ID: 1184803169

View in Genome Browser
Species Human (GRCh38)
Location 22:46774739-46774761
Sequence CGGGGGCCCAGAAATATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803169_1184803176 1 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803169_1184803177 2 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803169_1184803180 13 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803169_1184803179 12 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803169 Original CRISPR CGGGGGCCCAGAAATATCAG GGG (reversed) Intronic
901851640 1:12019706-12019728 CGGGGCCGCAGAAGTAACAGAGG - Intronic
906409329 1:45566464-45566486 AGGGGGCTCAGAAATATAACAGG - Intronic
912419361 1:109532694-109532716 CGGGCGCCCAGAAACCCCAGGGG + Intergenic
915963122 1:160283557-160283579 CTGGGGCCCCGAAGCATCAGGGG + Exonic
919814891 1:201431100-201431122 CCTGGGGCCAGAAATGTCAGGGG + Intergenic
919942018 1:202294526-202294548 CAAGGGCCCAGACATATGAGTGG - Intronic
1063408753 10:5820434-5820456 CCGGGGCCCAGCAATAGCTGTGG - Intronic
1064529553 10:16293958-16293980 CTGTGATCCAGAAATATCAGAGG - Intergenic
1065210362 10:23396669-23396691 CTTGGGCCCACAAATAACAGGGG + Intergenic
1067723244 10:48745908-48745930 TGGGGGCCAGGAAATAACAGGGG + Intronic
1068687990 10:59889026-59889048 CTGGGGCCCTTGAATATCAGGGG + Intronic
1071478200 10:86042549-86042571 TGGGGGCCTGGAAATAGCAGGGG + Intronic
1073069424 10:100783861-100783883 CGGGTGGCAAGACATATCAGAGG + Intronic
1073662761 10:105495461-105495483 TGTGGGCTAAGAAATATCAGGGG - Intergenic
1076850053 10:133088278-133088300 CGGGGGCCCTGGATTATCCGTGG - Intronic
1078582767 11:12551531-12551553 CAGAGGCCCAGAGATACCAGAGG - Intergenic
1081447600 11:43145682-43145704 ATGGGGCCCAGAAATGTCAGGGG - Intergenic
1081684662 11:45033899-45033921 AGAGAGCCCAGAAATAACAGTGG + Intergenic
1093425431 12:19023202-19023224 TGGGGGCCTACAAATAACAGTGG - Intergenic
1095910152 12:47418025-47418047 TGGGGACCCAGACACATCAGAGG + Intergenic
1103719470 12:122965744-122965766 CAGAGGCCCAGAAATAAAAGAGG + Intronic
1110789283 13:79569560-79569582 CAGCAGCCCAGAAATATCAAAGG + Intergenic
1111919033 13:94391368-94391390 CGGGGTCCCAGAGAGATCACAGG + Intronic
1118909236 14:70047417-70047439 TGGGGGACCTGAACTATCAGAGG - Intronic
1122076353 14:99237564-99237586 CGGGTGCCCAGACAAAACAGTGG - Intronic
1131282368 15:91032291-91032313 CGAGGGTCCAGAGAAATCAGAGG + Intergenic
1135375920 16:21947373-21947395 CGGGGGCCCAGAAATTTGAATGG + Intergenic
1139122221 16:64034101-64034123 GGGGAGCCCAGAAAAATGAGTGG + Intergenic
1139675931 16:68523532-68523554 CGGGGGCACAGAGGTATCTGGGG + Intergenic
1144956314 17:19020579-19020601 CGGGAGCCCTGAAAAATTAGGGG + Exonic
1153911254 18:9708264-9708286 CGGCGGCCCAGAAATAGCAGCGG + Exonic
1153925756 18:9833332-9833354 CAGGGGCCCGGAAGTGTCAGGGG + Intronic
1157223941 18:45846189-45846211 AGGGGGCCCAGAAACATGAGGGG - Intergenic
1161336159 19:3714745-3714767 CTGAGGCCCAGAGATAGCAGGGG - Intronic
1165902087 19:39173751-39173773 AGGGGGCCCAGGAACAGCAGGGG - Exonic
1168240470 19:55086581-55086603 CGGGGGCTCAGAAAGAGCAAAGG + Intronic
1168348467 19:55662217-55662239 CAGGGGCCCCAAAAAATCAGGGG - Intronic
927457062 2:23261928-23261950 CCTGGGTCCTGAAATATCAGAGG + Intergenic
928375864 2:30772676-30772698 GAGGGGCCCAGAAATAACAGAGG + Intronic
932023516 2:68112167-68112189 TTGGGGCCCATAAATATCAGTGG + Intergenic
937303721 2:120858478-120858500 CGAGAGGCCAGAAACATCAGAGG - Intronic
939535174 2:143418744-143418766 CAGGGGCCCATTAATATGAGAGG + Intronic
944309076 2:198212636-198212658 CTGGGCCCCACAAATATTAGGGG - Intronic
946346431 2:219114721-219114743 CTGGGGCCCAGACATGGCAGAGG + Intronic
946886322 2:224226387-224226409 TCGGGGCACAGAAATATAAGAGG - Intergenic
