ID: 1184801712

View in Genome Browser
Species Human (GRCh38)
Location 22:46764782-46764804
Sequence CAAGGAAAGCCAGGGGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 2, 2: 17, 3: 109, 4: 521}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184801705_1184801712 21 Left 1184801705 22:46764738-46764760 CCTATGGAGACAGAAACAGAGAT 0: 1
1: 1
2: 2
3: 43
4: 445
Right 1184801712 22:46764782-46764804 CAAGGAAAGCCAGGGGTTGCTGG 0: 1
1: 2
2: 17
3: 109
4: 521
1184801704_1184801712 22 Left 1184801704 22:46764737-46764759 CCCTATGGAGACAGAAACAGAGA 0: 1
1: 0
2: 7
3: 137
4: 817
Right 1184801712 22:46764782-46764804 CAAGGAAAGCCAGGGGTTGCTGG 0: 1
1: 2
2: 17
3: 109
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184801712 Original CRISPR CAAGGAAAGCCAGGGGTTGC TGG Intronic
900627900 1:3617848-3617870 CAAGGGGAACCGGGGGTTGCTGG + Intergenic
900634148 1:3653363-3653385 CCGGGAAAGGCAGGGGCTGCAGG - Intronic
900913603 1:5619229-5619251 CCAGGAAGGCCAAGAGTTGCTGG - Intergenic
901374229 1:8826056-8826078 CAAGAAAAGCCACGTGGTGCAGG - Intergenic
901429526 1:9204586-9204608 CAAGGAACACCAAGGATTGCTGG - Intergenic
901593801 1:10368854-10368876 CAAGGAAACCCTGAGGTTCCTGG + Intronic
902110964 1:14077887-14077909 CAGGGAATGCCAAGAGTTGCCGG + Intergenic
902636013 1:17735587-17735609 GAAGCAAACCCAGGGGCTGCAGG - Intergenic
903864680 1:26389573-26389595 CAGGGAACGCCAGGGGTAGAGGG - Intergenic
904727586 1:32561466-32561488 GAAGGAATGCCAAGGATTGCTGG - Intronic
904877788 1:33669889-33669911 CAAGGAATGCGAAGGGTTCCTGG + Intronic
904991821 1:34599175-34599197 CAAGGAAAGGCAGGAGTGGTGGG - Intergenic
905239971 1:36575196-36575218 CAAGGACAGCCAGGGGTGGAAGG + Intergenic
905253099 1:36662396-36662418 CAAGGAATGACAAGGGCTGCTGG - Intergenic
906109329 1:43312616-43312638 CAAGGATAGCTGGGGGTTGGGGG + Intronic
906508868 1:46399922-46399944 CAAGGAGAACCAGGGGTGGAGGG + Intronic
906901777 1:49843746-49843768 AAAGGTAAGCCAGGGGTGACTGG - Intronic
907108492 1:51905574-51905596 CAAGGAATGCAAAGGATTGCTGG - Intergenic
907136161 1:52141850-52141872 CGGGGAACGCCAGGGGTTGGTGG + Intergenic
907258914 1:53201398-53201420 CAAGGCATGCCAGGGATTGCTGG + Intronic
907314576 1:53560305-53560327 CAAGGAGCCCTAGGGGTTGCTGG + Intronic
907373947 1:54020501-54020523 CAAGGAAGGCCAGAGGCTGAAGG - Intergenic
907490397 1:54805659-54805681 CAAGGAGAGCCAGAGGGTGGAGG - Intergenic
907557758 1:55359452-55359474 CAGGGAAGACCAGGGATTGCTGG + Intergenic
907579820 1:55561678-55561700 CAACGAATGCCAAGGGTTGCTGG + Intergenic
908182362 1:61618723-61618745 AAAGAAAAGTCAGGGGTTGCAGG + Intergenic
908437408 1:64120220-64120242 CATGGAAAGCCTGGAGTTGGGGG + Intronic
908616229 1:65925902-65925924 CAAGCAGGGCCAGGGGTTGAGGG - Intronic
908941567 1:69441130-69441152 CAAGGAGTGCCAAGGGTTTCTGG - Intergenic
909831159 1:80191691-80191713 CAAGAAATGCCAAGGATTGCTGG + Intergenic
911159763 1:94672492-94672514 TAAGGAAAGCCAGGGGTTGGGGG - Intergenic
911864402 1:102998335-102998357 CAAGGAAAACCAGGACTTGCTGG - Exonic
912300688 1:108513691-108513713 CAAGGAATGCCAAGGATTGCTGG - Intergenic
912309178 1:108602399-108602421 CAAGGAATGCCTGAGGCTGCTGG - Intronic
912365475 1:109130013-109130035 CAAGAAAGGCCAAGGATTGCTGG - Intronic
913172612 1:116246281-116246303 CCAGGAAAGCCAAGGATTGCTGG + Intergenic
913480099 1:119280054-119280076 AGAGGAAGGCCAGGGGTTGTGGG - Intergenic
917475964 1:175369369-175369391 CAAGGAATGCCAGGGAGTGCTGG - Intronic
917670469 1:177269103-177269125 AAAGGAAATCCGGGGGCTGCAGG - Intronic
918368517 1:183835484-183835506 CAAGGAAAGCCAGGAGAAGCTGG - Intronic
919136561 1:193515985-193516007 CAAGGAATGCCAAAGATTGCTGG - Intergenic
919910905 1:202110130-202110152 CAAGGACAGCCAGAGGTAGGAGG + Intergenic
919934796 1:202244514-202244536 CAAGGAACGCCAGCAGCTGCCGG - Intronic
919982466 1:202650877-202650899 CAAGGAAAGGCGGGTGTTTCAGG + Intronic
921431673 1:215073136-215073158 CAAGGAACACCAAGGATTGCTGG + Intronic
921764153 1:218950842-218950864 CAAGGAAGGCCAAAGATTGCTGG - Intergenic
922088856 1:222376585-222376607 AAAGGAACACCAGGGATTGCTGG - Intergenic
922844090 1:228669194-228669216 CAGGAACAGCCAGGGGTTGGGGG - Intergenic
924165722 1:241280267-241280289 CAAGGAATGCCCGTGATTGCCGG + Intronic
924425848 1:243949632-243949654 CAAGGAATGCCAAAGATTGCGGG + Intergenic
1064524391 10:16238896-16238918 CAAGGGCAGCCAGAGTTTGCAGG + Intergenic
1065191262 10:23211213-23211235 CAAGGAATGCCAAGGATTGGTGG - Intronic
1065478303 10:26164851-26164873 GAAGGAAAGCCAAGAGTTGATGG + Intronic
1066428981 10:35335168-35335190 CAAGAAAAGTCAGGGATGGCTGG + Intronic
1066586977 10:36946192-36946214 CAAGGAACGCCAGGTATTGCTGG - Intergenic
1067190450 10:44063763-44063785 CAAGGCAAGCAAGTGGCTGCTGG - Intergenic
1067414135 10:46091187-46091209 CAAGGTGAGGCAGGGCTTGCAGG + Intergenic
1067531524 10:47077613-47077635 CAAGGAACGTCAAGGATTGCCGG - Intergenic
1067847668 10:49736588-49736610 TAAGGAGAGCCTGGGGATGCAGG - Intronic
1068687170 10:59882037-59882059 AAAGGAAAGCCAGGGGGAGAAGG + Intronic
1068687269 10:59882394-59882416 AAAGGAAAGCCAGGGGGAGAAGG + Intronic
1068687276 10:59882417-59882439 AAAGGAAAGCCAGGGGGAGAAGG + Intronic
1068687289 10:59882463-59882485 AAAGGAAAGCCAGGGGGAGAAGG + Intronic
1068687304 10:59882509-59882531 AAAGGAAAGCCAGGGGGAGAAGG + Intronic
1069194410 10:65531219-65531241 CCAGGGAAGCCAGGGGTGGAGGG + Intergenic
1069586091 10:69603530-69603552 CAAGGAATGCCAAGCATTGCTGG - Intergenic
1069715172 10:70515906-70515928 AAAGAAAAGCGAGGGCTTGCAGG - Intronic
1070740653 10:78900914-78900936 CGAGGAAAGCCAGGGGTCCAAGG - Intergenic
1070853197 10:79584307-79584329 CCAGGAAACCCAGGGGCTCCTGG - Intergenic
1071278334 10:84076806-84076828 CAAGGCAGCCCAGGGGCTGCAGG + Intergenic
1071320707 10:84454174-84454196 CAAGGAATCCCAAGGATTGCTGG - Intronic
1071603105 10:86968544-86968566 CATGGCAAGCAAGGGCTTGCAGG + Exonic
