ID: 1184801490

View in Genome Browser
Species Human (GRCh38)
Location 22:46762995-46763017
Sequence GGGGCTCGGAGGTCGGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184801490 Original CRISPR GGGGCTCGGAGGTCGGAGCG TGG Intronic
900110112 1:1001728-1001750 GGGGCTGCGAGGCCGGAGCGGGG + Intergenic
900119093 1:1041013-1041035 GGGGCCTGGGGGGCGGAGCGGGG + Intronic
900119131 1:1041088-1041110 GGGGCCTGGGGGGCGGAGCGGGG + Intronic
900209964 1:1450563-1450585 GGGGCTTTGAGGTCGAGGCGTGG + Exonic
900220019 1:1503467-1503489 GGGGCTTTGAGGTCGAGGCGTGG + Intergenic
900222326 1:1515894-1515916 GGGGCTTTGAGGTCGAGGCGTGG + Intronic
900334204 1:2153431-2153453 GGGGCTGGGAGGGCAGAGCTGGG + Intronic
901425325 1:9179022-9179044 GTGCCACGGAGGTCAGAGCGGGG + Intergenic
905474157 1:38214054-38214076 GGGGCTCGGAGCTCAGTGTGGGG - Intergenic
907278032 1:53327711-53327733 GCGGCCGGGAGGCCGGAGCGGGG - Intronic
907459320 1:54595966-54595988 TGGGCTTGGAGGCCGGAGCTGGG + Intronic
908355881 1:63324233-63324255 GGGGCTCGGCGGTGGGCGCTGGG + Exonic
914900900 1:151710517-151710539 GGGGCTGGGAGGTGGGGGAGGGG + Intronic
915355991 1:155255421-155255443 GGAGCTCGGGGAGCGGAGCGTGG - Intronic
916128280 1:161590241-161590263 GGGGCATGGAGGGCGGGGCGGGG - Intronic
916138200 1:161672072-161672094 GGGGCATGGAGGGCGGGGCGGGG - Intronic
917905760 1:179586294-179586316 GGCGCTCGGAGCTCGGAGCTCGG + Intergenic
920795538 1:209132952-209132974 GGGGCTCGGAGGCTGCTGCGGGG - Intergenic
921141419 1:212310532-212310554 GGGGCTCAGAGCTGGGAGTGGGG + Intronic
922505186 1:226122028-226122050 GGGGCGCGGAGGTGGGCGGGGGG - Intergenic
922669067 1:227495053-227495075 GGGGCTCTGAGGGCCCAGCGCGG - Intergenic
922670530 1:227506249-227506271 GGGGCTCTGAGGGCCCAGCGCGG + Intergenic
922734503 1:227971993-227972015 GGGCCTGGGAGGTCGCAGTGGGG + Intergenic
924853749 1:247856435-247856457 GGGGCTCGGAGGGTGGAAGGCGG + Intergenic
1063393643 10:5666476-5666498 GCGCCGCGGAGGTCAGAGCGAGG - Intronic
1063596631 10:7441464-7441486 GGGGCTGGGAGGCTGGAGGGAGG - Intergenic
1066180646 10:32958110-32958132 GGGCCTCGGGTGTGGGAGCGCGG - Intronic
1067066029 10:43104858-43104880 GGGGCTCTGCGGTCAGAGCGGGG - Intronic
1071266110 10:83966319-83966341 GGGGCTGGGAGCTTGGAGCTGGG - Intergenic
1071568185 10:86682206-86682228 GGAGCTCGGAGGCAGGAGCAGGG + Intronic
1074126187 10:110530474-110530496 CGGGCTCCGAGGGAGGAGCGGGG + Intergenic
1074818634 10:117163292-117163314 CGGGCTCGGGGGCCGGAGTGAGG + Intergenic
1075022414 10:118961444-118961466 CGGGGTCAGAGGTCAGAGCGAGG - Intergenic
1075054464 10:119207386-119207408 GGCGCGCGGCTGTCGGAGCGAGG - Intergenic
