ID: 1184803176

View in Genome Browser
Species Human (GRCh38)
Location 22:46774763-46774785
Sequence CTGCATCCGCTCTGTTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803160_1184803176 30 Left 1184803160 22:46774710-46774732 CCAAGGCAGAGCCCTTTCCGGCT 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803170_1184803176 0 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803166_1184803176 13 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803164_1184803176 19 Left 1184803164 22:46774721-46774743 CCCTTTCCGGCTTCGGGGCCCCT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803169_1184803176 1 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803171_1184803176 -1 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179
1184803165_1184803176 18 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG 0: 1
1: 0
2: 0
3: 20
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803176 Original CRISPR CTGCATCCGCTCTGTTCCCA CGG Intronic
900092354 1:925901-925923 CTGCCTCGGCTCTGCTCGCAGGG + Exonic
903180451 1:21602490-21602512 CAGCATCCGTGCTCTTCCCACGG - Intronic
904621405 1:31777471-31777493 CTGCATCCACCCTGTTCCCTGGG + Intergenic
905791566 1:40792321-40792343 CTGAATCCCCACTGTGCCCAGGG - Intronic
906296291 1:44651010-44651032 CTGTTCCAGCTCTGTTCCCAGGG + Exonic
910631021 1:89354432-89354454 CTGCATGTGCTCAATTCCCAAGG + Intergenic
912508592 1:110173326-110173348 CTGCATCCACTCTGGACACAGGG - Intronic
913524567 1:119678641-119678663 CTGCATGTGCTCAATTCCCAAGG - Intronic
916414143 1:164576827-164576849 GTGCCTGCGGTCTGTTCCCAGGG + Intronic
918107130 1:181424925-181424947 CTGCCTCCACTCTGCTCCCATGG + Intronic
919991179 1:202709573-202709595 CTGCTTCAGCTCTGTCCCCAAGG - Intronic
920036862 1:203071732-203071754 CAGCTTCCGGTCTGTGCCCAAGG - Exonic
920841888 1:209562142-209562164 CTGCACCCCCTGTGTTTCCAGGG - Intergenic
923216830 1:231856342-231856364 CTGCTTCCCCTCTGTTCTCGGGG + Intronic
1062983337 10:1744128-1744150 GTCCATCAGCTGTGTTCCCAGGG + Intergenic
1063111151 10:3038525-3038547 CTGCATGCTCTCTGGTTCCAAGG - Intergenic
1065687219 10:28298334-28298356 CAACATCCACTCTGTACCCATGG - Intronic
1066167836 10:32807774-32807796 CTGCATCTGCTTGGTTCTCACGG - Intronic
1067048467 10:42999071-42999093 CTGCATCCTCTGTATCCCCAGGG - Intergenic
1071406081 10:85333901-85333923 CTGCATGGGCTCTGCTCCTATGG + Intergenic
1072049579 10:91689988-91690010 CTGCCTCTGCACTGTTCCCCAGG + Intergenic
1074002602 10:109387797-109387819 CTGCATATGCTCACTTCCCAAGG + Intergenic
1074978976 10:118603927-118603949 TTGCATCTGCTCTGTGCCCCTGG - Intergenic
1076126435 10:127977891-127977913 CTGCAGCCACTCTGCTTCCAGGG - Intronic
1076802698 10:132838633-132838655 CTTCATCCGTTCTGTGGCCAAGG + Intronic
1077334885 11:1998806-1998828 CGGCAAACCCTCTGTTCCCATGG + Intergenic
1077532726 11:3104721-3104743 CTGCAGTCTCTCTGTTCCCTGGG - Intronic
1078479107 11:11660702-11660724 CTGCCTAGGCTCTGTGCCCATGG - Intergenic
1080936351 11:36868069-36868091 CTACATCTGCTGTGTGCCCAAGG + Intergenic
1081742250 11:45448846-45448868 CTGCATTCACTCCGTGCCCATGG - Intergenic
1082010928 11:47449127-47449149 CTGAACCAGCTTTGTTCCCAGGG - Exonic
1082202700 11:49392024-49392046 CTGCATCCACTTTTCTCCCAGGG - Intergenic
1084873720 11:72115345-72115367 CTGCTTCCCCTCTGTCCCCAGGG - Intronic
1086533187 11:87811134-87811156 CTGCGTGTGCTCAGTTCCCAGGG - Intergenic