1072057231 10:91772086-91772108 CAAGGAATGCCAAAGATTGCTGG - Intergenic
1072538982 10:96384205-96384227 CAAGGAATGCCAAGGACTGCTGG + Intronic
1072594690 10:96860418-96860440 CAAGGATTGCCAAGGATTGCTGG + Intronic
1073077561 10:100834013-100834035 CAAGGAGAGACAGTGGGTGCAGG + Intergenic
1073267848 10:102239139-102239161 AATGGGGAGCCAGGGGTTGCTGG - Intronic
1074460389 10:113631381-113631403 CCAGGAAAGAAAGGAGTTGCAGG + Intronic
1074472457 10:113739865-113739887 TCAGAAAAGCCAGGGTTTGCTGG + Intergenic
1074830955 10:117248484-117248506 CCAAGAAAGCCTGAGGTTGCTGG + Intronic
1074876668 10:117618957-117618979 CAAGGAATGCCAGGAGGTGACGG + Intergenic
1074886716 10:117699783-117699805 CAAGGGACGCCAAGGATTGCCGG + Intergenic
1075067842 10:119301661-119301683 AAAGGAGAGCCAGGGGCTTCTGG - Intronic
1075074173 10:119339545-119339567 GAAGAAAAGCCATGGGTTGTAGG + Intronic
1075191633 10:120314993-120315015 CAAGGAATGCCATGGATTGCAGG - Intergenic
1075635172 10:124025832-124025854 CAAGGAACGCCAAGGACTGCTGG + Intronic
1075675574 10:124293624-124293646 CAAGGCAACCCTGGGGGTGCAGG + Intergenic
1075832246 10:125421441-125421463 CATGGAATGCCAGGGACTGCTGG - Intergenic
1076736626 10:132462005-132462027 CAAGGAAAGCTTGGGGGAGCTGG - Intergenic
1077223231 11:1426545-1426567 CAGGGAAGGCCCTGGGTTGCTGG + Intronic
1077546307 11:3171674-3171696 CAAGGAGTGCCAAGGATTGCTGG - Intergenic
1077880907 11:6349284-6349306 CAAGGAATGACAAGGATTGCTGG - Intergenic
1078478695 11:11657297-11657319 CAAGGAATGCCAAGGATTGCTGG + Intergenic
1078520828 11:12061632-12061654 CAAGGAACGTCAAGGGGTGCCGG + Intergenic
1078916408 11:15782815-15782837 CAAGGAAGGCCAGAGATTGCTGG + Intergenic
1079349855 11:19683281-19683303 AACGGAATGTCAGGGGTTGCGGG + Intronic
1080087313 11:28299866-28299888 CAAGGAACACCAAGGATTGCTGG - Intronic
1080113798 11:28599361-28599383 CAAGGAAGGCCAGGGATTAATGG + Intergenic
1080860525 11:36146651-36146673 CAAGAAATGCCAAGGATTGCTGG - Intronic
1080950252 11:37024079-37024101 CAAGGAATGCCAAATGTTGCTGG + Intergenic
1081845377 11:46237520-46237542 CATGGCAAAACAGGGGTTGCAGG + Intergenic
1084008502 11:66335309-66335331 CAAGGCAAGGCAGGGGCTTCGGG + Intronic
1084110961 11:67013954-67013976 CAAGGAATATCAAGGGTTGCTGG - Intronic
1086532576 11:87803217-87803239 AAAGGAAAGCCAGGGATTGCTGG - Intergenic
1086546605 11:87975050-87975072 TAAGGAATGCCAAGGATTGCTGG - Intergenic
1086903989 11:92398112-92398134 CAAGGAAAGCCAAGGAGTGCTGG - Intronic
1087403710 11:97701955-97701977 CAAGGAATACCAAGGCTTGCAGG + Intergenic
1088798275 11:113283013-113283035 GAGGGTAAGTCAGGGGTTGCTGG + Intergenic
1088831268 11:113538986-113539008 TAGTGAAAGCCAGGGGCTGCTGG - Intergenic
1089374701 11:117986213-117986235 GAAGGAAAGGGAGGGGTGGCCGG + Intergenic
1090609950 11:128462167-128462189 AAAGGAAAGCCAGGACTTGTGGG - Exonic
1090672242 11:128956793-128956815 CTAAGAAAGGAAGGGGTTGCTGG - Intergenic
1090782508 11:130020523-130020545 CAAGGAATTCCAAGGATTGCTGG - Intergenic
1090799533 11:130161622-130161644 AAACTAAAGCCAGGGCTTGCAGG - Intronic
1091043387 11:132303354-132303376 CAAGGAACGCCAGGAATTGCTGG - Intronic
1091061197 11:132464093-132464115 CAAGGAAAGGGAGGGGTGGCAGG - Intronic
1091628259 12:2139194-2139216 CAAGGGATGCCAGGCGCTGCTGG - Intronic
1092659622 12:10723519-10723541 CAAGGAAAGCCAGGGTGAACGGG + Intergenic
1093447318 12:19275214-19275236 CAAGGAAAGGCTTGGGTTACAGG + Intronic
1095942761 12:47737506-47737528 CCGGGAAAGCCAGGGTGTGCCGG - Exonic
1095985078 12:47994010-47994032 CCAGGAAGGCCTGGGGTTCCTGG + Exonic
1096016601 12:48281923-48281945 CAAAGGATGCCAGGGGTTTCTGG - Intergenic
1096577461 12:52562182-52562204 CAAGGCAAGCCTGGGGGAGCTGG - Intergenic
1096596010 12:52696010-52696032 CCAGGAAAGCCAGGACTTGTGGG - Intronic
1096783955 12:54006638-54006660 CAAGTCCGGCCAGGGGTTGCGGG + Intronic
1097395182 12:59064639-59064661 CTATGAAAGGCAGGGGTTGTTGG - Intergenic
1098105627 12:67067851-67067873 CGAGGAAAGCCAGAGGAGGCCGG - Intergenic
1098464673 12:70773019-70773041 CAAGGAATCCCAAGGATTGCTGG - Intronic
1099104365 12:78481058-78481080 ATAGGAAGGCCATGGGTTGCTGG - Intergenic
1100233603 12:92634970-92634992 CAAGGAATGCCAAGGATTGCCGG - Intergenic
1100615603 12:96229424-96229446 CAAGGCACGCCAGGGACTGCTGG - Intronic
1100616771 12:96236942-96236964 CAAGGAACACCAAGGGTGGCTGG - Intronic
1101558179 12:105830570-105830592 CAAGGTAAGCCAAGGATTGTTGG - Intergenic
1102412233 12:112730083-112730105 CAAGGAATGCCAGTGATTTCTGG + Intronic
1102556498 12:113730107-113730129 CAAGGAAAGCAAGCTGTGGCTGG - Intergenic
1103005237 12:117415597-117415619 CAAGGAACTCCAAGGCTTGCTGG - Intronic
1103941081 12:124501541-124501563 CAGGGAACACCGGGGGTTGCCGG - Intronic
1103960542 12:124606574-124606596 CAAGGCATGCCAGGGATTGCTGG + Intergenic
1103974719 12:124695048-124695070 GAAGGAAGGTCCGGGGTTGCGGG + Intergenic
1104170147 12:126272865-126272887 CAAGGAACGCCATGGGTTGCTGG + Intergenic
1104368685 12:128202697-128202719 CAGGGAAAGCCAGGGCTGGAGGG - Intergenic
1104406940 12:128525782-128525804 CAAGGCAGGCCAGGAGTTGCAGG - Intronic
1104496002 12:129239688-129239710 CAAGGAATGCCAAAGATTGCTGG + Intronic
1104517565 12:129442161-129442183 CAATGAAAGACAAGCGTTGCAGG - Intronic
1104942860 12:132403092-132403114 CAAGGAAGGCCAGGAGCCGCAGG + Intergenic
1105437508 13:20391060-20391082 GAAGGGAAGCAAGGGGTTGGGGG + Intergenic
1105437594 13:20391257-20391279 GAAGGAAGGACAGGGGTTGGGGG + Intergenic
1105437629 13:20391349-20391371 GAAGGAAGGCGAGGGGTTGGGGG + Intergenic
1105437674 13:20391464-20391486 GAAGGAAGGCGAGGGGTTGGGGG + Intergenic
1105841998 13:24261662-24261684 CAAAGGAAGCCAGGGCTTCCAGG + Intronic
1106155068 13:27146978-27147000 CAAGGAATGCCTGAGGCTGCCGG + Intronic
1106196405 13:27497894-27497916 CAAGGGAAGCAAGGGGTAGAAGG - Intergenic
1106298416 13:28439746-28439768 CAAAGAATGCCAAGGATTGCGGG + Intronic