1076905272 10:133358042-133358064 GGGGCTTGGGGGCCGGGGCGGGG + Intergenic
1076916621 10:133425625-133425647 GGGACGTGGAGGTGGGAGCGGGG + Intergenic
1076936725 10:133570420-133570442 GGGACGTGGAGGTGGGAGCGGGG + Intergenic
1076986021 11:236454-236476 GGGGCGCGGAGGCGGGACCGGGG - Intronic
1077069594 11:662508-662530 GGGAGTCGGAGGTCGGCGAGGGG - Intronic
1077325484 11:1962126-1962148 GGGGCTCAGGGGTTGGACCGAGG + Intronic
1077331295 11:1984814-1984836 GGGGCTGGGAGGTGGGTGCAAGG + Intergenic
1082035585 11:47642660-47642682 GGGGCGCTGAGGTCGGGGCGGGG + Intergenic
1083253101 11:61481182-61481204 GAGGCTCTGAGGTCGGGGAGAGG - Exonic
1083757452 11:64799357-64799379 GGGGCAGGGAGGTCGGATGGAGG - Intronic
1083922690 11:65788959-65788981 GGAGGGCGGAGGGCGGAGCGGGG - Intronic
1083968701 11:66059090-66059112 GGGGCTCAGAGGTGGGTGAGAGG + Intronic
1084703989 11:70805230-70805252 GGGGCTCAGGGGTCGGAGGGTGG - Intronic
1087487848 11:98780430-98780452 GGGGCTGGGAAGTGGGAGCATGG + Intergenic
1089255075 11:117189877-117189899 GGGGCCCGGATGGCGGGGCGTGG + Intronic
1090722025 11:129484347-129484369 AGGGCTAGGAGGTGGGAGCAGGG - Intergenic
1202808464 11_KI270721v1_random:17305-17327 GGGGCTCAGGGGTTGGACCGAGG + Intergenic
1202814276 11_KI270721v1_random:39990-40012 GGGGCTGGGAGGTGGGTGCAAGG + Intergenic
1091409515 12:229886-229908 AGGGGTGGGAGGTCGGAGTGGGG + Intronic
1091792904 12:3281620-3281642 AGGGCTGGGAGGTAAGAGCGAGG + Intronic
1095961549 12:47837920-47837942 AGGGATCGGAGGTCGGAATGTGG + Intergenic
1096429715 12:51532731-51532753 GGGGCTGGGGGGTTGGAGGGAGG + Intergenic
1098275627 12:68808603-68808625 GGGGCTCGGGGCGCGGGGCGCGG + Intronic
1100091824 12:90982469-90982491 GGGGCCAGGAGGTTGGAGAGGGG - Intronic
1100581396 12:95943284-95943306 GGGGCTGGGAGGGTGGGGCGGGG - Exonic
1100830865 12:98515767-98515789 GAGGCTCGGAGGCGGCAGCGCGG + Exonic
1100977966 12:100142335-100142357 GGAGCCCGGAGTGCGGAGCGCGG - Intronic
1101865185 12:108515306-108515328 GCGGCCCGGAGCTGGGAGCGCGG + Exonic
1102467087 12:113136078-113136100 GGGGCGCGGAGGTTGGAGAGAGG - Exonic
1102722944 12:115033798-115033820 GGGGCACGGAGGTGGGAGGGAGG + Intergenic
1102822183 12:115917277-115917299 GGGGCTGGGCGGGCGGAGCGCGG + Intergenic
1102913765 12:116737915-116737937 GGGGCGCGGCGGCCGGGGCGCGG + Exonic
1104977205 12:132557489-132557511 GGGGCTCGGGGCTCGGGGCTGGG + Intronic
1106340149 13:28819913-28819935 GGGGCGCGGGGCGCGGAGCGCGG + Intergenic
1108292573 13:48976167-48976189 GTGACTCGGAGGTGAGAGCGCGG + Intronic
1112091568 13:96089976-96089998 GGGGCTCGGAGGAGGCAGCTGGG - Intergenic
1113813087 13:113154048-113154070 GGGGCGCGGGGGGCGGGGCGTGG + Intergenic
