ID: 1184803165

View in Genome Browser
Species Human (GRCh38)
Location 22:46774722-46774744
Sequence CAGGGGCCCCGAAGCCGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803165_1184803180 30 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803165_1184803176 18 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803165_1184803179 29 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803165_1184803177 19 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803165 Original CRISPR CAGGGGCCCCGAAGCCGGAA AGG (reversed) Intronic
900569869 1:3352955-3352977 CATGGGCCCCGAAGCCTGCAGGG - Intronic
901539990 1:9909773-9909795 CAGGGGCCCAGAGGTCGGGAGGG + Intronic
902206064 1:14868978-14869000 CCGGGGCCCCCAAGCTGGAGTGG - Intronic
902820701 1:18941567-18941589 CAGGGGCCCAGAAGGAGGAACGG + Intronic
905208926 1:36359872-36359894 CAGAGGCCCAGCAGCAGGAAAGG - Intronic
906102283 1:43271333-43271355 GAGGGGCCAGGAAGCCTGAATGG - Intronic
913118455 1:115717960-115717982 CAGGGACTCAGAAGCTGGAATGG + Intronic
922792611 1:228318425-228318447 CAGGGGCCCAGAAGCTTAAAGGG - Intronic
923591892 1:235327507-235327529 CGAGGGCCCCGGAGGCGGAACGG + Intronic
924614969 1:245605328-245605350 CTGGAGCCCCCAAGCCTGAAAGG + Intronic
1069706162 10:70460127-70460149 CAGGGGCCCAGACGGCGGAAGGG - Intergenic
1075253865 10:120908479-120908501 CAGGCTCCCAGAAGCAGGAAGGG - Intronic
1077014424 11:393473-393495 CAGGGTCCCAGAAGCCAGAGAGG + Intronic
1082801249 11:57416465-57416487 CAGGGACCCAGAATCAGGAAAGG - Intronic
1083766793 11:64845078-64845100 CCGCGGCCCCGGAGCCGGATGGG + Intergenic
1083793970 11:65003857-65003879 CAGGGTCCCAGGAGCTGGAAAGG + Intergenic
1089376225 11:117996567-117996589 CAGGGGCCCCACAACTGGAAGGG + Intronic
1089505179 11:118957765-118957787 CAGGGGCCCCGAGGGCGCACGGG - Intronic
1089757874 11:120699801-120699823 CAGGGACCCAGAGGCAGGAATGG + Intronic
1090467495 11:126947905-126947927 CAGGGGCCATGATGCTGGAATGG + Intronic
1090978355 11:131694912-131694934 CAGCGCCCTCGCAGCCGGAATGG + Intronic
1092189658 12:6509729-6509751 CAGGGGCCCCTGAGCTCGAAAGG - Exonic
1094195745 12:27748153-27748175 CAAAGGCCTTGAAGCCGGAAAGG - Intronic
1102016300 12:109650138-109650160 CAGAGGCCCTGAGGCAGGAAGGG + Intergenic
1104820331 12:131673279-131673301 CAGGGGCTCCCCAGCCGGAGTGG + Intergenic
1107624937 13:42272354-42272376 GGGCGGCCCCGAAGCCAGAAGGG - Intronic
1110924912 13:81138765-81138787 CAGGGGCCCCGTGGCCAGCAGGG - Intergenic
1112050603 13:95641727-95641749 CAGGGGCCCCGAAGCCGCGCTGG + Exonic
1113876406 13:113597482-113597504 CAGGGGTCCCGGGGCCTGAACGG + Intronic
1117920370 14:60721998-60722020 CAGGGGCCCAGAAGCGGCAAGGG + Intronic
1118425128 14:65652229-65652251 CAGTGGACCAGAAGCTGGAAAGG + Intronic
1118591742 14:67407021-67407043 GAGGGGCCCATAAGCTGGAATGG + Intronic
1118644097 14:67820150-67820172 CAGGCTGCCCGAAGCGGGAAGGG - Intronic
1119331837 14:73800662-73800684 CAGGGACCCTGCAGCAGGAAAGG - Intergenic
1119477566 14:74939928-74939950 CAGGAGCCTCGCAGCAGGAATGG - Intergenic
1122358342 14:101138056-101138078 CAGAAGCCCAGAAGCTGGAATGG + Intergenic
