ID: 1184799005

View in Genome Browser
Species Human (GRCh38)
Location 22:46748783-46748805
Sequence AGGCTGTTGCAGGAGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184799005_1184799015 14 Left 1184799005 22:46748783-46748805 CCCTGTAGCTCCTGCAACAGCCT No data
Right 1184799015 22:46748820-46748842 CTGAGAGGAGAGCCTCCCAGAGG No data
1184799005_1184799009 -9 Left 1184799005 22:46748783-46748805 CCCTGTAGCTCCTGCAACAGCCT No data
Right 1184799009 22:46748797-46748819 CAACAGCCTCCCAAGAACCAGGG No data
1184799005_1184799011 -1 Left 1184799005 22:46748783-46748805 CCCTGTAGCTCCTGCAACAGCCT No data
Right 1184799011 22:46748805-46748827 TCCCAAGAACCAGGGCTGAGAGG No data
1184799005_1184799008 -10 Left 1184799005 22:46748783-46748805 CCCTGTAGCTCCTGCAACAGCCT No data
Right 1184799008 22:46748796-46748818 GCAACAGCCTCCCAAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184799005 Original CRISPR AGGCTGTTGCAGGAGCTACA GGG (reversed) Intergenic
No off target data available for this crispr