1117722003 14:58637789-58637811 GGGGCGGGGAGGGCCGAGCGAGG + Intronic
1118592790 14:67413645-67413667 GGGGCTGGCAGGTGGGAGTGGGG - Intergenic
1120881309 14:89417045-89417067 GGGGCGCGGGGGTCGCGGCGCGG + Intronic
1121052439 14:90828291-90828313 GGGGGCCGCAGGGCGGAGCGAGG + Intergenic
1121573777 14:94966989-94967011 GGGGCTCTGAGGACTGAGCAAGG - Intergenic
1122330824 14:100911275-100911297 GGGGCTCAGAGGTGGGATGGAGG + Intergenic
1122652349 14:103232577-103232599 GGGGCTGGGAGGCAGGAGGGTGG + Intergenic
1122985043 14:105208153-105208175 GGGGCTCGGGGGCTGGGGCGCGG - Intergenic
1125535889 15:40441109-40441131 GGGGCCGGGCGGGCGGAGCGGGG - Intronic
1128743684 15:70099317-70099339 GGCGCTCGGAGGCCGGAGCGCGG + Intergenic
1130282875 15:82532874-82532896 GGGGCTGGGAGCTTGGAGGGGGG - Intergenic
1130531131 15:84748539-84748561 GCGGCTCCGGGGGCGGAGCGGGG - Intergenic
1132655832 16:1041341-1041363 GGGTCTGGGAGGTGGGAGCTGGG - Intergenic
1132976880 16:2715484-2715506 GGGGGTCGGGGGGCGGTGCGAGG + Intronic
1133209836 16:4257460-4257482 GGGGCTGGGGGGTGGGAGAGTGG + Exonic
1133802252 16:9092724-9092746 GGGGCAGGGAGGTCGCGGCGGGG - Intronic
1135135839 16:19884945-19884967 GGGGCTCGGAGGCCCGGGGGCGG - Intronic
1139590622 16:67931008-67931030 AGGGCTCAGAGGTCAGAGTGGGG + Intronic
1142409084 16:89907385-89907407 GGAGCTGGGAGGTGGGAGCTGGG - Intronic
1142409156 16:89907602-89907624 GGAGCTGGGAGGTGGGAGCTGGG - Intronic
1142409284 16:89907964-89907986 GGAGCTGGGAGGTGGGAGCTAGG - Intronic
1142409377 16:89908244-89908266 GGAGCTGGGAGGTGGGAGCTGGG - Intronic
1142409484 16:89908608-89908630 GGAGCTGGGAGGTGGGAGCTGGG - Intronic
1142409497 16:89908643-89908665 GGAGCTGGGAGGTGGGAGCTGGG - Intronic
1143341395 17:6214062-6214084 GGGGCTGAGAGGTAGGAGGGTGG + Intergenic
1143634344 17:8155923-8155945 GAGGTTCGGAGGCCGGAGGGAGG - Intronic
1144565161 17:16353547-16353569 GGGGCGCGGCTGGCGGAGCGGGG - Intronic
1145193257 17:20866536-20866558 GGGGCCTGGAGGTAGGAGCCTGG - Exonic
1145253739 17:21311399-21311421 AGGGCTGGGAGCTTGGAGCGAGG + Intronic
1145265383 17:21377329-21377351 GGGGTTCGGAGGTGGGCGCCCGG + Intronic
1145322848 17:21776562-21776584 AGGGCTGGGAGCTTGGAGCGAGG - Intergenic
1146352839 17:32110602-32110624 GGGGCTTGGAGGCCAGACCGAGG + Intergenic
1146846229 17:36183447-36183469 GGGGCTCGGGGCTCGGGGCTCGG - Intronic
1146926293 17:36748126-36748148 TAGGCTGGGAGCTCGGAGCGGGG - Intergenic
1147321459 17:39648709-39648731 GGGGCTCGAAGGCAGGGGCGGGG - Intronic
1147840633 17:43369031-43369053 GGGGCTGGGCGGGAGGAGCGGGG + Intergenic
1147906406 17:43825892-43825914 GGTGCTTGGAGCTCTGAGCGAGG - Intronic