1106543556 13:30711898-30711920 CAAGGAACACCAGGGATTGCTGG - Intergenic
1107107161 13:36656808-36656830 CAAGGAATGCCAAGGATTGCTGG - Intergenic
1107595532 13:41959926-41959948 CAAGGAAAACTGGGGGTTGCGGG + Intronic
1107783482 13:43930218-43930240 CAAGGAACACCAAGGATTGCTGG + Intergenic
1110232201 13:73178765-73178787 CAAGGAATACCATGGTTTGCTGG + Intergenic
1110242368 13:73283346-73283368 CAAGGAATGCCAAGGATTGATGG + Intergenic
1111324519 13:86675623-86675645 CAAGGAAAGGCAAGGATTGTTGG - Intergenic
1112831955 13:103464403-103464425 CAAGGAATGCCAAAGGCTGCTGG - Intergenic
1113209881 13:107964548-107964570 CAAGGAACATCAGGGATTGCTGG - Intergenic
1114497143 14:23140673-23140695 CAGGGCAGGCCAGGGGCTGCTGG - Intronic
1115815701 14:37162074-37162096 CAAGGAATACCAAGCGTTGCTGG + Intronic
1116349611 14:43843952-43843974 CAAGGAAAGCCAAGGATTGCTGG - Intergenic
1116573049 14:46543008-46543030 CAAGGAAACCAAAGGATTGCTGG - Intergenic
1116690672 14:48102067-48102089 TAAAGAAAGCAAGGGGCTGCAGG - Intergenic
1119036438 14:71233613-71233635 CCAGGAAAGCCAATGGCTGCAGG - Intergenic
1119042041 14:71283445-71283467 AAAGGAAGGCCAGGAGCTGCTGG + Intergenic
1119139698 14:72255149-72255171 AAAGGAAAGGCAGGGTATGCAGG + Intronic
1119264915 14:73259012-73259034 CAACGGCATCCAGGGGTTGCTGG - Exonic
1119895571 14:78216834-78216856 CAAGGAACGCCAAGGATTGCCGG - Intergenic
1120462835 14:84819137-84819159 CAGGGAATGCCAAGGATTGCTGG + Intergenic
1120768154 14:88350584-88350606 CAAGGCAAGGTAGGGGTTGCAGG + Intergenic
1121493614 14:94377482-94377504 GGAGGAAAGGGAGGGGTTGCGGG + Exonic
1121711902 14:96044707-96044729 CAAGGAATGCCAAGGACTGCAGG - Intronic
1122042672 14:99000096-99000118 CAAGACAAGCCATGGGGTGCGGG + Intergenic
1122580952 14:102771288-102771310 CCAGCAAAGCCAGTGGTTGGTGG - Intergenic
1122594983 14:102884180-102884202 CAAGGAAGGCCAAGGACTGCTGG - Intronic
1123405535 15:20017772-20017794 CCAGGCCAGCAAGGGGTTGCAGG - Intergenic
1123514867 15:21024420-21024442 CCAGGCCAGCAAGGGGTTGCAGG - Intergenic
1124605542 15:31167760-31167782 CAAAGAAAGGCAGGGTTTCCTGG + Intergenic
1125460215 15:39899227-39899249 CAGGCAAAGCAGGGGGTTGCTGG - Intronic
1126176229 15:45738182-45738204 CAGGGAAAGCAAGGGCTGGCTGG + Intergenic
1127681671 15:61303847-61303869 CAAGGAACACCAAGGGTTTCTGG - Intergenic
1127718745 15:61678732-61678754 CAAGAAATGCCAGGGATTGCTGG + Intergenic
1128216351 15:65936916-65936938 AAAGGAAAGCCAGGAGATCCTGG + Intronic
1128699591 15:69794669-69794691 AAAGGAAAGCCAGGACTTGGGGG - Intergenic
1128808941 15:70555922-70555944 CTAGCAAAGCCGGGGGTGGCTGG + Intergenic
1128892483 15:71343538-71343560 CAAGGAAGGCCAGTGATTGCTGG - Intronic
1129360996 15:75024038-75024060 AAAGGAAAGCCATGGGATGTTGG + Intronic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1131209302 15:90479916-90479938 CAAGGAATGCCCTGGGTTGCAGG - Intronic
1131476868 15:92747276-92747298 CAGGGAATGCCAAGGGCTGCTGG - Intronic
1132224126 15:100127391-100127413 CAGGGGAGGCCAAGGGTTGCCGG + Intronic
1132234483 15:100208897-100208919 CAGGTAAAGCCTGGTGTTGCAGG - Intronic
1133126938 16:3653190-3653212 TAAGGAAAGCCAAGGATTGCTGG + Intronic
1133205495 16:4230882-4230904 CAAAGAATGCCAGGAATTGCTGG + Intronic
1133618222 16:7499970-7499992 CAAGGAAAACCAGGGGTTTTTGG - Intronic
1133909953 16:10056730-10056752 CAAAGAACGCCAAGGGTTGATGG + Intronic
1134451668 16:14367727-14367749 GAAGGAAAGTCAGGGGTGACCGG - Intergenic
1134687099 16:16166515-16166537 CAAGGAATGCCAGCGACTGCCGG + Intronic
1135396427 16:22135266-22135288 CAAGGAATGCCAGAGATTGCTGG - Intronic
1135934533 16:26768415-26768437 CAAGGAAAGGCAGGGGATCCAGG - Intergenic
1136682974 16:31978682-31978704 GAAGGATGGCCAGGGCTTGCCGG + Intergenic
1136783615 16:32922238-32922260 GAAGGACGGCCAGGGCTTGCAGG + Intergenic
1136886176 16:33931568-33931590 GAAGGACGGCCAGGGCTTGCCGG - Intergenic
1137474354 16:48794111-48794133 CAAAGAAAGCCAAGGATTGCTGG - Intergenic
1138107269 16:54294847-54294869 CAAAGAATGCAAGGGGTTGCTGG + Intergenic
1138718290 16:59048981-59049003 CAAGGAAGGCCAAGCATTGCTGG + Intergenic
1138853800 16:60663041-60663063 CAAGAAATGCCAAGGATTGCTGG + Intergenic
1140300925 16:73756674-73756696 CTAGGAAAGCCTGGGCTTTCCGG - Intergenic
1140636335 16:76919089-76919111 CAAGGAACACCAAGGTTTGCTGG - Intergenic
1140942011 16:79730697-79730719 CAAGGAATGCCAAGGATTTCTGG + Intergenic
1141109820 16:81263004-81263026 TGAGGAACACCAGGGGTTGCCGG - Intronic
1141253616 16:82381071-82381093 CAAGGAATGCCAAGGCTTGCTGG - Intergenic
1141307978 16:82884498-82884520 CAAGGTAAGCCAGGGGACACAGG + Intronic
1141747570 16:85936079-85936101 CAAGGAGATTCAGGGGATGCGGG - Intergenic
1142858803 17:2749062-2749084 CCAGGGAAGGCAGGGGTTGGGGG + Intergenic
1143479808 17:7221694-7221716 CTAGGAGAGCCAGGGATTGGGGG + Intronic
1144771707 17:17763141-17763163 CCAGGAAAGCGGGGGGATGCAGG - Intronic
1144783046 17:17817344-17817366 CAAGGAGGCCAAGGGGTTGCAGG + Exonic
1145118131 17:20231104-20231126 CAAGGAGAACAAGGGGCTGCAGG + Intronic
1145170321 17:20650883-20650905 CAAGGAGAACAAGGGGCTGCAGG + Intergenic
1145219636 17:21077575-21077597 CAAGGAACACCAAGGATTGCTGG + Intergenic
1145919635 17:28600593-28600615 AAAGTTAAGCCAGGGGTGGCAGG + Intronic
1146281488 17:31547999-31548021 CAAGGGAAGCCTGGGATTACAGG + Intergenic
1147143879 17:38474391-38474413 GAAGGAGGGCCAGGGCTTGCCGG + Intronic
1147347831 17:39814691-39814713 CAAGGAACACCAGGCATTGCTGG + Intronic
1148081873 17:44971288-44971310 CAAAGGATGCCAGGGGCTGCTGG - Intergenic
1148155837 17:45424998-45425020 GCAGGAGAGCCAGGGGGTGCGGG + Intronic
1148581916 17:48750057-48750079 GTAGGAAAGCCAGGGGTCGAAGG + Intergenic
1149009857 17:51845043-51845065 CAAGGAATGCCAAGGATTGATGG + Intronic
1149537649 17:57444783-57444805 AGAGGAAAGCCCGGGGTTGGCGG + Intronic
1150480309 17:65503996-65504018 CAGGGAAAGCCTGGGGATGGAGG + Intergenic
