGGGGAGGG + Intergenic
1071676151 10:87658476-87658498 TTCCCACCTTCCCACGGCGAAGG + Intergenic
1076815227 10:132911267-132911289 CTCCCAGCTCCCAGTGGGGACGG - Intronic
1077111257 11:863192-863214 CCCCCACCTCGCCTCGGGGATGG + Intronic
1077225225 11:1436626-1436648 GACCCACCTCTCAGTGGGGAGGG + Intronic
1079710946 11:23680907-23680929 CTCCCACCTCACCGAGGGCAGGG - Intergenic
1083610263 11:64000935-64000957 GGCTCACCTCCCCGCGCGGCTGG - Intronic
1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG + Exonic
1084363821 11:68685085-68685107 CTCCGCCCTGCCCGCGGGGATGG + Intronic
1084646850 11:70463881-70463903 GTGCCGGCTCCCCGCGGTGAAGG + Intergenic
1085559668 11:77459812-77459834 GTCCCAGCTGCTCGCGGGGGTGG - Intronic
1087820762 11:102709448-102709470 GCCCCACCTCCCTGCAGTGAAGG - Intergenic
1088257276 11:107912955-107912977 GTCACACCTCCCCGACGGGGTGG - Intronic
1092247340 12:6871128-6871150 TCCCCACCTCCCCAAGGGGAGGG + Exonic
1094654680 12:32408932-32408954 GTCCCATCTGCCCTCTGGGAAGG + Intronic
1097990249 12:65825566-65825588 TCCCCACCTCCCCGCCCGGAGGG - Intronic
1098257383 12:68630796-68630818 GTTCCACCTACCCGGGAGGATGG - Intronic
1100611347 12:96194235-96194257 GACCCCCCTCCCCGTGGGGAGGG + Intergenic
1100655132 12:96635981-96636003 CTCCCACCTCCTGGAGGGGAGGG - Intronic
1102913757 12:116737897-116737919 GCCCCACGTCCGCGCCGGGATGG - Exonic
1103775677 12:123364854-123364876 GCCCCCCCGCCCCGCCGGGAGGG + Intergenic
1104017484 12:124970779-124970801 GGCCCCTCTCCCCGCCGGGAGGG + Intronic
1104995451 12:132651618-132651640 GTCCCACCCCCACTCAGGGAAGG - Intronic
1106374486 13:29171953-29171975 GTCCCATCTAGCCGCAGGGAAGG + Intronic
1107331555 13:39306818-39306840 GTGCCACCTCACCTCGGGGCTGG - Intergenic
1112077227 13:95928301-95928323 CCCCCACCTCCCCGACGGGACGG + Intronic
1113179914 13:107613036-107613058 GTCCCGCCTCCCCTGGAGGAAGG + Intronic
1113652266 13:112042357-112042379 GTCCCACCTCCCAGCTGGACAGG + Intergenic
1117571008 14:57049302-57049324 TTACCCCCTCCCCGCGGGGGTGG - Intergenic
1119176311 14:72569911-72569933 GTCCCACCAGCCCGAGGGGCTGG - Intergenic
1121625863 14:95385052-95385074 GTCCCTCCTCCCCACTTGGAAGG + Intergenic
1122771212 14:104098738-104098760 GTCCCACCTCCCCCTGGGTCTGG + Intronic
1122887772 14:104718182-104718204 GTCCCAGCTCCCCAGTGGGATGG - Intronic
1131825744 15:96321789-96321811 GTCCCACCTGCCCACGAGCAGGG + Intergenic
1132872553 16:2122296-2122318 GTCCCACAGCCCCTGGGGGAAGG - Intronic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1133113180 16:3561817-3561839 GTCCCACCCGCCCACGGGCAGGG + Intronic
1133269173 16:4602261-4602283 GTCCCACCTCCCCACACAGAAGG - Intergenic
1134551651 16:15141496-15141518 GTCCCACAGCCCCTGGGGGAAGG - Intergenic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1135168899 16:20165649-20165671 CTCCCACCTCCCCACCAGGAAGG - Intergenic
1136146831 16:28320999-28321021 GAGCCACCTCGCCGCGGGGCAGG + Exonic
1136399922 16:30011569-30011591 GCCCCAGCTCCCTGCGGGGGAGG - Intronic