1147996793 17:44363931-44363953 GGGGGGCGGCGGGCGGAGCGGGG - Intergenic
1148687575 17:49509289-49509311 GGGGCTGGGAGGGCAGAGCTGGG + Intronic
1150281989 17:63934143-63934165 GGGGCACGGAGGTTGGTGGGGGG + Intergenic
1152352939 17:79793435-79793457 ACGGCTCGGAGCTCGGAGCTGGG - Exonic
1152645287 17:81465806-81465828 TAGGCTCGGGGGTGGGAGCGGGG - Exonic
1152834248 17:82519449-82519471 GGAGCTCGGGGGTCTGAGCCCGG - Intergenic
1152848112 17:82614975-82614997 GGGGCTCGGAGGCCAGACCAGGG + Exonic
1152861206 17:82697981-82698003 GGGGCTCCTGGGGCGGAGCGCGG - Intronic
1152938227 17:83152797-83152819 GGGGCACAGAGCTCGGAGCAGGG + Intergenic
1153008255 18:515125-515147 GGGGCCCGGAGGTCTGGCCGAGG - Intergenic
1153008267 18:515156-515178 GGGGCCCGGAGGTCTGGCCGAGG - Intergenic
1153008279 18:515187-515209 GGGGCCCGGAGGTCTGGCCGAGG - Intergenic
1153008291 18:515218-515240 GGGGCCCGGAGGTCTGGCCGAGG - Intergenic
1155110679 18:22711213-22711235 GGGGTGGGGAGGTGGGAGCGGGG - Intergenic
1160756328 19:758763-758785 GGGTCTCAGAGGTTGGAGCAGGG + Intronic
1161006839 19:1941323-1941345 GGGGCGCGGGGCCCGGAGCGGGG + Exonic
1161014925 19:1978774-1978796 GGGGCTCGGAGGGAAGAGGGTGG + Intronic
1161063716 19:2227557-2227579 GGGGGCCGGAGGGCGGAGGGCGG + Intronic
1161104643 19:2437234-2437256 GGGGCTCGGAGAGGGGAGTGGGG - Intronic
1161243288 19:3234875-3234897 GGGGCGCGAAGGTGGGAGCCAGG - Intronic
1161576695 19:5058397-5058419 GGGGCTCTGAGGACTGAGGGAGG + Intronic
1161980085 19:7625841-7625863 GGGGCTCTGGGTTCGGGGCGGGG - Intronic
1163144779 19:15373054-15373076 GGGGCTCAGAGGACGCAGCGGGG + Exonic
1163157175 19:15445863-15445885 GGGGCTCTGAGGGCTGAGTGGGG + Intronic
1163263315 19:16204236-16204258 GGGGCTCTGAGATCTGGGCGGGG - Intronic
1163783911 19:19264683-19264705 AGGGCTAGGGGGTCGGAGGGTGG + Exonic
1163831812 19:19550612-19550634 GGGCCTCTGAGGTGGGGGCGGGG + Intergenic
1164942009 19:32257913-32257935 TGGGCTGGGAGGTGGGGGCGTGG - Intergenic
1165065819 19:33227079-33227101 AGGGCCTGGAGGTGGGAGCGGGG + Intergenic
1165331082 19:35141424-35141446 GGGGCTTGGGGGACGGGGCGGGG - Intronic
1165427993 19:35756210-35756232 GGGGCTCTGAGGAGGGAGCTGGG - Intronic
1165475180 19:36026378-36026400 GGGGCTCCGAGGTGGGGGCGGGG - Intronic
1165924938 19:39320931-39320953 GCGGCGCGGAGGGCGGAGCTCGG - Intergenic
1165940838 19:39413974-39413996 GGGGCTGGGAATTAGGAGCGTGG - Intronic
1166268470 19:41699566-41699588 CGGGCTCTGAGGTTGGAGCCCGG - Intronic
1166547047 19:43639895-43639917 GGGGCGCCGAGGCCGGGGCGGGG + Intergenic
1166688328 19:44809015-44809037 GGGGCCTGGAGGGCGGGGCGGGG + Intergenic
