ID: 1184803171

View in Genome Browser
Species Human (GRCh38)
Location 22:46774741-46774763
Sequence GTCGGGGGCCCAGAAATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803171_1184803180 11 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803171_1184803177 0 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803171_1184803179 10 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803171_1184803186 30 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803186 22:46774794-46774816 TGGGTGTTCTTGCTCATGCTTGG 0: 1
1: 0
2: 3
3: 22
4: 209
1184803171_1184803176 -1 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803171 Original CRISPR GTCGGGGGCCCAGAAATATC AGG (reversed) Intronic
905783893 1:40737159-40737181 GCCTGGGGACCAGAAATGTCTGG - Intronic
906295038 1:44644540-44644562 GTCAGGGGCACTGAAGTATCTGG + Intronic
908282242 1:62552772-62552794 GTGGGAGTCCCAGATATATCTGG + Exonic
915927296 1:160032303-160032325 GTCCGGGGCCCACAAATCCCCGG - Intergenic
919417648 1:197331264-197331286 GAAGGGTGCCCAGAAATATATGG - Intronic
1066475190 10:35739913-35739935 GACTGGGGCCCAGAAATCTCAGG - Intergenic
1073563328 10:104515496-104515518 ATTGGGTGCCCAGACATATCTGG + Intergenic
1079591531 11:22189005-22189027 GTCTGGGGCCTAAAAATGTCAGG + Intergenic
1094168028 12:27462854-27462876 GCCGAGGGCCCAGAGATTTCAGG - Intergenic
1096111626 12:49032236-49032258 GTTGGGGGCCCAGAAGGTTCTGG + Exonic
1101806602 12:108069585-108069607 CTTGGGGGCCCAGATATACCTGG - Intergenic
1109379475 13:61540847-61540869 GTAGGGTGTCCAGAAATAACAGG + Intergenic
1139655312 16:68383820-68383842 GTCCAGGGCCCAGAACTATTTGG - Intronic
1139675929 16:68523530-68523552 CTCGGGGGCACAGAGGTATCTGG + Intergenic
1140238356 16:73179291-73179313 GTAGGTGGCCCAGAAATAAAAGG - Intergenic
1146529888 17:33599494-33599516 GTCTGGGGCTCAGAACTACCGGG + Intronic
1147457649 17:40548150-40548172 GTAGGGGCTCCAGAAATATTTGG + Intergenic
1149535769 17:57432278-57432300 GTCGGTGGCCCAGAAGAAACTGG + Intronic
1151385644 17:73753701-73753723 GTTGTGTGCCCAGAAATACCTGG + Intergenic
1153838049 18:8981914-8981936 GGAGGGGGACCAGATATATCAGG + Intergenic
925219481 2:2126451-2126473 GTCTGGGGCCCAGAAAGAAGAGG + Intronic
1169346865 20:4835701-4835723 TTCCTGGGCCAAGAAATATCAGG + Intergenic
1169748180 20:8964199-8964221 GTCTCGGGCACAGAAATATTTGG - Intronic
1169879277 20:10328943-10328965 GCTTGGGGCCCAGAAAAATCAGG - Intergenic
1172300850 20:33849041-33849063 GTCAGGGGCCCTGAAATGTGTGG + Intronic
1173803731 20:45911079-45911101 GGCGGGGCCCGAGAAATCTCAGG - Intronic
1175381659 20:58568139-58568161 GTCTGGGGCCAAGAACCATCTGG + Intergenic
1175806631 20:61832868-61832890 GTCAGGGGCACAGAAATAAGAGG - Intronic
1175970937 20:62686527-62686549 CTCGGGGGCTCAGAAACAGCAGG - Intergenic