1137288855 16:47037992-47038014 GGCCGAGCTCCCCGCGGGGCGGG + Intergenic
1141925947 16:87169708-87169730 GTCCCCCCTCCCATCGGGAAAGG + Intronic
1142707005 17:1701742-1701764 GTCCCAGCTACTCGCGGGGGAGG + Intergenic
1143205254 17:5136479-5136501 GTCCCACCTCCCCAGGGCAAAGG + Intronic
1144784427 17:17823816-17823838 GCCCCACCTCCCCACGGCGGCGG + Intronic
1144806546 17:17971947-17971969 GTGCCACCTCCCGGGGGGGCTGG - Intronic
1144811944 17:18006272-18006294 GTAGCACCTCCCCATGGGGAAGG - Intronic
1145155925 17:20545248-20545270 GTCCCACCTCCCCAGGGCAAAGG - Intergenic
1145970002 17:28951002-28951024 CTCCCCCCTCCCCCCGGGGTTGG - Exonic
1148048683 17:44758994-44759016 GCCCCGCCGCCCCGCCGGGATGG + Intergenic
1148076794 17:44941761-44941783 GTCCCTGCTCCCCATGGGGAGGG + Intronic
1148156058 17:45425751-45425773 TTCCCACCTCTGGGCGGGGATGG + Intronic
1151362684 17:73598103-73598125 ATCCCATCTCCCCAGGGGGAGGG + Intronic
1151576450 17:74954717-74954739 TTCCCACCTCCCCTCGAGCAAGG + Intronic
1152196917 17:78923872-78923894 GTCCCACCTCCACTCTGGGCAGG + Intronic
1152924838 17:83082097-83082119 GTCCCGCCTCCCCCCACGGAAGG - Intronic
1153285548 18:3451794-3451816 CTCCCTCCGTCCCGCGGGGAGGG - Exonic
1153388160 18:4523114-4523136 CTCCCACCTCCCTGTGGTGATGG - Intergenic
1153486608 18:5605036-5605058 GTCACACCTCCTCCTGGGGAGGG + Intronic
1153654434 18:7270488-7270510 GTCTCACCTCCCCTCAGGGAGGG + Intergenic
1153940031 18:9969360-9969382 GCCCCTCCTCCCAGCGTGGAAGG - Intergenic
1155677690 18:28449554-28449576 GTCCCACCTCCCTCCATGGATGG - Intergenic
1158426849 18:57348000-57348022 GTCTCACCTCCCCACGGGCCTGG + Intergenic
1159288262 18:66381441-66381463 GTCCCACCTACTCGGGAGGATGG - Intergenic
1159957526 18:74530278-74530300 GTCCCACCTGCCCTCCAGGAAGG + Intergenic
1160501075 18:79401256-79401278 GCTTCACCTCCGCGCGGGGAGGG - Intronic
1160584242 18:79903904-79903926 CCCTGACCTCCCCGCGGGGAGGG - Exonic
1160718142 19:585666-585688 GTCCCAGCTCCCAGTGGGCAGGG + Intergenic
1161438817 19:4279336-4279358 GTCCCACCTCCCGGCGGCGGCGG + Exonic
1161681303 19:5681097-5681119 AGCCCACCTCCTCCCGGGGAGGG - Exonic
1161990305 19:7680932-7680954 GACCCACACGCCCGCGGGGAAGG - Intronic
1163266338 19:16224727-16224749 GTCCCAACTCCCTGAGGGGGAGG + Intronic
1163320412 19:16571638-16571660 GTTCCACCTCCACGGCGGGATGG + Intronic
1165473085 19:36014571-36014593 GTCTCACCTCCCTGCGGCGTGGG - Intergenic
926162952 2:10501261-10501283 GTCCCACCTCCCCACTGGCCCGG - Intergenic
926753283 2:16216635-16216657 GGCTCACCTCCCTGCCGGGAAGG + Intergenic
929600584 2:43201873-43201895 AACCCACCTCCCCGCTGGCATGG + Intergenic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
931571335 2:63671970-63671992 ATCCCACCTCCCCACAGAGACGG - Intronic
932337312 2:70938525-70938547 AGCCCACCTCCCCCGGGGGAGGG - Intronic
937955592 2:127420251-127420273 CTCCCTCCTCCACACGGGGATGG + Intronic
937996409 2:127697942-127697964 CTCCCACCTCCCCAAGGGGAAGG - Intergenic
938119184 2:128621997-128622019 GTCAGACCTCCCCTGGGGGACGG - Intergenic