1167075007 19:47243254-47243276 GGGGCTGGGAGGGCGGGGAGGGG + Intergenic
1167237789 19:48325545-48325567 GGGGCACGGAGGCCCGAGCGAGG + Exonic
1167668974 19:50838930-50838952 GGGGCTGGGGGGTCTGAGGGAGG + Intergenic
1167669192 19:50839626-50839648 GGGGCTGGGGGGTCTGAGGGAGG + Intergenic
1168375351 19:55872901-55872923 GGGGCTGGGAGCTTGGGGCGGGG + Intronic
1168405498 19:56108299-56108321 GGGGCTGGGTGGTGGGAGCTGGG - Intronic
925984982 2:9207637-9207659 GCGGCGGGGAGCTCGGAGCGCGG - Intronic
926027370 2:9556326-9556348 GGGGCTCGGGGCTCGGGGCCCGG - Intergenic
927810847 2:26179529-26179551 GGGGCTGGAAGGGAGGAGCGAGG + Intronic
927891689 2:26754583-26754605 GGGGGTGAGAGGTGGGAGCGGGG + Intergenic
929889727 2:45908880-45908902 GGGGCTCAGAGGAAGGAGAGGGG - Intronic
931700766 2:64907313-64907335 AGGGCTCAGAGGTGGTAGCGTGG - Intergenic
932567708 2:72920030-72920052 GGGGCTCGGAGGAGAGGGCGGGG + Intronic
935592363 2:104855074-104855096 GGGGCTCGCCGGGCGGGGCGGGG - Intergenic
936053135 2:109240704-109240726 GGTGCTCAGAGGTGGGAGGGAGG - Intronic
937119528 2:119431980-119432002 GGGGGTGGGAGGACGGAGGGAGG + Intronic
937917690 2:127107002-127107024 GGGGCTGGGGGCTGGGAGCGCGG - Exonic
944412613 2:199458378-199458400 GAGAGTCGGCGGTCGGAGCGGGG + Intronic
945564250 2:211377107-211377129 GGGGCTGGGAGGGGGGAGTGAGG - Exonic
947748753 2:232522388-232522410 GGGGCACGGAGGGCGGGCCGGGG - Intronic
949004287 2:241636821-241636843 GGGCCTCGGCGGCCGGGGCGCGG - Intronic
949019733 2:241734487-241734509 GGGGCTTGGACGGCGGGGCGGGG + Intergenic
949046100 2:241873372-241873394 GGGTCTCGGAGGTGGAGGCGGGG - Exonic
949046154 2:241873525-241873547 GGGTCTCGGAGGTGGAGGCGGGG - Exonic
949046161 2:241873545-241873567 GGGTCTCGGAGGTGGAGGCGGGG - Exonic
1168961230 20:1871435-1871457 GGGGCTGGAAGGTGGGAGCAGGG - Intergenic
1169264635 20:4160404-4160426 GGGGGCCTGAGGTCGGAGCAGGG + Intronic
1171452822 20:25248001-25248023 GGGCCTCGGGGGGCGGGGCGGGG - Intergenic
1172118025 20:32583446-32583468 GGAGCGCGGAGGGGGGAGCGGGG + Intronic
1172596564 20:36154618-36154640 TGGGCTCCGAGGCCGGGGCGGGG + Intronic
1172975533 20:38903175-38903197 GGGGCTTGGAGTTAGGAGCCTGG + Intronic
1173549273 20:43921154-43921176 TGGGCTCGGAGGACAGAGCCTGG + Intronic
1174046782 20:47739433-47739455 GGGGCCAGGAGGTGGGAGGGCGG - Intronic
1174804493 20:53593865-53593887 GGGGCGGGGAGGGCGGAGGGAGG + Intronic
1175976188 20:62711553-62711575 GGGGATCGGGGGTCTGAGTGGGG - Intronic
1175976197 20:62711574-62711596 GGGGATCGGGGATCTGAGCGGGG - Intronic
1175976205 20:62711595-62711617 GGGGATCGGGGTTCTGAGCGGGG - Intronic
1176128972 20:63488238-63488260 CGGGCCCGGGGTTCGGAGCGCGG + Exonic