1176113979 20:63423079-63423101 GACGAGGGCCCAGAAAGAGCTGG - Intronic
1177409296 21:20708809-20708831 GTCGAGGGACCAGGAAAATCTGG + Intergenic
1180600636 22:17012949-17012971 GTCTGGGCCCTAGAAATTTCAGG - Intergenic
1181337848 22:22154369-22154391 GTTAGGGGCCCTGAAATATCGGG - Intergenic
1184803171 22:46774741-46774763 GTCGGGGGCCCAGAAATATCAGG - Intronic
953388946 3:42523413-42523435 GCTGGGAGCCCAGAAAGATCTGG + Intronic
954446062 3:50547513-50547535 GTGGGAGGCCCAGGAAAATCTGG + Intergenic
954786551 3:53097314-53097336 GCCAGGGGCCCAGAAAGAACTGG + Intronic
958615984 3:96494014-96494036 GGCTGGGGCCCAGGAGTATCTGG + Intergenic
961331938 3:126147634-126147656 GGAGGGGCCCCAGCAATATCAGG + Intronic
969757988 4:9162432-9162454 GTTGGGGGCTGACAAATATCAGG - Intergenic
971111003 4:23586049-23586071 GTCTGGGGCCAAGGAATATAAGG + Intergenic
972589781 4:40473647-40473669 ATCATGGGCTCAGAAATATCTGG + Intronic
974391119 4:61270205-61270227 GTCAGAGGCCCAGAAATAAGAGG + Intronic
977644335 4:99395285-99395307 ATCGGGGACCCAGAAAAATTAGG - Intergenic
981335265 4:143562293-143562315 GTCTGGGGCCTAAAAATGTCAGG + Intergenic
987674773 5:21061527-21061549 GTGGGCAGCCCAGAAATACCAGG - Intergenic
994420353 5:99523124-99523146 GGCTGAGGCCCAGAAATATGAGG + Intergenic
994420521 5:99523943-99523965 GGCTGAGGCCCAGAAATATGAGG + Intergenic
994486519 5:100390371-100390393 GGCTGAGGCCCAGAAATATGAGG - Intergenic
994486856 5:100392009-100392031 GGCTGAGGCCCAGAAATATGAGG - Intergenic
997943363 5:138178419-138178441 TTTGGGGGCCCAGAAATCTGGGG - Intronic
1006101276 6:31687775-31687797 GGCGGGGGCCCAGCAAGGTCAGG - Intronic
1007721157 6:43886223-43886245 ATGGGGGGCCCATAAATAGCAGG - Intergenic
1019365911 7:632730-632752 GCCGGGGGCTCAGGAACATCCGG - Intronic
1022692661 7:32672023-32672045 GTCTGTGGCTAAGAAATATCAGG + Intergenic
1022920333 7:35006549-35006571 GTCTGTGGCTAAGAAATATCAGG + Intronic
1023264401 7:38391306-38391328 GTAGGGAGCCCATAAATATTTGG - Intronic
1028833081 7:95346593-95346615 GTCTGGGCCCCAGGAATACCAGG + Intergenic
1033159479 7:138982817-138982839 GTCCTGGGACCAGACATATCTGG - Intergenic
1036371962 8:8169736-8169758 GTTGGGGGCACAGAAATAAAGGG - Intergenic
1036878942 8:12495907-12495929 GTTGGGGGCACAGAAATAAAGGG + Intergenic
1046293947 8:112196979-112197001 GTCGGGGGGGCAGAAATAAGGGG - Intergenic
1051123475 9:13777354-13777376 GTTGGGGGCCCACAAGTATGAGG - Intergenic
1051889278 9:21926134-21926156 GTCTGGGGCTCAAGAATATCAGG + Intronic
1189146399 X:38659543-38659565 AGCTGAGGCCCAGAAATATCAGG + Intronic
1195667217 X:107442291-107442313 GTAAGGGGCTCAGAAATACCAGG - Intergenic
1200058355 X:153473076-153473098 GTGGTGGGCCCAGAGATATATGG + Intronic
1200140903 X:153902539-153902561 CTCGGGGGCCAAGAAAGATGGGG - Intronic