1150582080 17:66483335-66483357 CAAGGAATGCCAAAGATTGCCGG - Intronic
1150674919 17:67236809-67236831 CAAGGAAATGAAGGGGTTCCAGG + Intronic
1150897546 17:69231174-69231196 CAAGGAATGACAAGGGTTGCTGG - Intronic
1151336291 17:73441583-73441605 CAAGGAATGCCAAGCATTGCTGG + Intronic
1151706943 17:75774172-75774194 CACTGATAGCCAGGGATTGCTGG + Intergenic
1151943116 17:77305133-77305155 CAGGAAAACCCAGGGGTTCCTGG - Intronic
1151946807 17:77324061-77324083 CAAGGAACGCCAAGGGTTTCGGG - Intronic
1151950787 17:77352560-77352582 CGAGGAATACCAGGGGTTGCTGG - Intronic
1152255336 17:79235667-79235689 TAATGAAAGCCAGGAGTTTCTGG - Intronic
1152643217 17:81457750-81457772 GGAGGAAGGGCAGGGGTTGCTGG + Intronic
1153142606 18:1991819-1991841 CAAGGAATGCCAGGGATTATTGG - Intergenic
1153642102 18:7166047-7166069 CGAGGAATGCCAAAGGTTGCTGG + Intergenic
1155305421 18:24473476-24473498 CAAGGAATGCCAGGGGTTGCTGG - Intronic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1155548630 18:26940961-26940983 CAAGGAATGTCAAGGATTGCTGG + Intronic
1155581409 18:27312275-27312297 CAAGGAATGACAAGGGTTCCTGG - Intergenic
1155868219 18:30992880-30992902 CAAGGAAAGCCAGGCCTTGTGGG - Exonic
1157434310 18:47655374-47655396 CCAGGACAGCCAGGGGATGAGGG - Intergenic
1157481854 18:48060292-48060314 AAAGGAAAGGCAGGGCATGCAGG + Intronic
1157499172 18:48178003-48178025 CAAGGAGAGGGAGGGGCTGCTGG - Intronic
1158058323 18:53308938-53308960 CAAGGAAGACCAGGGACTGCCGG - Intronic
1158272221 18:55728934-55728956 CAAGGAACCCCAAGGATTGCTGG + Intergenic
1158698250 18:59722168-59722190 CAAGGAATGCCAGTGATTTCAGG + Intergenic
1158803745 18:60945189-60945211 CAAGGAACTTCAAGGGTTGCTGG - Intergenic
1158973328 18:62688364-62688386 CAGGGAATGCCAAGGGCTGCAGG - Intergenic
1159161751 18:64651394-64651416 CAAGGAAAGCTGTGGGTGGCAGG - Intergenic
1160017770 18:75157597-75157619 CAAGGAATGCCAGAGATTGCCGG + Intergenic
1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG + Intronic
1161250643 19:3278206-3278228 GAAGGACAGCCAGGGGCTACCGG - Intronic
1161306073 19:3569059-3569081 CAAGAAAAGCCCAGGATTGCTGG + Intronic
1161757420 19:6144452-6144474 CAAGGAATGTCAAGGATTGCCGG + Intronic
1161999888 19:7737278-7737300 CAAGGAACGCCAAAGGTTGTCGG + Intergenic
1162006275 19:7781933-7781955 CAAGGAATGCCAAAGGTTGTCGG - Intergenic
1162549366 19:11350049-11350071 CAAGGAGAAACAGAGGTTGCTGG - Intronic
1162908298 19:13836247-13836269 CCAGGGAAGGCAGGGGCTGCAGG + Intergenic
1163624682 19:18382400-18382422 CAAGGAGAGCCAGGAGGAGCTGG + Intronic
1166047182 19:40236431-40236453 GAAGGAAAGGCTGGGGTGGCAGG - Intronic
1166387241 19:42389205-42389227 CAGGGACAGACTGGGGTTGCCGG - Intronic
1167007738 19:46786803-46786825 GAGGGAAAGGCAGGGGTGGCAGG + Intronic
1167120217 19:47512300-47512322 CAAGGAATCCCAGGACTTGCTGG - Intronic
1167242636 19:48353859-48353881 CAAGGAGCACCAAGGGTTGCTGG + Intronic
1168329920 19:55561994-55562016 CAAGGGATGCCAAGGGTGGCTGG + Intergenic
925428271 2:3769342-3769364 CAAGGAAACCCAAGGGGCGCTGG + Exonic
926515361 2:13838360-13838382 CAAAGAAAGTCGGGTGTTGCGGG - Intergenic
926590853 2:14738841-14738863 CAAGGAAGGCCGAGGATTGCTGG + Intergenic
927763734 2:25784644-25784666 CAAGGAATGCCAAAGATTGCTGG - Intronic
928254827 2:29713101-29713123 CAAGGAACACCAAGGATTGCGGG - Intronic
928466406 2:31527000-31527022 CACGGAACACCAAGGGTTGCCGG + Intronic
928601602 2:32908980-32909002 AGAGGAAAGCCAGGCATTGCAGG + Intergenic
928697231 2:33861655-33861677 CAAGAAATGCCAGGGAGTGCTGG - Intergenic
928700996 2:33898476-33898498 CAAGCAATGCCAAGGATTGCTGG + Intergenic
929414725 2:41735894-41735916 CAAGGAATGCTAGGGCTTCCTGG + Intergenic
930551113 2:52836018-52836040 CAGGGAATGCCAAGGGTTGCAGG - Intergenic
931165753 2:59745892-59745914 CAATGAGAGCCAGTGGTTGAGGG - Intergenic
931986826 2:67750302-67750324 CAAGGAATGCCAAAGCTTGCCGG - Intergenic
933592848 2:84251660-84251682 GAAGGAGAGACAGGGGTTGGCGG + Intergenic
933628633 2:84631662-84631684 CAAGGAATCCCAAGGGTTGCCGG + Intronic
933848627 2:86347997-86348019 CAAGGAATGCGAAGGGCTGCCGG - Intergenic
933850830 2:86365271-86365293 CAGGGAATGCCAAGGATTGCTGG + Intergenic
934057456 2:88263666-88263688 CAAGGAAATCCAAGGATTGCTGG - Intergenic
935025139 2:99269494-99269516 CAAGGAGTGCCAAGGATTGCTGG + Intronic
936558323 2:113515088-113515110 CAAGGAATGTCAGGGCTTGCAGG - Intergenic
936888476 2:117341113-117341135 CAAGGAATGTCAAGGATTGCAGG - Intergenic
937308482 2:120886786-120886808 CAAGGAACCCCAGACGTTGCTGG + Intronic
937898879 2:127000840-127000862 CAAGGAATGCCAAGGGTTGCTGG - Intergenic
938586241 2:132693493-132693515 CAAGGAAGACCAGGGATTGCTGG + Intronic
938966989 2:136397470-136397492 CAAGGAAAGGCAGGAGGAGCAGG - Intergenic
939829629 2:147056627-147056649 CAAGGAAGGGCAGGGGTTTTGGG - Intergenic
940498497 2:154464751-154464773 CAAGGAATGCCAAGGACTGCCGG - Intergenic
941228760 2:162882623-162882645 CAAGGAATGCCAAGAATTGCTGG - Intergenic
941933008 2:170961266-170961288 CCACGTAAGCCAGGGGTTGCAGG - Intronic
942296307 2:174520378-174520400 CAAGGAACACCAAGGATTGCCGG - Intergenic
942421204 2:175809853-175809875 CAAGGAAGGCCAAGGATTGCTGG - Intergenic
942486019 2:176440627-176440649 CAAGGAAAGCCAGAGATTGCTGG - Intergenic
943863605 2:192899185-192899207 CATTGAAAGGCAGGGGTGGCGGG - Intergenic
943881741 2:193154282-193154304 CAAGGAATGCCAAAGATTGCTGG - Intergenic
944390707 2:199216373-199216395 CAAGGAAGGCCAGAGACTGCCGG + Intergenic
944589323 2:201202469-201202491 CAAGGAAAGCCAGGGCCTGGAGG + Intronic
945611885 2:212013675-212013697 TAAGGAATGCCAAGGATTGCTGG + Intronic
946134352 2:217633552-217633574 AAATGAAGCCCAGGGGTTGCTGG - Intronic
947352678 2:229262789-229262811 CAAGGAATGCCAAGGATTGCTGG - Exonic
947496340 2:230640230-230640252 CAAGAAATGCCAAGGGTTGCCGG + Intergenic
947564062 2:231182670-231182692 CCAGGAGTGCCAGTGGTTGCTGG - Intergenic