1176649489 21:9531607-9531629 GGGGCTTGGTGGTAGGAGCCTGG + Intergenic
1178680517 21:34669588-34669610 GGGGCCCGGAGGCCGAGGCGCGG + Exonic
1181268051 22:21642561-21642583 GGGGCTCGGGGTTGGGAGTGTGG + Intronic
1181637645 22:24181765-24181787 GGGGATGGGAGGTCTGAGCCGGG + Intronic
1182282188 22:29224235-29224257 GGGCCTGGCAGCTCGGAGCGGGG - Intronic
1183524795 22:38316876-38316898 GGGCCTCGGAGGGCCCAGCGGGG + Intronic
1183535518 22:38398547-38398569 GGGGCGGGGAGGGCGGAGGGAGG + Intergenic
1184403590 22:44287542-44287564 GGGGCTGGGAGGTGGGGGCAAGG - Intronic
1184801490 22:46762995-46763017 GGGGCTCGGAGGTCGGAGCGTGG + Intronic
953618155 3:44510516-44510538 GGGGCGCGGGGTGCGGAGCGGGG - Intronic
954681849 3:52350184-52350206 GGGGCTGGGAGGTCGGACTCAGG + Intronic
954778878 3:53045350-53045372 GGGGCTCGGCGGGCGGAGCGCGG + Intronic
954794998 3:53156892-53156914 GGGGCTGAGAGGTGGGAGCGGGG + Intronic
961735862 3:129001851-129001873 AGCGCTCGGAAGTCGGCGCGGGG - Exonic
962832490 3:139156993-139157015 AGGCTTCGGGGGTCGGAGCGGGG - Intronic
963374196 3:144442752-144442774 GGGGGTCGGAGGTTGCAGTGAGG - Intergenic
967227658 3:187307285-187307307 GGGGCTGGTAGGTGGGAGTGGGG - Intergenic
968640386 4:1711843-1711865 GGGACCCGGGGGTCGGGGCGCGG - Intronic
968815227 4:2818398-2818420 GGGGCTCGGGGGCCGGGGCTCGG - Intronic
969083829 4:4640763-4640785 GGGGCTCGGAGGGTGGAGTCAGG + Intergenic
970074908 4:12206973-12206995 GGGGCTAGGAGGTTGGAGTAGGG - Intergenic
973292461 4:48483744-48483766 TGGGCTCCGGGGTCGGAGTGGGG - Exonic
973584623 4:52377666-52377688 GGAGCTCGGCGGTCGGGGGGTGG + Intergenic
974414106 4:61582340-61582362 GGGGCCTGGAGGCAGGAGCGGGG - Intronic
976911720 4:90315138-90315160 GCGGATCGGAGGGCTGAGCGTGG - Intronic
977151726 4:93520922-93520944 GGGGCTCAAGGGTGGGAGCGGGG + Intronic
978092783 4:104738321-104738343 GTGGGTCGGAGGTGGGAGAGGGG + Intergenic
978362987 4:107950533-107950555 TGGGCTCAGAGGTCGGAAGGAGG + Exonic
980054053 4:128062456-128062478 GGGGCACGGAGGTGGTAGCTTGG + Intronic
981615341 4:146638831-146638853 GGGGCGCGGGGGTAGGCGCGGGG + Intergenic
983221317 4:165046813-165046835 GGGGCTGGGAGGCGGGAGAGTGG + Intergenic
985478414 5:92342-92364 GGGGCGCGGGGGTAGGGGCGGGG + Intergenic
985478482 5:92478-92500 GGGGCGCGGGGGTAGGGGCGGGG + Intergenic
985660566 5:1155084-1155106 GGGCCTGGGAGGGCGGGGCGGGG - Intergenic
985703234 5:1386122-1386144 GGGGCTCTGGGGCCGGCGCGGGG + Intergenic
985718547 5:1476454-1476476 GTGGCTCGGAGGTCAGAGCCAGG + Intronic
985748599 5:1661684-1661706 GGGGGTCGGGGGTCGGGGGGTGG + Intergenic
991936707 5:71809171-71809193 GGGGGTAGGAGGTGGGAGGGAGG + Intergenic
