ID: 1184803166

View in Genome Browser
Species Human (GRCh38)
Location 22:46774727-46774749
Sequence AATATCAGGGGCCCCGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803166_1184803176 13 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803166_1184803180 25 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803166_1184803177 14 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803166_1184803179 24 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803166 Original CRISPR AATATCAGGGGCCCCGAAGC CGG (reversed) Intronic
903604132 1:24562619-24562641 AAGAGCAGGGGACCTGAAGCAGG - Intronic
906218815 1:44061203-44061225 GATCTGAGGGGCCCCGAGGCAGG - Intergenic
912927959 1:113929855-113929877 GAGATCTGGGGCCCCGCAGCCGG - Exonic
1066212755 10:33256088-33256110 AATTTCAGAGGCTCCCAAGCAGG + Intronic
1067668269 10:48296887-48296909 AATAGCAGGTCCCTCGAAGCAGG - Intergenic
1067705858 10:48606018-48606040 ATTATCAGGGGCACAGAGGCAGG - Intronic
1071532507 10:86400727-86400749 CATATCCGGGTCCCCGAGGCGGG + Intergenic
1076316204 10:129543544-129543566 AACATCAAGAGCACCGAAGCTGG - Intronic
1076476553 10:130757728-130757750 AATCACAGGGGCCCTGAAACTGG - Intergenic
1077480532 11:2812459-2812481 AAGATCAGGGGCCACAGAGCCGG - Intronic
1084093971 11:66898016-66898038 AAAAACAGGGGCCCTGGAGCTGG - Intronic
1095440583 12:42235771-42235793 AATGTCAGGGGCCCCCATGTGGG + Intronic
1105340486 13:19519009-19519031 AGTATAAGGGGCCCCCAAGACGG - Intronic
1112408935 13:99145608-99145630 AATATCTGGGGCCCCCAGGGTGG + Intergenic
1117021813 14:51578779-51578801 AAGATCAGAGGCACCAAAGCAGG + Intronic
1120969847 14:90198177-90198199 AATGCCTGGGGCCCCGAAGGAGG - Intergenic
1137830464 16:51538831-51538853 AATAGCAGTGTCCCTGAAGCTGG - Intergenic
1139714054 16:68798555-68798577 AAGATGAGGTGCCCCAAAGCAGG + Intronic
1140738829 16:77923471-77923493 AAACTCAGGGGCCCAGAATCAGG + Intronic
1142514279 17:416869-416891 AATGACGGGGGCCCCGGAGCAGG + Intronic
1150445867 17:65226509-65226531 CATAGCAGCGGCCCCAAAGCTGG - Intronic
1160431679 18:78817144-78817166 AGCATCAGGGGTCCCGCAGCAGG - Intergenic
1162489977 19:10986248-10986270 GACATCTGGGGCCCCGAAGACGG - Exonic
1163638467 19:18448837-18448859 GTTCTCCGGGGCCCCGAAGCAGG - Intronic
1165121254 19:33560229-33560251 AGCCTCAGGGGCCCCGAAGATGG + Intergenic
936484731 2:112916273-112916295 AAGAACAGGGGCCCCCAGGCTGG - Intronic
945863227 2:215147753-215147775 AATATCAGGGGCCAAGCTGCTGG - Intergenic
1171166254 20:22974620-22974642 AATATAAAGGGCCCAGAAGAGGG + Intergenic
1175541477 20:59750719-59750741 AATATCAGGGACCGGGCAGCAGG + Intronic
1178520291 21:33283698-33283720 CATATAAGGGGCCCTGAATCAGG - Intronic
1180561395 22:16617555-16617577 AGTATAAGGGGCCCCCAAGACGG + Intergenic
1181557656 22:23681210-23681232 ACCATCAGGGGCCCCGGGGCAGG - Intergenic
1183534263 22:38387453-38387475 AGTATAAGGGGCCCCCAAGACGG - Intronic
1184086641 22:42269932-42269954 GCTGCCAGGGGCCCCGAAGCAGG + Intronic
1184803166 22:46774727-46774749 AATATCAGGGGCCCCGAAGCCGG - Intronic
961136789 3:124518894-124518916 ATTATCAGTGGCCCCTAATCTGG + Exonic
966925017 3:184639101-184639123 AATATCAGGGGTGCAGGAGCAGG + Intronic
968622326 4:1609361-1609383 CATATCAGAGGCCCCGGGGCAGG - Intergenic
969310946 4:6353004-6353026 AACATCTGGAGCCCCGGAGCTGG + Intronic
973166858 4:47088657-47088679 CATAACAAGGGCTCCGAAGCAGG + Intronic
980624245 4:135352430-135352452 AATATCAGGTGCTCCAAATCTGG + Intergenic
988245098 5:28670107-28670129 AACATCAGGGGCCAGGAAGCTGG + Intergenic
989680869 5:44028406-44028428 ATTCTCTGGGGCCCCAAAGCTGG + Intergenic
1000342958 5:160291571-160291593 CATACCAGGTGCCCCGTAGCTGG - Intronic
1002779367 6:354430-354452 CAGATCAGGGGCCTCCAAGCGGG + Intergenic
1031147676 7:118015054-118015076 AATTCCAGGGGCCCAGAAGCTGG - Intergenic
1032682874 7:134203498-134203520 AATACCAGGGGCCCTCAACCTGG - Intronic
1037199174 8:16229706-16229728 AAGATCAAGGGACCAGAAGCTGG - Intronic
1041462692 8:58129480-58129502 ACCAACAGGGGCCCCGAAGGGGG - Intronic
1045704457 8:104904871-104904893 ATTATCAGGGGACCCCAAGATGG - Intronic
1047891574 8:129317468-129317490 TATATCAGGGGCCAGGAATCTGG - Intergenic
1051910511 9:22150025-22150047 AATTTCAGGGAACCTGAAGCAGG - Intergenic
1052496541 9:29233010-29233032 AATATCAGCGGCCCCCAGTCAGG - Intergenic
1052988652 9:34505826-34505848 AAGCTCAGGGGAGCCGAAGCTGG - Intronic
1058637636 9:107051761-107051783 AAGATCAGGGGCCAAGCAGCAGG + Intergenic
1193326338 X:80182156-80182178 GATATAAGGGGCCCAGAGGCAGG - Intergenic
1198814238 X:140570503-140570525 AAAATTAGGGGCCCGGAAGATGG - Intergenic
1202591693 Y:26491551-26491573 AGTATGAGGGGCCCCCAAGACGG + Intergenic