947752279 2:232539404-232539426 CAAGGACAGCCAGGGCCAGCTGG - Intergenic
947820132 2:233063591-233063613 CGAGGAAATGCAGGGTTTGCTGG - Intronic
947854346 2:233313154-233313176 CACCAAAAGCCAGGGGGTGCTGG + Intronic
948098376 2:235354537-235354559 CAAGTGAAGCCAGGGGTGGGAGG - Intergenic
948237576 2:236402081-236402103 CTGGGAAAGCCAGGGCTTCCTGG + Intronic
948279349 2:236734630-236734652 CAAGGAATGCCAAGGATTCCTGG + Intergenic
948320801 2:237067469-237067491 CAAGGAATGCCAGGGATTGCTGG - Intergenic
948694081 2:239724462-239724484 TAAGGAGAGACAGGGTTTGCAGG - Intergenic
1169238251 20:3950403-3950425 CAAGGAATGCCAAGGCTTTCTGG + Intronic
1169292177 20:4362125-4362147 CAAGGAGGGCCAAAGGTTGCTGG + Intergenic
1169311358 20:4543616-4543638 CAAGGAACTTCAGGGGTTGATGG - Intergenic
1169319008 20:4615927-4615949 CAAGGAACTCCAAGGATTGCTGG - Intergenic
1169576380 20:6966535-6966557 CAAGGAATGACAAGGGTTGCAGG + Intergenic
1170041497 20:12044542-12044564 CAAGAAAAGACAGGGTTAGCTGG - Intergenic
1171186551 20:23127588-23127610 CAGGGAAACCCAGGGGCTGTGGG + Intergenic
1172106643 20:32521027-32521049 CAAGGAAAGTCAGGGATTTGAGG + Intronic
1173423976 20:42927091-42927113 CAAGGAAAACCTGAGGGTGCAGG + Intronic
1173531980 20:43776769-43776791 CAAGGAATGGCAAGGATTGCTGG - Intergenic
1174440653 20:50549595-50549617 GAATGAAAGACAGGGGTTGAGGG - Intronic
1174727552 20:52878669-52878691 CAAGGAAGGCCCAGGATTGCCGG - Intergenic
1175163152 20:57023686-57023708 CAAGGAATGCCAGGAGCTACTGG + Intergenic
1175251991 20:57615440-57615462 CAAGGAGGGCCTGGGGTTCCTGG + Intronic
1175371979 20:58498516-58498538 GAAGAAAGGCCAGGGGCTGCTGG + Intronic
1175608387 20:60330107-60330129 CAAGGAATGCCAAGGTTTGCTGG + Intergenic
1175775093 20:61648070-61648092 CAAGGGAAGTCAGAGGTGGCTGG - Intronic
1177622124 21:23610362-23610384 CAAGGAATGCCAAGGAATGCTGG + Intergenic
1178055024 21:28788956-28788978 CAGGGAATGCCAAGGATTGCTGG + Intergenic
1178095802 21:29213553-29213575 CAAGGAATGCAGAGGGTTGCAGG - Intronic
1178308616 21:31511035-31511057 CAAAGAATGCCATAGGTTGCTGG + Intronic
1178368956 21:32011230-32011252 CAAAGAATGCCAAGGATTGCTGG - Intronic
1178376877 21:32074373-32074395 CAAGGAAGGCCAAAGGTTGCTGG - Intergenic
1178422184 21:32451711-32451733 CAAGGAATGCCGAGCGTTGCCGG - Intronic
1178506444 21:33166928-33166950 CAAGGAATGGCAGGGATTGCTGG + Intronic
1178599144 21:33980969-33980991 CAAGGAATGCCAAGGAGTGCAGG - Intergenic
1178718288 21:34986691-34986713 CAAGGGATGTCAAGGGTTGCTGG + Intronic
1178750587 21:35299050-35299072 CAAGGAAGGCCACGCATTGCTGG + Intronic
1178885907 21:36484559-36484581 CAAGGAATGCCAAGGATTGCTGG - Intronic
1179051186 21:37889705-37889727 CAAGGAATGCCAAGGGTTGCTGG - Intronic
1179282104 21:39942556-39942578 CAAGGAATGCCAAGGACTGCTGG - Intergenic
1179428928 21:41304894-41304916 CCAGCAAAGGCAGGGGCTGCTGG + Intronic
1179473912 21:41631330-41631352 CAAGGAGAGCCAGGGATTGCTGG - Intergenic
1179927393 21:44543708-44543730 CAAGGGAACCCAAGGTTTGCTGG + Intronic
1179938584 21:44622563-44622585 CAAGGGACGCCAAGGTTTGCTGG - Intronic
1181051987 22:20242244-20242266 CACGGCCAGCCAGGCGTTGCGGG + Exonic
1181473789 22:23156491-23156513 CAAGGGCAGCCAGGTGGTGCTGG + Intronic
1182358149 22:29731544-29731566 CAAGGAAATAGCGGGGTTGCAGG + Exonic
1183052382 22:35274165-35274187 CAAGGAAAGCCCGGAATGGCTGG + Intronic
1183350211 22:37330732-37330754 CTAGGACTGCCAGGGGTTGGGGG + Intergenic
1183562754 22:38589203-38589225 CAAGGACAGCCACGGACTGCTGG + Intronic
1184250946 22:43259985-43260007 CCAGGGAAGCCAGGGATTCCGGG + Intronic
1184438536 22:44495189-44495211 CAAGGACATTCAGTGGTTGCTGG - Exonic
1184464092 22:44658914-44658936 CAAGGAGGGCCAGAGGTTCCAGG + Intergenic
1184744138 22:46446287-46446309 CAGGTACAGCCAGGGGATGCGGG - Intronic
1184767093 22:46577556-46577578 CGAGGACATCCCGGGGTTGCGGG + Intronic
1184801712 22:46764782-46764804 CAAGGAAAGCCAGGGGTTGCTGG + Intronic
1185112567 22:48909473-48909495 CAAAGAAAGACAGAAGTTGCAGG - Intergenic
949228369 3:1720848-1720870 CAAGGAAGGCCAGGGATTGCTGG - Intergenic
949558029 3:5175752-5175774 GAAGGAATGCCAAGGATTGCTGG - Intronic
949902112 3:8824150-8824172 CAAGGAAAGGCAGGAGTTACTGG - Intronic
950110023 3:10412875-10412897 CAAGAAGAGCTAGGGTTTGCTGG - Intronic
950850928 3:16061603-16061625 CAGGGAATGCCAAGGATTGCAGG - Intergenic
950955821 3:17052628-17052650 GAAGGAAAGGCAGGGGAGGCAGG - Intronic
951863293 3:27277776-27277798 CAAAGAAAGTCAGGTGTAGCAGG - Intronic
952101424 3:30017578-30017600 CAAGGGATGCCAAGGATTGCCGG + Intergenic
952126668 3:30308862-30308884 CAAGGAACACCAAGGGTTGCTGG - Intergenic
952372501 3:32736778-32736800 CAAGAAAAGGCAGGGGTTGAGGG + Intronic
953916545 3:46924237-46924259 CACTGAATGCCAGGGGTTGGAGG - Intronic
954136032 3:48582634-48582656 CAGGGGCTGCCAGGGGTTGCTGG - Exonic
954198806 3:49012185-49012207 CCTGGAAAGCAAGGGATTGCTGG + Exonic
954240246 3:49288087-49288109 CCATGAGAGCCAGGGGTTGTGGG - Intronic
954681200 3:52346926-52346948 CAATGCAAGCCAGGGCTGGCAGG - Intronic
955849476 3:63204306-63204328 CAAGGAATGCCTGGGGATGCTGG - Intergenic
955941740 3:64152579-64152601 CAAGGAAACCCAGTGGCTTCTGG - Intronic
956750826 3:72342572-72342594 CAAGGGAAGCAAGAGGTTGGAGG - Intergenic
957282742 3:78174384-78174406 CAAGGAATGCCAAGGTTTGTTGG + Intergenic
957429614 3:80085117-80085139 TAAGGAATGCCAGGGACTGCTGG + Intergenic
958892135 3:99794757-99794779 CTGGGAAAGCCAGGGGCTCCAGG + Exonic
958966360 3:100563144-100563166 CAAGGAATGCCAAGGATGGCTGG - Intronic
961064985 3:123867570-123867592 CAAGGAATGCCAAGGACTGCTGG + Intronic
961459472 3:127041297-127041319 CAAGGAGAGGCCGGGGCTGCAGG - Intergenic
962212988 3:133494702-133494724 CAAGGCACACCAGGGGCTGCCGG - Intergenic
962321856 3:134396953-134396975 CCAGGAAATCCAGGGGCTTCTGG - Intergenic
962420004 3:135219476-135219498 CAAGGAATGTCAAGGTTTGCTGG + Intronic