992690485 5:79236474-79236496 GGAGCTCGGCGGTCGGGGCGCGG + Exonic
999491466 5:152055508-152055530 GGGGCAGGGAGGTGGGAGTGAGG + Intergenic
1001617882 5:173056959-173056981 GGGCCGCGGAGGTTGGAGCCAGG + Intronic
1002139550 5:177130686-177130708 GGAGCTGGGAGGTGGGAGAGAGG + Intergenic
1002267800 5:178047341-178047363 GGGGCTGGGAGGACAGAGCTAGG - Exonic
1003218407 6:4135711-4135733 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003218466 6:4135876-4135898 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003403558 6:5810170-5810192 GGGGCTGGGAGGTGGGCGTGGGG + Intergenic
1003432201 6:6049758-6049780 TGGGCTGGGTGGTCGGAGCATGG - Intergenic
1006026340 6:31149519-31149541 GAGGCTGGGAGGTCGAGGCGAGG - Intronic
1007236076 6:40392244-40392266 GGGGCTGGGACGTCGGCCCGGGG - Exonic
1014098313 6:117482995-117483017 GGGCCTGGGGGGACGGAGCGCGG + Intronic
1018727629 6:166626505-166626527 GCGCCTCGGAGGGCGGAGCTGGG + Intronic
1018972855 6:168540551-168540573 GGGGCACGGAGCTAGGAGGGAGG + Intronic
1019343617 7:519622-519644 GGCGAGCGGAGGGCGGAGCGCGG - Intronic
1019659634 7:2216944-2216966 AGGGCTGGGAGGTCGGCGCTGGG - Intronic
1019708381 7:2507211-2507233 GGGGCTCCCAGGTCTGAGGGGGG - Intergenic
1022840203 7:34157113-34157135 GTGGCTGGGAGGTGGGAGTGGGG + Intergenic
1024000027 7:45183914-45183936 AGGGCTCGGAGGTCACAGCACGG - Exonic
1024043764 7:45574279-45574301 GGGGCTCGGCTGTCGCAGCGCGG + Intronic
1025023036 7:55495041-55495063 GGGGCTGGGGGGTCGGGGGGAGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030138674 7:106284498-106284520 GGGGCTCGGGGCTCGGGGCTTGG - Intronic
1033253211 7:139777851-139777873 GGGGCTCGGGGCTCGGGGCTCGG + Intronic
1033654265 7:143362517-143362539 GGGGGTCGGAGGGCGGCCCGGGG + Intronic
1035167462 7:157000087-157000109 GGGGCGCGGGGGGCGGAGCGGGG + Intronic
1035203278 7:157279766-157279788 GGGGGCCGGAGGTCGGAGGAGGG + Intergenic
1035569826 8:665262-665284 TGGGCTCAGAGGTCGGAGCCGGG - Intronic
1035569835 8:665291-665313 CGGGCTCAGAGGTTGGAGCCGGG - Intronic
1035570691 8:670764-670786 GGGGTTCAGAGGTTGGAGCTGGG - Intronic
1035570715 8:670850-670872 TGGGCTCAGAGGTCGAAGCAGGG - Intronic
1035570733 8:670908-670930 TGGGCTCAGAGGTTGGAGCAGGG - Intronic
1035751951 8:2002480-2002502 GGGGCCCAGCGGTCGGCGCGCGG - Exonic
1038311646 8:26449783-26449805 CGGGCGCGGAGGTCTGGGCGGGG + Intronic
1039936487 8:42051355-42051377 GGGGCGCGGGGATCCGAGCGGGG - Intronic
1041167016 8:55101485-55101507 GGGGCTCGGAGCGCGGAGCCTGG - Intergenic
1045394954 8:101751326-101751348 GGGACTGGGATGTCGGGGCGTGG + Intronic
1048152119 8:131904206-131904228 GGGCCGCGGAGGCCGGAACGAGG - Exonic