1122651268 14:103228467-103228489 CAGGGGCCCAGGAGACAGAATGG + Intergenic
1122784083 14:104155916-104155938 CAGGGGCACCGAGGCTGGAGGGG - Intronic
1122836676 14:104434063-104434085 CAGGCGCCCCGGAGCTGGAGGGG + Intergenic
1124071244 15:26394891-26394913 CTGGGGCCCAGAAGCAGGCAGGG - Intergenic
1128830377 15:70763206-70763228 CAGGGCCGCCGAAGCCGAACTGG + Intronic
1129687095 15:77692756-77692778 CAGGGGCCCTGGAGGCGGGAGGG - Intronic
1132371889 15:101305356-101305378 CTGGGGCCCCGCATCAGGAAAGG + Intronic
1142354649 16:89596787-89596809 CTGGGGCCCCCAAGGCCGAAGGG + Exonic
1142748388 17:1972516-1972538 GAGGGGCCGCAAAGCGGGAAGGG - Intronic
1143033697 17:3982448-3982470 CCGGGGCTCCGCAGCTGGAAAGG - Intergenic
1145112014 17:20172206-20172228 CAGGAGCCCTGAGGCCAGAAGGG - Intronic
1151724775 17:75877621-75877643 CAGGGGACCTGAAGCCGGGCCGG - Intronic
1152301375 17:79496952-79496974 CAGGGGTCCCGAGGCAGGCAAGG - Intronic
1152626796 17:81391349-81391371 CAGGGGCCCCTAGGCTGAAAGGG + Intergenic
1152737424 17:82004335-82004357 CAGATGCCCCGAAACTGGAAGGG - Intronic
1160775346 19:852804-852826 CAGAGGCCCCGTGGCCGGGAGGG + Intronic
1160909033 19:1466369-1466391 CAGGGGCCCGGAAGCAGGCCTGG + Exonic
1160916142 19:1497560-1497582 CAGGGGCCCCGAGGACGGGAGGG - Exonic
1161067773 19:2247104-2247126 CAGGGGACCCCAAGCCCGATGGG - Intronic
1161337913 19:3724161-3724183 CAGGGCCCCCGAACCCAGAGTGG - Intronic
1163768964 19:19179265-19179287 CAGGGGGCCTGAAGCAGGAGGGG - Intronic
1165121257 19:33560234-33560256 CAGGGGCCCCGAAGATGGGAAGG + Intergenic
1166666338 19:44682666-44682688 CAGGAGCCCCGAAGCCGGGGTGG + Intronic
1166960024 19:46491693-46491715 CAGGGATCCCGAAGCAGCAAAGG + Exonic
1167015378 19:46837991-46838013 CAAGGGCCCCCAGGCTGGAAGGG - Intergenic
1168637107 19:58004707-58004729 CAAAGGCCCTGAAGCAGGAATGG - Intronic
932343705 2:70982327-70982349 CAGGGGCCCCAGGGCAGGAAAGG - Intronic
934554255 2:95278997-95279019 CAGTGGCCCAGCAGCCGGAAGGG + Exonic
948859855 2:240747518-240747540 CAGGGGCCCCAAAGCAGCCACGG + Intronic
1169265130 20:4162814-4162836 CAGGAGCCAGGAAGCAGGAATGG - Intronic
1170571508 20:17635383-17635405 CAGGGGCCCAGAACCCAGACGGG + Intronic
1172357811 20:34292055-34292077 CAGAGGCCCTGAGGCAGGAATGG - Intronic
1172781840 20:37441356-37441378 CAGGGCCCCAGGAGGCGGAAGGG - Intergenic
1173670442 20:44795087-44795109 CAGGGGCCCTGAGGCAGGAGTGG - Intronic
1173687851 20:44936686-44936708 CAGGGGCGCCGCAGCCAGCATGG - Exonic
1173736198 20:45363348-45363370 CGGGGGCCGCGCAGGCGGAATGG + Intronic
1175138826 20:56844476-56844498 CAGAGGCCTGGAGGCCGGAAAGG - Intergenic
1175943223 20:62547403-62547425 CAGGAGCCCGGAGGCGGGAAGGG - Intergenic
1176048404 20:63104146-63104168 CAGGAGCCCCCAAGCCAGACTGG - Intergenic
1178104093 21:29299148-29299170 AAGTGGCCGCGACGCCGGAAGGG + Intronic
1180127346 21:45801374-45801396 CAGGGGCCCTGCAGCCAGCAGGG - Intronic
1182320950 22:29478461-29478483 CAGGGGTCCCTAAGCAGGAGGGG + Intergenic
1183829035 22:40408382-40408404 CAGGCGCCCCCAAGCAGGGATGG - Exonic
1183834607 22:40441938-40441960 CAGGGGCCCCAGGGCCAGAATGG + Intronic
1184099580 22:42335093-42335115 CAGGGCCCCGGGAGCAGGAATGG - Intronic