962438499 3:135389485-135389507 CAAGGAGAGCCAAGGAGTGCCGG + Intergenic
962454646 3:135553861-135553883 CAAAGAACGCCAGAGATTGCCGG - Intergenic
962501166 3:135994523-135994545 CAAAGAAAGCCAAGGTTTGTTGG - Intronic
962663320 3:137627358-137627380 CAAGGAGTGCCAAGGATTGCTGG - Intergenic
962872229 3:139507400-139507422 CAAAGAATGCCAAGGGTTGCTGG - Intergenic
963045555 3:141100442-141100464 CAAGGAAAGTCAAAGATTGCCGG + Intronic
963339049 3:144012278-144012300 CAAGGAATGCCAAGGATTACTGG + Intronic
963377970 3:144494345-144494367 CAAGGGATGCCAGCGATTGCTGG - Intergenic
963454684 3:145529399-145529421 CTAGGAAAGGCAGTGGTTTCAGG + Intergenic
963704501 3:148669263-148669285 CAAGGAAAGCCAAAGATTGTTGG - Intergenic
963761312 3:149289291-149289313 CCAGGGAACCCAAGGGTTGCTGG + Intergenic
963775602 3:149436095-149436117 CAAGGAATGCCAAGGATTGCCGG - Intergenic
963962550 3:151325285-151325307 CAAGAAAAGAGAGGGGTTGAAGG - Intronic
964221002 3:154344706-154344728 CAAGGAACACCAAGGATTGCTGG + Intronic
964307132 3:155353964-155353986 CAAGGAATGCCAAGGATTACTGG - Intergenic
964481277 3:157140919-157140941 CAAAGAAAACCAAGGATTGCCGG + Intergenic
966004563 3:174993887-174993909 CAAGGAATGCCACGGATTGCAGG - Intronic
967114165 3:186321638-186321660 CAAGGCAAGTCTGGGGTTCCTGG + Intronic
967303803 3:188041749-188041771 AGAGGAAAGCCAGGGTTTTCGGG + Intergenic
967427192 3:189340714-189340736 CAGGGAAAGCCAAGGGCTCCAGG - Intergenic
967835539 3:193959478-193959500 CAAGGAAGGCCAGGGACTGACGG + Intergenic
967846492 3:194047206-194047228 GAAGGGAAGCCAGAGCTTGCAGG + Intergenic
967969037 3:194985745-194985767 CCAGGAAAGCCAGGGCATGAAGG - Intergenic
968730868 4:2268657-2268679 GCAGGAAAGCCTGGGGTCGCAGG - Intergenic
968737366 4:2304370-2304392 CAAGGAGAGGCTGGGGTTGCAGG - Exonic
969120275 4:4903521-4903543 CAGGGAAGCCAAGGGGTTGCTGG + Intergenic
969206770 4:5653040-5653062 TAAGGAACACCAAGGGTTGCTGG - Intronic
969646593 4:8433397-8433419 CAAGGAATGCCAATGATTGCTGG + Intronic
969934316 4:10666101-10666123 CAAGGAAAGCCAGGAGCCTCTGG + Intronic
970112825 4:12657891-12657913 CAAGGAATGCTAGGGATGGCCGG + Intergenic
971108677 4:23557232-23557254 CAAGGAATGCCAGTGTTTGCTGG + Intergenic
971243306 4:24907886-24907908 CAAGGAAAGCCAAAGATTGCTGG - Intronic
971243607 4:24910147-24910169 CAAGGCATGCCAGAGGTCGCTGG - Intronic
971619315 4:28834302-28834324 CAAGGAAAGCCAAGGATGGCTGG + Intergenic
971658768 4:29384995-29385017 CAAGGAATGCCAAGGATTGCTGG - Intergenic
972903164 4:43710388-43710410 CAAGGAATGCCAAAGATTGCTGG + Intergenic
973764753 4:54152943-54152965 CAAGGAATGCCAAGAATTGCTGG + Intronic
973849683 4:54948679-54948701 CCAGCAAAGCCAGGTATTGCTGG + Intergenic
973956598 4:56069071-56069093 CAAGGAATGCCAGGAGCCGCGGG + Intergenic
973975643 4:56259767-56259789 CAGGCAAAGCAGGGGGTTGCTGG + Intronic
974801824 4:66828240-66828262 CCAGGAAAGCCAGCAGTTACAGG + Intergenic
975258799 4:72271974-72271996 CAAGGAATGCCAAGGATTGCTGG + Intergenic
976515066 4:85955530-85955552 CAAGGAACGACAAGGGTTGCTGG - Intronic
977188930 4:93976052-93976074 CAAGGAATGCCAAGTATTGCTGG - Intergenic
977966062 4:103149769-103149791 CAAGGAATGCGAAGGGTAGCTGG + Intronic
978392954 4:108246675-108246697 CAAGGAGAGGCAGGAGTTGGGGG - Intergenic
978610222 4:110529668-110529690 CAAGGAAAGCCAGAAGTTCCTGG - Intronic
978960229 4:114668766-114668788 CATGGTAAGCCTGGTGTTGCTGG + Intronic
979499041 4:121418269-121418291 CAGGGAAAGCCTGGGGCTGAAGG + Intergenic
979871760 4:125832212-125832234 CAAGTAATGTCAAGGGTTGCAGG - Intergenic
980175663 4:129340993-129341015 CAAGGAATGCCAAGGATTGATGG - Intergenic
981913334 4:150007786-150007808 CAAGGAATGCCAAGGATTGACGG - Intergenic
982140813 4:152316050-152316072 CTGGGAGAGCTAGGGGTTGCTGG + Intergenic
982434426 4:155367347-155367369 CAAGGAATGCCATGGACTGCTGG + Intronic
983391211 4:167132733-167132755 CAAGGAATGCCAGGGTTTACGGG - Intronic
983835685 4:172380439-172380461 CAAGGAAACCCAGCTTTTGCTGG - Intronic
984336690 4:178401385-178401407 CAAGGAATACCAAGGATTGCTGG + Intergenic
984420654 4:179516492-179516514 CAAGGAAATCCAAGGATCGCTGG + Intergenic
984859873 4:184228461-184228483 CAAGGAGTGCCAAGGATTGCTGG - Intergenic
985335054 4:188883405-188883427 CAAGGAATGACAAGGGTTGCCGG - Intergenic
985564632 5:609116-609138 AAAGCAAAGGCAGGGGCTGCTGG - Intergenic
985815536 5:2125365-2125387 CAGGGACAGGCAGGGCTTGCAGG + Intergenic
985842467 5:2318787-2318809 CAGGGCCAGCCAGGGGTTGGGGG - Intergenic
985907526 5:2852628-2852650 CAAGGAAGGCCAAGGGTTGTTGG - Intergenic
986802523 5:11276860-11276882 CAAGGAAAGCCAGGGGCCACTGG + Intronic
987051198 5:14147622-14147644 CCTGGAAAGACAGGGGCTGCAGG - Intronic
987101222 5:14592869-14592891 CAAGGAAAGTGAGGGGAGGCTGG - Intronic
987263672 5:16229184-16229206 CAAGGAAAGCCAAGGATGGCCGG - Intergenic
988686604 5:33531157-33531179 CAAGGAATGCCAGTGATGGCCGG + Intronic
989262626 5:39435454-39435476 CAAGGAACACCAAGGTTTGCTGG + Intronic
989445718 5:41526074-41526096 CAAAGAATGCCAAAGGTTGCTGG + Intergenic
990235079 5:53758648-53758670 CAAGGAAACCCAGGGGTCCATGG + Intergenic
990310153 5:54530064-54530086 CAAAGAAAACCAAGGGCTGCTGG - Intronic
991560398 5:67945306-67945328 CAAGGAATGCCAAGGACTGCTGG + Intergenic
991668336 5:69022372-69022394 CAAGGAATGCCAAGGACTGCTGG + Intergenic
992101140 5:73409129-73409151 CATGGTATGCCAGGGATTGCCGG - Intergenic
992367220 5:76105166-76105188 CAAGAAATGCCAGGGATTGCTGG + Intronic
992367641 5:76109706-76109728 CGAGGAATGCCAAGGCTTGCTGG + Intronic
992581141 5:78177806-78177828 CAAGCAATGCCACGGATTGCTGG + Intronic
993106463 5:83606096-83606118 CAAGGAATGCTAAGGATTGCTGG + Intergenic
995756844 5:115514466-115514488 TAAGGAACGCCAAGGATTGCCGG - Intergenic
997039184 5:130231979-130232001 CAAGGAATGCCAAGGGTTGTTGG - Intergenic
997317999 5:132954173-132954195 CATGGATGGACAGGGGTTGCGGG + Intronic