1048303504 8:133267761-133267783 GAGGCTCGGAGGTTGGGGAGTGG - Intronic
1048455044 8:134570102-134570124 GAGGCCCGGAGGTAGGTGCGTGG - Intronic
1049185713 8:141251592-141251614 GGGGCTCGGACGTAGGAGACCGG - Intronic
1049466426 8:142753050-142753072 GGAGCTCGGAGGTGGGACCAAGG - Intergenic
1049697175 8:143990062-143990084 GCGGCTCGGAAGACGCAGCGGGG - Exonic
1051620984 9:19049333-19049355 CGGGCACGGAGGGCGGAGCGAGG + Intronic
1052552666 9:29970334-29970356 GGGGCGGGGAGGGCGGGGCGGGG + Intergenic
1055513214 9:77015126-77015148 GGGTCTGGGCGCTCGGAGCGGGG - Intergenic
1055539782 9:77291295-77291317 GGGGCTGGGGGGTTGGAGGGTGG - Intronic
1057259825 9:93577135-93577157 TGGGCTCGGGGCTCGGGGCGCGG + Intronic
1057716684 9:97501615-97501637 TGGGCTCGGGGGTGGGAGCCAGG - Intronic
1057758155 9:97853326-97853348 GGGGCAGCGAGGTCGGGGCGCGG - Exonic
1057758193 9:97853447-97853469 CGGGCTCGAAGGCCAGAGCGAGG - Exonic
1059191635 9:112333152-112333174 GGGGCGCGGAGGGCGGACCTCGG + Intronic
1059404686 9:114092506-114092528 GGGGCACTGAGGTCAGAGAGGGG - Intronic
1060156820 9:121326034-121326056 GGGGCTTGGTGGTGGGAGTGAGG - Intronic
1060197998 9:121635627-121635649 GGGGCGCTGAGATGGGAGCGAGG + Intronic
1060244308 9:121931262-121931284 GGGGCTCTGAGGACGTAGGGTGG - Intronic
1060818690 9:126649390-126649412 GGGGCTGGGAGGACGCAGGGAGG - Intronic
1061041357 9:128142663-128142685 GGGGCTGGGGGGTGGGAGCCTGG - Intergenic
1061052218 9:128203649-128203671 GGGGGTCGGGGGTCGGCGCCTGG - Intronic
1061315945 9:129795852-129795874 GGGGCTGGGAGGTCAGAGGAAGG + Intergenic
1061327207 9:129871175-129871197 GGGGCTGGGAGGTGGGAGTAGGG - Intronic
1061680850 9:132241812-132241834 GGAGCTCGGAGGTTGGCGGGGGG + Intronic
1061811173 9:133163538-133163560 GGGGCTTGGAGGCCCGAGTGGGG - Intronic
1061935977 9:133857858-133857880 GGGGCTCAGAGGAGGGAGGGTGG + Intronic
1062022538 9:134326273-134326295 GGGGCTGGGCGGGCGGGGCGCGG + Intronic
1062255249 9:135617757-135617779 GGGCCTGGGAGGTCGCAGAGGGG + Intergenic
1062535194 9:137018354-137018376 GGGGCCGGGAGGTTGGGGCGGGG + Intronic
1203627230 Un_KI270750v1:35155-35177 GGGGCTTGGTGGTAGGAGCCTGG + Intergenic
1186432540 X:9517353-9517375 GGGCCTCGGAGGTCGGGGTTTGG - Intronic
1187950517 X:24465696-24465718 GGGGCTCGGATTTCGGGGCGCGG + Intronic
1192387910 X:70692429-70692451 GGGGCTGGGAGGTGGGGGAGAGG - Intronic
1192467143 X:71365571-71365593 GGGGGTCTGAGGTGGGAGCCAGG - Intergenic
1195728038 X:107937181-107937203 GGGGGACGGAGGGCGGAGGGCGG - Intergenic
1197415208 X:126165736-126165758 AGGGCCGGGAGGTAGGAGCGCGG - Exonic
1199736789 X:150693314-150693336 GGGGCGGGGAGGGCGGCGCGCGG - Intronic