ID: 1184797887

View in Genome Browser
Species Human (GRCh38)
Location 22:46742326-46742348
Sequence GTGTGAATAGTCCTGATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184797887_1184797903 15 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797903 22:46742364-46742386 GGGACATCACACCCAGGGGGAGG No data
1184797887_1184797891 -8 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797891 22:46742341-46742363 ATTCACACCCCTGGAGGGCCAGG No data
1184797887_1184797893 -6 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797893 22:46742343-46742365 TCACACCCCTGGAGGGCCAGGGG No data
1184797887_1184797892 -7 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797892 22:46742342-46742364 TTCACACCCCTGGAGGGCCAGGG No data
1184797887_1184797904 25 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797904 22:46742374-46742396 ACCCAGGGGGAGGCCTCCAAAGG No data
1184797887_1184797894 -5 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797894 22:46742344-46742366 CACACCCCTGGAGGGCCAGGGGG No data
1184797887_1184797908 30 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797908 22:46742379-46742401 GGGGGAGGCCTCCAAAGGCTGGG No data
1184797887_1184797901 11 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797901 22:46742360-46742382 CAGGGGGACATCACACCCAGGGG No data
1184797887_1184797900 10 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797900 22:46742359-46742381 CCAGGGGGACATCACACCCAGGG No data
1184797887_1184797902 12 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797902 22:46742361-46742383 AGGGGGACATCACACCCAGGGGG No data
1184797887_1184797907 29 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797907 22:46742378-46742400 AGGGGGAGGCCTCCAAAGGCTGG No data
1184797887_1184797898 9 Left 1184797887 22:46742326-46742348 CCAGGGATCAGGACTATTCACAC No data
Right 1184797898 22:46742358-46742380 GCCAGGGGGACATCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184797887 Original CRISPR GTGTGAATAGTCCTGATCCC TGG (reversed) Intergenic
No off target data available for this crispr