938265224 2:129923422-129923444 GTCCCAGCGCCCCCTGGGGACGG - Intergenic
945054894 2:205859869-205859891 GTCCCAGCTCCCCGGGGTCAAGG + Intergenic
947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG + Intronic
948958609 2:241315151-241315173 GGCCCGCCGCCCCGCGGGGGAGG - Intronic
949013902 2:241698686-241698708 TTCCCACCTCCCCAGGGGGCAGG - Intergenic
1168967388 20:1907131-1907153 GTGCCACATCCCTGCAGGGAAGG - Intronic
1169136162 20:3199027-3199049 GTCCCAGCTACTCGCAGGGACGG + Intronic
1171967919 20:31544292-31544314 GCCCCACCTCCCAGCCAGGAAGG - Intronic
1172794479 20:37527567-37527589 GACCCACCTCCGGGCTGGGAAGG + Intronic
1175828687 20:61950768-61950790 GTCCCAGCTCCCCGAAGGGCAGG + Intergenic
1176173372 20:63706494-63706516 GTCCCAGCTCTCCCAGGGGATGG + Intronic
1176603930 21:8814477-8814499 GCCCCACCTCTCCGCGGCGCGGG + Intergenic
1180346214 22:11706054-11706076 GCCCCACCTCTCCGCGGCGCGGG + Intergenic
1181514910 22:23404861-23404883 GGCCCAGCTTCCAGCGGGGAGGG - Intergenic
1184104957 22:42362166-42362188 GTGCCACCTCTCCACGTGGATGG - Intergenic
1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG + Intronic
1184865063 22:47197707-47197729 GTCCCACCTTCCCAGCGGGAGGG + Intergenic
1185157983 22:49205618-49205640 GTCCAACCTCCATGCTGGGAGGG + Intergenic
1185237772 22:49724822-49724844 TCCCCACCTCGCAGCGGGGAGGG + Intergenic
1185376272 22:50483874-50483896 GTCCCCCGTCCCCCCAGGGAAGG - Exonic
951491216 3:23272161-23272183 CAGCCACCTCCCCGCGGGGCAGG - Intronic
952884988 3:38006685-38006707 TGCCCACCTCCCTGCGGGCAGGG - Exonic
952935619 3:38396313-38396335 GCCCCACCTCCCCACCAGGATGG - Intronic
954622806 3:52005457-52005479 GGCCCTCCTCCCCGTGGGCAGGG + Intergenic
954691206 3:52396602-52396624 CTCCCACCTCCCCCAGGTGATGG + Exonic
960223732 3:115146920-115146942 CTCCCACCTCCCCGCCGGGTCGG + Intronic
960413680 3:117358836-117358858 ATCCAACTTCCCCGCAGGGAGGG + Intergenic
962853968 3:139328105-139328127 CTCCCACCTCCCCACGAGGCAGG - Intronic
962874151 3:139522917-139522939 GGCCCACCTGCCCGCCTGGATGG - Intronic
963397899 3:144757103-144757125 CAGCCACCTCCCCGCGGGGCAGG + Intergenic
968071934 3:195789472-195789494 GCCCCAGCTCCCACCGGGGATGG - Exonic
968913767 4:3488290-3488312 CTCTCACCTGCCCGTGGGGAGGG + Intronic
970845447 4:20532576-20532598 GTCACACCTCCCCAGGGGCATGG - Intronic
972586179 4:40438703-40438725 GGCCCACCGCCCGGCTGGGAGGG - Exonic
973374186 4:49276438-49276460 GCCCCACCTCTCCGCGGTGCGGG - Intergenic
973383226 4:49333801-49333823 GCCCCACCTCTCCGCGGTGCGGG + Intergenic
973684331 4:53354222-53354244 CAGCCACCTCCCCGCGGGGCAGG - Intronic
975883570 4:78939268-78939290 GTCCCGCCTCCCCGGGGAGGGGG + Exonic
985543214 5:496308-496330 GTCCCACCTGCCCACGGGGGAGG + Intronic
985727638 5:1524242-1524264 GGCCCGCCTGCTCGCGGGGAGGG + Intergenic
987084451 5:14456002-14456024 CAGCCACCTCCCCGCGGGGCAGG - Intronic
990382916 5:55233464-55233486 GTCCCGCCTCCCCGCTCGGGCGG + Exonic
996056539 5:118988654-118988676 GTCCCACCCTGCCGCTGGGAAGG + Intergenic
