ID: 1184796946

View in Genome Browser
Species Human (GRCh38)
Location 22:46738219-46738241
Sequence CCTGCAGTGGCCCGGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184796928_1184796946 29 Left 1184796928 22:46738167-46738189 CCGCCAGGCTGGGGGCGCGCGGA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 51
4: 273
1184796929_1184796946 26 Left 1184796929 22:46738170-46738192 CCAGGCTGGGGGCGCGCGGACGC 0: 1
1: 0
2: 3
3: 15
4: 226
Right 1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 51
4: 273
1184796936_1184796946 -6 Left 1184796936 22:46738202-46738224 CCGGACCGTTAGCGGCCCCTGCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 51
4: 273
1184796934_1184796946 4 Left 1184796934 22:46738192-46738214 CCGAGGGGCGCCGGACCGTTAGC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 51
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184796946 Original CRISPR CCTGCAGTGGCCCGGGCGGC GGG Exonic