997588382 5:135057991-135058013 CAAGGAAAGCCAAGGGTTGCCGG - Intronic
999094824 5:148968552-148968574 AAAGGAAAGCCAGGGGCTGTGGG + Intronic
1000101476 5:158021161-158021183 CAAGGCAAGCTAGAGGTTCCTGG - Intergenic
1000988557 5:167887910-167887932 CAAAGAATGCTAAGGGTTGCTGG - Intronic
1001154767 5:169263428-169263450 CAAGGAATGCCAAGGGCTGCTGG + Intronic
1001422160 5:171596343-171596365 CAGGGAAGGCAAGGGGTTTCTGG + Intergenic
1001778263 5:174345344-174345366 CAAGGAAAGCCAGGAATTGCCGG - Intergenic
1002335465 5:178474987-178475009 CAAGGAATGGCAGGGATTGCTGG - Intronic
1002922217 6:1580856-1580878 GAAGGAGGGCCAGGGGCTGCAGG - Intergenic
1002993361 6:2258456-2258478 CAAGGAAGGCCAAGGAATGCTGG - Intergenic
1003214366 6:4095580-4095602 CAAGGAATACCAAGGATTGCAGG + Intronic
1003879442 6:10466719-10466741 CAAGGAACGCCAGAGATTGCTGG - Intergenic
1003976941 6:11353450-11353472 CCAGGAATGCCCGGGGCTGCTGG + Intronic
1004220345 6:13741605-13741627 CAAGGAGTGCCAAGGATTGCTGG - Intergenic
1004295153 6:14403348-14403370 CGAGGAACACCAGGGATTGCTGG - Intergenic
1004467943 6:15903229-15903251 CAGGGAATGCCAGGGATTGCTGG + Intergenic
1005311149 6:24560649-24560671 CAAGGAATACCAAGGATTGCTGG - Intronic
1005873357 6:29994034-29994056 AGAGGAAAGCCAGGGGGTGGTGG - Intergenic
1006297626 6:33177017-33177039 CAAGGGAAGCCAGGGCTCCCCGG - Exonic
1006428475 6:33980646-33980668 TAAGGAGAGGCAGGGGCTGCAGG + Intergenic
1007270467 6:40632271-40632293 TAAGGAAAGTCAGGGGTTAGAGG + Intergenic
1007364828 6:41384031-41384053 CAAGGAAGGGCAAGGGTTGTTGG - Intergenic
1007398320 6:41589776-41589798 CAAGGAGAGCGAGCGGCTGCAGG + Exonic
1007486503 6:42184385-42184407 GAAGAAAAGGCAGGAGTTGCCGG - Exonic
1007512365 6:42383434-42383456 CTAGGAAAGCCAGGGTTGGGAGG - Intronic
1008731057 6:54483108-54483130 CAAGGAACACAAAGGGTTGCTGG + Intergenic
1009188560 6:60602141-60602163 CAAAAAAACGCAGGGGTTGCAGG + Intergenic
1009533642 6:64852765-64852787 CAAGGAACACCAAGGTTTGCTGG + Intronic
1009969939 6:70615443-70615465 CAAGGAATGCCAAAGATTGCTGG - Intergenic
1010825892 6:80474442-80474464 CAAGGAATGCCAAGCCTTGCTGG + Intergenic
1010977201 6:82329346-82329368 CAAGGAACCCCAAGGCTTGCTGG + Intergenic
1011126178 6:84010271-84010293 CAGGGGATGCCAAGGGTTGCTGG + Intergenic
1011493871 6:87919953-87919975 CAAGGAACACCAGTGGTGGCCGG - Intergenic
1011591552 6:88974979-88975001 CAAGGAATGCCAAGGATTGCTGG + Intergenic
1013086124 6:106859350-106859372 CAAGGAACACCAAGGCTTGCTGG + Intergenic
1013617687 6:111860024-111860046 CAAGGAAAGCCAAGGTTTGCCGG + Intronic
1013748512 6:113373943-113373965 GAAGACAAGCCAGGGGATGCAGG + Intergenic
1013980490 6:116121823-116121845 CAAGGAGAGCCAGGGTTGCCAGG - Exonic
1014536190 6:122615788-122615810 CAAGGGATGCCAAGGTTTGCTGG + Intronic
1014591530 6:123277642-123277664 CAAGGAACACCAAGGATTGCTGG + Intronic
1014597969 6:123369134-123369156 CAAGGAATGCCAAGGGTTCCTGG - Intronic
1014736634 6:125101672-125101694 CAAAGAATGCCAAGGATTGCTGG - Intergenic
1014784206 6:125599202-125599224 CAAGGAAGGCCAAGGATTGGAGG + Intergenic
1015414658 6:132934625-132934647 CGAGGAATGCCAAGGGTTGTGGG + Intergenic
1015546982 6:134371312-134371334 CAAGGAGTGCCAAGGGTTGTCGG - Intergenic
1016706143 6:147110540-147110562 CAAGGAATGCCAGGGATTGCCGG + Intergenic
1016779807 6:147944871-147944893 CAAGGAATGCCAAGGCCTGCTGG - Intergenic
1017931429 6:158958991-158959013 CCAGCAAAGCCAGGGGGTGGGGG - Intergenic
1018230470 6:161670413-161670435 CAAGGAATGCCAAGGGTTGTTGG - Intronic
1018984767 6:168628073-168628095 CAAGGAAGGCAAGGGCTTGTGGG - Intronic
1019644258 7:2120738-2120760 CCAAGAAAGACAGGGGGTGCGGG + Intronic
1020476996 7:8607984-8608006 CAAGGAATGCCAAGGATTGGTGG + Intronic
1020950816 7:14674769-14674791 CAAAGAATTCCAGGGATTGCTGG + Intronic
1021655567 7:22870392-22870414 CAAGGACAGACAAGAGTTGCTGG + Intergenic
1021979620 7:26041475-26041497 CAAGGAACACCAGGGTTTACAGG + Intergenic
1022719507 7:32930383-32930405 AAAGGAAAGCAAGAGGTTGCAGG + Intergenic
1022963131 7:35449213-35449235 TAATGACAGCCAGGGGTTCCTGG - Intergenic
1023393327 7:39730953-39730975 CAAGGAATGCCAAGGGTTGCTGG + Intergenic
1023900571 7:44474986-44475008 AATAGAAAGCCAGGGGTTGAGGG - Intronic
1024972429 7:55082904-55082926 CAAGGAATGCCAAGGGCTGCTGG - Intronic
1026317415 7:69239220-69239242 GATGGAAAGGCAGGGGTTACAGG - Intergenic
1027054855 7:75042979-75043001 CAAGGAGTGCCAGTGGTTCCCGG + Exonic
1027251933 7:76404322-76404344 GAAGGAAAGACAGGGCTTGGGGG + Exonic
1027836545 7:83251223-83251245 CAAGGATTGCCAGGGGTTAGGGG - Intergenic
1029935087 7:104416216-104416238 CAAGGAATTCCAAGGATTGCTGG + Intronic
1030663216 7:112245642-112245664 TAAGGAATGCCAAAGGTTGCCGG - Intronic
1031155404 7:118104483-118104505 CATGGAATGCCAAGGATTGCTGG + Intergenic
1031562536 7:123255743-123255765 CATGGAAAGCCTGGGGTCCCAGG + Intergenic
1033026638 7:137780886-137780908 CAAGGAGAGCCAGTGGTTAGTGG + Intronic
1034191110 7:149214176-149214198 CAAGGAGTGCCAGAGGTTCCTGG - Intronic
1034310747 7:150085527-150085549 CAAGGAAATCTAGGGGTTTGTGG - Intergenic
1034542736 7:151769502-151769524 CAAGGAACCCCAGGGTTTGTGGG + Intronic
1034796094 7:154015104-154015126 CAAGGAAATCTAGGGGTTTGTGG + Intronic
1035074064 7:156166819-156166841 CAAGGAAAACCAGGGAAGGCGGG - Intergenic
1035122530 7:156580098-156580120 CAAGGACAGCCAGAGGATGGGGG + Intergenic
1036093053 8:5690423-5690445 CAAGAAATGCCAAGGGTTGCTGG + Intergenic
1036097106 8:5736677-5736699 CACGGCAAGCCAGGGGCGGCCGG - Intergenic
1036619421 8:10414752-10414774 CAGGGAAAGCCAAGGATAGCAGG - Intronic
1037651035 8:20838663-20838685 CAAGGAAGCACAGGTGTTGCTGG - Intergenic
1037932479 8:22890173-22890195 CTAGGAAATCCAGGGGCTGAAGG + Intronic
1038002702 8:23404475-23404497 CAAGGAGGGCCAGGGTTTTCGGG - Intronic
1039038545 8:33385203-33385225 CCTGGAAAGCCTAGGGTTGCAGG - Intronic
1039793171 8:40891530-40891552 CAGGGAACGCCAGGGGCTGGTGG - Intronic