996567236 5:124892667-124892689 CACCCACCTCCCCACGGGGCAGG + Intergenic
1002081186 5:176738444-176738466 TTCCCACCTCCCCATGGTGAGGG + Intergenic
1005495198 6:26382228-26382250 ATACCACCTCCCCGTGGGAAAGG + Intergenic
1007479679 6:42142064-42142086 CTCCCACCTCCCCGTGGTGGTGG + Intronic
1007724505 6:43906901-43906923 GTCCCACTTCTCGGCAGGGAGGG - Intergenic
1007784831 6:44273575-44273597 TCCCCACCTCCCTGGGGGGAAGG + Intronic
1008482112 6:51996450-51996472 GTACCAGCTCCCAACGGGGATGG - Intronic
1009942238 6:70303048-70303070 GTCCCTCCTGCCCCCGGTGAGGG + Exonic
1012927577 6:105283022-105283044 GTCTCCCCTCCCCGCGAAGACGG + Intronic
1013298155 6:108778549-108778571 GTCCCACCTCTCCCAGGAGAAGG + Intergenic
1014233872 6:118934522-118934544 GTCCCGCCAGCCCGCGCGGAGGG - Intronic
1015244566 6:131062686-131062708 CTCCATCCCCCCCGCGGGGAGGG - Intronic
1015935684 6:138404357-138404379 GTCCCTCCTCCCGGCCGGGCTGG - Exonic
1019574277 7:1728803-1728825 GTCCCAGCTCCTGTCGGGGAAGG + Intronic
1019629034 7:2036711-2036733 GTCCCACCTCCCCAAGGCCAGGG + Intronic
1020115135 7:5471968-5471990 GTCCCACCTCCTCGGGAGGCTGG + Intronic
1022007365 7:26278236-26278258 GTCCCAGCTACTCGGGGGGAGGG + Intergenic
1022419953 7:30210909-30210931 GCTCCACCTGCCCGCGGTGACGG + Intergenic
1022903574 7:34834291-34834313 CTCCCACCTCCCCGAGTGCAAGG - Intronic
1024890123 7:54190675-54190697 CTCCCATCTCAGCGCGGGGAAGG - Intergenic
1028622236 7:92836785-92836807 GACCCACCCCCCGGCGGGGCTGG + Intergenic
1032090473 7:128909236-128909258 GTCCCTCCTCCAGGCAGGGATGG + Intronic
1034983069 7:155490650-155490672 GTCCCCCATCCCTGCGGGCACGG - Intronic
1035341817 7:158167059-158167081 CCCCCAGCTCCCCCCGGGGAGGG - Exonic
1036501713 8:9320126-9320148 GTCCTACCTCCCTTCCGGGATGG + Intergenic
1037833897 8:22205032-22205054 GTCCCTCCTCCCCGTCAGGATGG - Intronic
1039914489 8:41849635-41849657 ATCCCACCGCCGCGCAGGGAAGG + Intronic
1046260301 8:111758892-111758914 CAGCCACCTCCCCGCGGGGCAGG - Intergenic
1049419374 8:142510287-142510309 GGCAAGCCTCCCCGCGGGGAAGG + Intronic
1049470857 8:142774452-142774474 TTCCCACCCCCTCACGGGGAGGG - Intronic
1055925642 9:81507596-81507618 CAGCCACCTCCCCGCGGGGCAGG + Intergenic
1058375472 9:104316699-104316721 GTCCCACCTCCCAGACGGGGTGG - Intergenic
1059380474 9:113919641-113919663 GTTCCACCTCCTCACGGAGAGGG - Intronic
1059769382 9:117412806-117412828 TTGCCACCTCCCCGTGGGGAAGG - Intronic
1061214287 9:129212005-129212027 GCCCCCCCTCCCCGGTGGGAGGG - Intergenic
1203551345 Un_KI270743v1:166637-166659 GCCCCACCTCTCCGCGGTGCGGG + Intergenic
1187281486 X:17861033-17861055 GTGGCAGCTCCGCGCGGGGAGGG + Intronic
1191077882 X:56475292-56475314 GTCCAAGCTCCCCACTGGGAGGG + Intergenic
1196194519 X:112825613-112825635 GTCCCACATCCCAGAAGGGAGGG + Intronic
1197831236 X:130645704-130645726 GCCCCACATCCACGCTGGGATGG + Intronic
1200224914 X:154411991-154412013 GTCCCACCTCCGGCCGGGCATGG - Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic