ID: 1184796929

View in Genome Browser
Species Human (GRCh38)
Location 22:46738170-46738192
Sequence GCGTCCGCGCGCCCCCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 226}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184796929_1184796941 22 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796941 22:46738215-46738237 GGCCCCTGCAGTGGCCCGGGCGG 0: 1
1: 0
2: 1
3: 50
4: 314
1184796929_1184796935 1 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796935 22:46738194-46738216 GAGGGGCGCCGGACCGTTAGCGG 0: 1
1: 0
2: 0
3: 3
4: 25
1184796929_1184796947 29 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796947 22:46738222-46738244 GCAGTGGCCCGGGCGGCGGGCGG 0: 1
1: 0
2: 4
3: 53
4: 481
1184796929_1184796939 18 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796939 22:46738211-46738233 TAGCGGCCCCTGCAGTGGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 172
1184796929_1184796946 26 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 51
4: 273
1184796929_1184796937 13 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796937 22:46738206-46738228 ACCGTTAGCGGCCCCTGCAGTGG 0: 1
1: 0
2: 2
3: 8
4: 51
1184796929_1184796944 25 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796944 22:46738218-46738240 CCCTGCAGTGGCCCGGGCGGCGG 0: 1
1: 0
2: 1
3: 23
4: 304
1184796929_1184796940 19 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796940 22:46738212-46738234 AGCGGCCCCTGCAGTGGCCCGGG 0: 1
1: 0
2: 3
3: 57
4: 359
1184796929_1184796933 -10 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796933 22:46738183-46738205 GCGCGGACGCCGAGGGGCGCCGG 0: 1
1: 0
2: 5
3: 34
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184796929 Original CRISPR GCGTCCGCGCGCCCCCAGCC TGG (reversed) Exonic