1039864204 8:41487182-41487204 CAAGGAATTCCAAGGATTGCTGG + Intergenic
1040068734 8:43171548-43171570 ATAGGAAAGCCAGGGTTTGATGG + Intronic
1040455349 8:47592560-47592582 CAAGGAAACCCAGGGTTTGCTGG - Intronic
1040486925 8:47882318-47882340 CTAGGAAAGCCAGGAGAAGCTGG - Intronic
1040581328 8:48700995-48701017 CCAGGAAAGCAATGGGTGGCTGG - Intergenic
1040804787 8:51382235-51382257 CCAGGGAAACCAAGGGTTGCCGG + Intronic
1040914040 8:52550708-52550730 CAAAGAATGCCAAGGATTGCTGG - Intronic
1041565584 8:59274542-59274564 CTAAGAAAGCCACGGGTTCCAGG - Intergenic
1042144320 8:65712310-65712332 GAAGGGAAGGCAGGGGTTGGGGG - Intronic
1042383888 8:68150912-68150934 CAAGGAATGCCAAGGACTGCTGG - Intronic
1042711237 8:71719739-71719761 CAAGGAAAGCCAAGGATTGCCGG - Intergenic
1042795069 8:72652988-72653010 CAAGGAACACCAAGGATTGCTGG - Intronic
1044393552 8:91681897-91681919 CAAGGAATGCCAAAGATTGCTGG + Intergenic
1044627690 8:94250391-94250413 CCAGGAAAGCCAGGCGCTTCTGG - Exonic
1045176915 8:99735500-99735522 CAAGGAACACCTGGGATTGCTGG + Intronic
1045687117 8:104723647-104723669 CAAGCATATCCAGGGGTTGCTGG - Intronic
1046204045 8:110965982-110966004 CAAGGAATGCCAAGGATTGCTGG + Intergenic
1046220910 8:111213179-111213201 CAAGGAAAATCAAGGATTGCAGG + Intergenic
1046951585 8:120024647-120024669 CAAGGAGTGCCAGGGATTGTGGG + Intronic
1047324659 8:123824823-123824845 CAAGGAACGCCAGGGATTTATGG + Intergenic
1047680430 8:127248984-127249006 CAAGGAAATCAAAGGATTGCGGG - Intergenic
1048019439 8:130524962-130524984 CAAGGAATGCCAGGAATTCCTGG + Intergenic
1048020411 8:130533294-130533316 CAAGGAATGTCAAGGATTGCTGG + Intergenic
1048340218 8:133533098-133533120 CATGGAAATCCAGGGATTCCAGG - Intronic
1048491757 8:134900756-134900778 CAAGGAATGCCAGGGATTGCTGG - Intergenic
1049469316 8:142768404-142768426 CAAGCAATGACAGGGGATGCAGG + Intronic
1049536853 8:143186462-143186484 CAAGGAAGGGCAGGGTTTGGAGG - Intergenic
1049603922 8:143520391-143520413 CCAGGAAAGCCTGGGGGTGGTGG + Intronic
1049894542 9:101178-101200 CAAGGAATGTCAGGGCTTGCAGG + Intergenic
1050070117 9:1801608-1801630 CAAGGAACACAAAGGGTTGCTGG - Intergenic
1050092934 9:2033767-2033789 CCAGGAATGCCAAGGATTGCTGG - Intronic
1051344917 9:16143141-16143163 CAAGGAAAGCCAGGGCAGGCAGG + Intergenic
1052294480 9:26881876-26881898 CAAGGAAATCCAGGGTGTGGTGG + Intronic
1053426916 9:38016224-38016246 CAAGGAGAGGCAGGGGAGGCAGG + Intronic
1053735748 9:41101168-41101190 CAAGGAATGTCAGGGCTTGCAGG + Intergenic
1054692629 9:68330230-68330252 CAAGGAATGTCAGGGCTTGCAGG - Intronic
1055427772 9:76213836-76213858 CAAGGAAAGCAAAGGGTTGAAGG - Intronic
1055554381 9:77460325-77460347 CGAGGAACACCAAGGGTTGCCGG + Intronic
1055630199 9:78215917-78215939 CAAGGAATGCCAAGGATTACTGG + Intergenic
1055961881 9:81828302-81828324 TAAAGGAAGCCAGGGGTAGCTGG + Intergenic
1056107503 9:83361857-83361879 CAAGGAAGGCCAAGGACTGCAGG + Intronic
1056629417 9:88280976-88280998 GGAGGGAAGCCTGGGGTTGCGGG + Intergenic
1056782373 9:89560416-89560438 CAAGGAAAGACCTGGGCTGCCGG + Intergenic
1056979060 9:91291088-91291110 CAAGGAATGCCAAGGGTTGTCGG - Intronic
1057694115 9:97311427-97311449 CAAGGAATAGCAGCGGTTGCTGG + Intronic
1057916527 9:99059918-99059940 CCAGGACAGCCAGGGCTTCCCGG + Exonic
1058930067 9:109710078-109710100 CAAGGAATGCCAAGTATTGCTGG + Intronic
1060032627 9:120228579-120228601 CAAGGAAACCCTTTGGTTGCAGG - Intergenic
1060621105 9:125067502-125067524 CAAGGAACGCCAAGGATTGCTGG + Intronic
1060884558 9:127141199-127141221 CAGGGAATGCCAGGGGTTGTGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061674350 9:132207384-132207406 CCAGGAACGCCAGAGGCTGCCGG - Intronic
1062130045 9:134887608-134887630 CAAGGAAAGACAGAGGTTTGAGG - Intergenic
1062160860 9:135078984-135079006 CAAGGAAAGAATGGGGTTGGGGG - Intronic
1062518094 9:136945996-136946018 CAAGGTGAGGCAGGGGCTGCAGG + Exonic
1185798044 X:2983763-2983785 CAAGGAATGCCAAGTATTGCCGG - Intergenic
1186076744 X:5887792-5887814 CAAGGAGAGGCAGGGGGTGCTGG - Intronic
1186193347 X:7087308-7087330 CAAGGAAAGCTAAGGGTGGCCGG + Intronic
1186409754 X:9336427-9336449 CAAGGAGTGCCAAGGATTGCTGG + Intergenic
1186433101 X:9521322-9521344 CAGGGAAAGCCAGAGGTGGTGGG + Intronic
1186711522 X:12202856-12202878 AAAGGAATGCCAAGGATTGCTGG + Intronic
1187137442 X:16561676-16561698 TAAAGAAAGGCAGGGGCTGCAGG + Intergenic
1187544227 X:20231837-20231859 CATGGAATGCCAAGGATTGCTGG + Intronic
1188084658 X:25888614-25888636 CAAGGAATGCCAAAGATTGCTGG + Intergenic
1188323880 X:28775339-28775361 CAAGGAAAGCCAAAGATTGCTGG - Intronic
1189158542 X:38785783-38785805 CAAGGAAAGCTAAAGATTGCTGG + Intergenic
1189207310 X:39253038-39253060 CAAGGAATGCCAAGGGATACTGG - Intergenic
1189305486 X:39983809-39983831 CGAGGAATGCCAAGGATTGCTGG - Intergenic
1189505007 X:41604453-41604475 CAAGGAATGACAAGGATTGCAGG + Intronic
1189783565 X:44539504-44539526 CAAGGAATGACAAGGATTGCTGG + Intronic
1189868229 X:45353666-45353688 CAAGGAATGTCAAGGATTGCTGG + Intergenic
1190461820 X:50684319-50684341 CAAGGAATGCCTAGGGTTGCTGG + Intronic
1192909992 X:75593311-75593333 CAAGGAACGCCAAGGATTGCCGG + Intergenic
1194739540 X:97556550-97556572 CAAGGAATGCCAAGGTTTGTTGG - Intronic
1196802662 X:119557731-119557753 CAAGGAATGCCAAGGATTGCTGG + Intronic
1196963839 X:121033634-121033656 CAAGGAATGCCAAGGATTGCTGG + Intergenic
1198547448 X:137707671-137707693 CAAGGAAAACCAAGGATTGCTGG + Intergenic
1199107207 X:143884127-143884149 CAAGGAAACCCAGCGTTTGCTGG + Intergenic
1199165423 X:144667873-144667895 CAAGAAAGGCCAGGGGTGGAGGG + Intergenic
1199491126 X:148401997-148402019 CAAGGAATGCCAAGGATTGCTGG - Intergenic
1200153018 X:153960461-153960483 CAAGGGCAACCAGGGGTGGCGGG - Intronic
1201518534 Y:14846174-14846196 CAAGGAGAGGCAAGGGGTGCTGG + Intergenic
1201565279 Y:15358816-15358838 CAAGGAAAGCTAAGGGTGGCCGG + Intergenic