1169745008 20:8934914-8934936 CAGGGGCCTGGAAATACCAGGGG - Intronic
1169879275 20:10328941-10328963 TTGGGGCCCAGAAAAATCAGGGG - Intergenic
1171459048 20:25288346-25288368 CTGGGGCCCAGCAGCATCAGAGG - Intronic
1171572136 20:26262772-26262794 CGGGGACTTAGAAATATTAGAGG + Intergenic
1172230463 20:33332679-33332701 GGGAAGCCAAGAAATATCAGGGG - Intergenic
1176083962 20:63287493-63287515 CGGGGGCACAGAATTCCCAGTGG + Intronic
1178373343 21:32046288-32046310 CAGAGGCCCAGAACTACCAGGGG + Intergenic
1179154370 21:38836979-38837001 CAGAGGCCCAGAAGTAGCAGGGG + Intergenic
1184803169 22:46774739-46774761 CGGGGGCCCAGAAATATCAGGGG - Intronic
955231548 3:57103467-57103489 TGGAGGCCCAGTAAAATCAGTGG - Intronic
956262092 3:67355530-67355552 GGCGGGGCCAGAAATATGAGAGG - Intergenic
957496080 3:80992871-80992893 CAGGGTCACAGAAATATCAGAGG + Intergenic
959192662 3:103135039-103135061 CAGGGGCCAAGAAATATGGGTGG - Intergenic
964238758 3:154566402-154566424 CTAGGGCTCAGAAAAATCAGGGG - Intergenic
966910605 3:184557544-184557566 TGGGGGCCCAGATATAAAAGGGG + Intronic
967847088 3:194052714-194052736 CAGGGACTCAGAAACATCAGTGG + Intergenic
969656511 4:8501811-8501833 CTGGGGCCCAGAAAGGACAGGGG - Intergenic
970947667 4:21714313-21714335 AGAGAGCCGAGAAATATCAGGGG - Intronic
972817899 4:42665016-42665038 TGGAGGCCCAGAAATATTTGGGG - Intergenic
979319106 4:119301608-119301630 CGGGCACCCAGACATATAAGTGG + Intronic
989795314 5:45463614-45463636 CAGTGACCAAGAAATATCAGAGG - Intronic
992057600 5:73007189-73007211 CAAGGCCCCAGAAATCTCAGTGG + Intronic
994420355 5:99523126-99523148 CTGAGGCCCAGAAATATGAGGGG + Intergenic
994420523 5:99523945-99523967 CTGAGGCCCAGAAATATGAGGGG + Intergenic
994486517 5:100390369-100390391 CTGAGGCCCAGAAATATGAGGGG - Intergenic
994486685 5:100391188-100391210 CTGAGGCCCAGAAACATGAGGGG - Intergenic
994486854 5:100392007-100392029 CTGAGGCCCAGAAATATGAGGGG - Intergenic
995687303 5:114784769-114784791 TGGGGTCCCAGAAATGTTAGGGG - Intergenic
997516679 5:134494995-134495017 CAGGGGCTCAAAAATATCATTGG - Intergenic
999154257 5:149447032-149447054 CAGGGGCCCAGTAATGTCACTGG + Intergenic
999765513 5:154737788-154737810 CGGGGAACCGGGAATATCAGAGG - Intronic
1001090576 5:168737249-168737271 CTGGGGTCCAGAAAGCTCAGTGG - Intronic
1001840990 5:174876524-174876546 AGGGGGCACAGGAATTTCAGGGG + Intergenic
1002365334 5:178705420-178705442 CGGGGACCCAGAGAGAGCAGAGG - Intergenic
1003105247 6:3210464-3210486 CGGTGGCCCAGAGATAACTGAGG + Intergenic
1006695801 6:35929617-35929639 AGGGGGCCCATAAATATTTGTGG - Intergenic
1007388741 6:41537363-41537385 GGTGGTCCCAGAAATACCAGTGG - Intergenic
1019386228 7:757748-757770 CTGTGTCCCAGAAATATCTGGGG - Intronic
1024111901 7:46155454-46155476 AGGGGACCCAGAAATAACACTGG - Intergenic
1025030605 7:55553721-55553743 AGGGAGCACAGAGATATCAGGGG - Intronic
1026646262 7:72171927-72171949 CTGGGGTCCAGAAAGATCACAGG + Intronic
1028005692 7:85564082-85564104 TGGGGGCCAAGAAATGTGAGTGG + Intergenic
1029315041 7:99704186-99704208 CTGTCTCCCAGAAATATCAGGGG + Intronic
1033602392 7:142897567-142897589 AGGGGGCTCAGAAAAAGCAGAGG + Intergenic
1037706415 8:21319175-21319197 GTGGGGGCCAGACATATCAGTGG + Intergenic
1042159502 8:65877903-65877925 CGGGGGCCTGGAAGTACCAGGGG + Intergenic
1049321712 8:142000321-142000343 CGGGGGCCCAGCAAAAGGAGAGG + Intergenic
1049554224 8:143274200-143274222 CGAGCGCCCAGAAACAGCAGAGG - Intronic
1049568394 8:143355680-143355702 CGGGGGCCCAGATGTAACAAGGG - Intronic
1061494175 9:130962318-130962340 GGAGACCCCAGAAATATCAGGGG + Intergenic
1190707683 X:53044202-53044224 TGGGAGCCCAAAAATGTCAGGGG - Intergenic
1195246302 X:102998630-102998652 CGGTGGCCCAGAATGGTCAGGGG - Intergenic