1184759511 22:46536819-46536841 CACGGGCTCCGCAGCCGGGAAGG + Exonic
1184803165 22:46774722-46774744 CAGGGGCCCCGAAGCCGGAAAGG - Intronic
1184894514 22:47399393-47399415 CAGGGCCCCAGAAGTCTGAAAGG + Intergenic
1185269305 22:49921602-49921624 CAGAGGCCCTGCAGCGGGAATGG + Exonic
952957740 3:38567747-38567769 CAGAGGCCCTGAAGTCGGACAGG - Intronic
954442325 3:50528520-50528542 CAGAGGCCCAGAAGGTGGAATGG + Intergenic
958004260 3:87792661-87792683 CAGGCGCCCCGGACCCGCAAGGG + Intergenic
969131878 4:4996101-4996123 CAGAGGCCCCGAAGCCAGCCAGG - Intergenic
978282578 4:107035716-107035738 CTGGGTCCCCGAACCAGGAAGGG - Exonic
984747907 4:183240917-183240939 CAGGGGCCGGGAATGCGGAAGGG - Intronic
985671451 5:1208966-1208988 CAGGGGCACCGAGGCCGGCAAGG - Intronic
985786696 5:1899323-1899345 CAGTGGCCCCGAAGCTGCAGTGG + Intergenic
986456785 5:7927741-7927763 CAGGCGCCCCAAAGCTAGAAAGG - Intergenic
992461018 5:76960306-76960328 CAGGGGCTCAGAGGCAGGAATGG + Intronic
998833393 5:146182441-146182463 CAGGGGCCCTGGAGCCGGACTGG - Intronic
1001940443 5:175736215-175736237 CAGGGCCCCCAAAGCCAGAGTGG + Intergenic
1004338233 6:14783852-14783874 CAGTGGCCCCGCACTCGGAACGG - Intergenic
1005026477 6:21467215-21467237 CAGGGACCCCGAAGCCACAGAGG - Intergenic
1005148633 6:22722058-22722080 GAAGGGCCCTGAAGCCTGAAGGG + Intergenic
1006180681 6:32151847-32151869 CAGGGTCCCTGCAGCCGGAGTGG + Exonic
1007398654 6:41591334-41591356 CTGGGGCCCAGAAGGTGGAAGGG - Intronic
1007422468 6:41727994-41728016 CTGGGGCCCAGAAGGTGGAAAGG + Intronic
1013369287 6:109455719-109455741 CGGCGGCTCCGAAGCCGGGAGGG + Exonic
1016923626 6:149318355-149318377 CAGGGGCGCCGACGCAGGGAGGG - Intronic
1019128804 6:169859012-169859034 CAGTGGCCGGGAAGCTGGAAGGG + Intergenic
1026018810 7:66692955-66692977 CAAGGCCCCCCATGCCGGAAGGG + Intronic
1029983244 7:104898651-104898673 TATGGGCCACGAAGCTGGAAAGG + Intronic
1032507409 7:132446031-132446053 CAGGAGCCCCGATGGAGGAAGGG + Intronic
1036578848 8:10054448-10054470 CAGCGGAGCCGCAGCCGGAACGG - Exonic
1038503408 8:28063853-28063875 CAGGAGCCCAGGAGCTGGAAGGG - Intronic
1048805958 8:138241400-138241422 GAGGGGACCTGAAGCCAGAATGG - Intronic
1049196966 8:141320990-141321012 CTGAGGCCCCAAAGCAGGAAGGG + Intergenic
1049426813 8:142541422-142541444 CAGGGGCAGCGATGCAGGAAGGG + Intronic
1049622675 8:143605661-143605683 CAGGGGCACAGAGGCAGGAAAGG + Exonic
1050310226 9:4345164-4345186 CAGGGGCCCAGTGGCAGGAAAGG - Intronic
1051816149 9:21107599-21107621 GAGTGGCCCCGTAGCTGGAAAGG + Intergenic
1052988651 9:34505821-34505843 CAGGGGAGCCGAAGCTGGAGAGG - Intronic
1054708095 9:68483442-68483464 CAAGGGCCCAGAGGCAGGAAAGG + Intronic
1060634537 9:125189598-125189620 CGGGCGCCCCACAGCCGGAAGGG + Exonic
1061009394 9:127946210-127946232 CAGAGGCCCCGAGGCTGGAAGGG + Intronic
1061392905 9:130327626-130327648 CAGGGCCCCAGAAGCCTGGAAGG + Intronic
1062489558 9:136798761-136798783 CACGGGCCCCAAAGCCAGAATGG + Intronic
1062556741 9:137116213-137116235 CAGGGCCTCCCAAGCCGGGAAGG + Intergenic
1192325453 X:70128210-70128232 CAGTGACCTCGAAGCCGCAAAGG + Intergenic