ID: 1184803170

View in Genome Browser
Species Human (GRCh38)
Location 22:46774740-46774762
Sequence TCGGGGGCCCAGAAATATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803170_1184803180 12 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803170_1184803177 1 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803170_1184803179 11 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803170_1184803176 0 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803170 Original CRISPR TCGGGGGCCCAGAAATATCA GGG (reversed) Intronic
900859869 1:5221071-5221093 CCAGGGGTCCAGAAATAGCACGG - Intergenic
904676592 1:32202439-32202461 TTGGGGGCCCTGGAGTATCAGGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
913710066 1:121473810-121473832 TCAAGGGCCCACAAATATCTAGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG + Intronic
1070064268 10:73018216-73018238 TGGGTGGCCCAGACATCTCATGG - Intronic
1070471017 10:76779588-76779610 TCAGGGACCCAGAAATCTCAAGG - Intergenic
1074497294 10:113991351-113991373 CCTGGGGCCCAGAGAGATCAAGG - Intergenic
1080922309 11:36721366-36721388 TTGGGCGGCCAGAATTATCAAGG - Intergenic
1081447601 11:43145683-43145705 AATGGGGCCCAGAAATGTCAGGG - Intergenic
1086010569 11:82098294-82098316 TCTGAGGCTCAGAAATATGAAGG - Intergenic
1094213979 12:27921341-27921363 CAGGGGGCCCAGAAATAGCAAGG - Intergenic
1097918087 12:65040993-65041015 TCTGGGGCCCCAAAATATCATGG - Intergenic
1103958259 12:124591803-124591825 GTGAGGGCCCAGAAATGTCAGGG - Intergenic
1106251242 13:27983169-27983191 TTTGGGGCACAGAAAGATCAAGG - Intronic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1118474849 14:66106914-66106936 TCGGAGGCCAAGAACTATGAAGG + Intergenic
1121851786 14:97228051-97228073 TCTGGGCACCAGACATATCAAGG + Intergenic
1135943795 16:26845998-26846020 ACGGTGTCCCAGAAAGATCAGGG - Intergenic
1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG + Intergenic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1156712679 18:39965877-39965899 TCTGGGGCCCAGAGATTTTAGGG - Intergenic
1156713025 18:39970255-39970277 TCCTGGAGCCAGAAATATCAAGG - Intergenic
1157223942 18:45846190-45846212 CAGGGGGCCCAGAAACATGAGGG - Intergenic
1157934511 18:51858403-51858425 TTGGGTACCCAGAAATATGAAGG + Intergenic
1158078718 18:53563127-53563149 TTGTGGTCCCAGATATATCATGG + Intergenic
1162028077 19:7905386-7905408 TTGGGGGTCCAGAGAAATCATGG + Intronic
1162044513 19:7989586-7989608 TCTGGTGCTCAGGAATATCAAGG + Intronic
1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG + Intronic
1166956447 19:46468645-46468667 TCAGGGACCCAGAAATTTCTTGG - Intronic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
930877999 2:56241482-56241504 TCAGAGGCCCAGAAAGATAATGG - Intronic
936029114 2:109057636-109057658 TCGGAGGCTCAGAAAGACCAAGG - Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
1169879276 20:10328942-10328964 CTTGGGGCCCAGAAAAATCAGGG - Intergenic
1173803730 20:45911078-45911100 GCGGGGCCCGAGAAATCTCAGGG - Intronic
1179150379 21:38804645-38804667 TCGGGGACCCAGAAACATTAAGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1184369602 22:44074242-44074264 TCAGGGGCTCAGAAATGCCAGGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
953620602 3:44529354-44529376 TAGGGAGGCCAGAAATATAAGGG - Intergenic
959578552 3:107961162-107961184 TTGAGGGCCCTGAAATATCAAGG - Intergenic
970947668 4:21714314-21714336 TAGAGAGCCGAGAAATATCAGGG - Intronic
981335266 4:143562294-143562316 TCTGGGGCCTAAAAATGTCAGGG + Intergenic
991945479 5:71894846-71894868 TTGGGGGCTCAGAACTAGCAAGG - Intergenic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994971960 5:106750925-106750947 TCAAAAGCCCAGAAATATCATGG - Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG + Intergenic
1008684679 6:53911846-53911868 CTAGGTGCCCAGAAATATCATGG - Intronic
1022692662 7:32672024-32672046 TCTGTGGCTAAGAAATATCAGGG + Intergenic
1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG + Intergenic
1022920334 7:35006550-35006572 TCTGTGGCTAAGAAATATCAGGG + Intronic
1025615230 7:63112546-63112568 CCAGGGGCACAGAAACATCATGG - Intergenic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1028105709 7:86875842-86875864 TCTGGGGCCCAAAGCTATCATGG - Intergenic
1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG + Intergenic
1029215355 7:98944598-98944620 TTGGGGGCCCAGAGACAACAGGG + Intronic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1037309102 8:17536157-17536179 TCAGGGCCCCAGGAATACCAAGG - Intronic
1037957167 8:23068839-23068861 TCGGGGGCCCGGAAAAGGCACGG - Exonic
1042454462 8:68984543-68984565 TCAGGAGCCCAGAAACCTCAAGG - Intergenic
1049568395 8:143355681-143355703 TCGGGGGCCCAGATGTAACAAGG - Intronic
1050366208 9:4876090-4876112 TTAGTGGCCCAGAACTATCAAGG - Intronic
1051123474 9:13777353-13777375 TTGGGGGCCCACAAGTATGAGGG - Intergenic
1057909005 9:99003924-99003946 TCGGGGGCACAGAAGTTTCCTGG + Intronic
1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG + Intronic
1061494174 9:130962317-130962339 TGGAGACCCCAGAAATATCAGGG + Intergenic
1186636917 X:11416139-11416161 GCGGCAGCACAGAAATATCATGG + Intronic
1189835901 X:45022429-45022451 TCTAGGGACGAGAAATATCATGG - Intronic
1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG + Intronic
1198679395 X:139165548-139165570 TCAGGGGCCCAGAGCTCTCAAGG + Intronic