ID: 1184796936

View in Genome Browser
Species Human (GRCh38)
Location 22:46738202-46738224
Sequence TGCAGGGGCCGCTAACGGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184796936_1184796944 -7 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796944 22:46738218-46738240 CCCTGCAGTGGCCCGGGCGGCGG 0: 1
1: 0
2: 1
3: 23
4: 304
1184796936_1184796946 -6 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 51
4: 273
1184796936_1184796948 0 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796948 22:46738225-46738247 GTGGCCCGGGCGGCGGGCGGCGG 0: 1
1: 2
2: 13
3: 89
4: 912
1184796936_1184796949 1 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796949 22:46738226-46738248 TGGCCCGGGCGGCGGGCGGCGGG 0: 1
1: 1
2: 9
3: 69
4: 592
1184796936_1184796955 11 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796955 22:46738236-46738258 GGCGGGCGGCGGGCGGCGGGAGG 0: 42
1: 36
2: 122
3: 583
4: 2578
1184796936_1184796947 -3 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796947 22:46738222-46738244 GCAGTGGCCCGGGCGGCGGGCGG 0: 1
1: 0
2: 4
3: 53
4: 481
1184796936_1184796953 7 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796953 22:46738232-46738254 GGGCGGCGGGCGGCGGGCGGCGG 0: 36
1: 45
2: 156
3: 633
4: 2685
1184796936_1184796954 8 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796954 22:46738233-46738255 GGCGGCGGGCGGCGGGCGGCGGG 0: 41
1: 40
2: 85
3: 486
4: 1777
1184796936_1184796941 -10 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796941 22:46738215-46738237 GGCCCCTGCAGTGGCCCGGGCGG 0: 1
1: 0
2: 1
3: 50
4: 314
1184796936_1184796956 14 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796956 22:46738239-46738261 GGGCGGCGGGCGGCGGGAGGCGG 0: 2
1: 42
2: 105
3: 526
4: 2626
1184796936_1184796951 4 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796951 22:46738229-46738251 CCCGGGCGGCGGGCGGCGGGCGG 0: 1
1: 8
2: 77
3: 190
4: 1174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184796936 Original CRISPR TGCAGGGGCCGCTAACGGTC CGG (reversed) Exonic