1086652335 11:89308052-89308074 CTGCATCCACTTTTCTCCCAGGG + Intergenic
1089104035 11:115987299-115987321 CTGAATCCCCTCAGTCCCCAAGG - Intergenic
1090519362 11:127461748-127461770 CTGCATTCCCTCTGCACCCAGGG - Intergenic
1202817868 11_KI270721v1_random:53988-54010 CGGCAAACCCTCTGTTCCCATGG + Intergenic
1091974102 12:4810970-4810992 CTGCACCAGCTCAGTGCCCAGGG - Exonic
1093958479 12:25249369-25249391 CTCCATCTGCTCTGTTGCCCAGG - Intronic
1094292813 12:28871377-28871399 TTGCATCTGCTCTCTTTCCATGG - Intergenic
1094737731 12:33254143-33254165 CTGCACACGCTCAATTCCCAAGG - Intergenic
1096085950 12:48865230-48865252 CTGCAGCCCCTCTGTTCACCTGG - Intronic
1098389961 12:69959302-69959324 CTGCCTCCTGACTGTTCCCAGGG + Intergenic
1101004954 12:100392708-100392730 CTGCTTGCTCTCTTTTCCCAGGG + Intronic
1103606528 12:122090105-122090127 CTGAATGCGCTTTGTTCCTAAGG - Intronic
1103920721 12:124397778-124397800 CTGCCACTGCTCTGTCCCCAAGG + Intronic
1104118236 12:125771486-125771508 CAGCATCCGCTCTGTTTCTGGGG + Intergenic
1105448257 13:20475695-20475717 GTGATTCCCCTCTGTTCCCAAGG - Intronic
1107322649 13:39205822-39205844 CTGCATCCTCTCCTTCCCCATGG + Intergenic
1112175684 13:97021300-97021322 CTGGATCTGATGTGTTCCCATGG + Intergenic
1113057398 13:106283964-106283986 CTGCATCAGCTGTGTTCTCCTGG + Intergenic
1113194694 13:107788485-107788507 CTTCTTCCTCTCTCTTCCCATGG + Intronic
1113955438 13:114097973-114097995 CTGGGCCCGCTTTGTTCCCAGGG - Intronic
1116800854 14:49441863-49441885 CTGGATCCGCTCTCTGCCTATGG + Intergenic
1117519995 14:56541957-56541979 CTGGAAGAGCTCTGTTCCCAAGG + Intronic
1121466197 14:94116863-94116885 CTGTGTCCCCTCTGTTCCCTGGG - Intergenic
1121659711 14:95625618-95625640 CTGCAGCCTCTGTGTTCCCAGGG - Intergenic
1121849735 14:97209925-97209947 CTGCAGCAGCTCTGTCTCCATGG - Intergenic
1122740446 14:103868911-103868933 CTCCCTCTTCTCTGTTCCCATGG + Intergenic
1122891291 14:104733418-104733440 CTGCCCCCCCTCTGTCCCCAGGG + Intronic
1128453152 15:67818782-67818804 CTGCATCCTGGCTGGTCCCAGGG - Intergenic
1132874479 16:2130250-2130272 CTGCCTCCGCTCGGCTGCCAGGG + Intronic
1133133901 16:3695960-3695982 CTGCATCCAGTCTGTACACATGG - Intronic
1133234329 16:4380848-4380870 CTGCCTCCTCTCTGCTCCCAGGG + Exonic
1133284248 16:4683284-4683306 CTGCATGCGGTTTGTGCCCATGG - Intronic
1133361428 16:5176960-5176982 CTAGATCCTCTGTGTTCCCAGGG - Intergenic
1134553423 16:15149083-15149105 CTGCCTCCGCTCGGCTGCCAGGG + Intergenic
1135475597 16:22771786-22771808 ATGCCTCCTTTCTGTTCCCATGG + Intergenic
1137696167 16:50463585-50463607 CTGCATCCCTTCTCTTCTCAGGG - Intergenic
1138240748 16:55425225-55425247 CTGCAGCTGCTTTGTCCCCATGG + Intronic
1138995839 16:62452001-62452023 CTGCATGTGCTCAGTTCCCAAGG - Intergenic
1140335480 16:74100896-74100918 CTACATTCACTGTGTTCCCAGGG - Intergenic
1142233642 16:88911271-88911293 CTGGCCCCGCTCTGTTGCCATGG - Intronic
1142627542 17:1202147-1202169 CTGTAGCCGCTCTGTTGCCCAGG + Intronic
1145232435 17:21183900-21183922 CTCCATCCTCTCTGTTGCCCTGG + Intronic
1152761808 17:82112331-82112353 CAGCATCAGCCCTGTTCCCACGG + Intronic
1153148260 18:2058076-2058098 CTGCATGTGCTCAATTCCCAAGG - Intergenic
1155434320 18:25795507-25795529 CTCCATCCACTCTCTACCCATGG + Intergenic
1156328945 18:36101336-36101358 CTGCTTCTGCTCTCTTTCCATGG + Intergenic
1156579527 18:38359017-38359039 CTGCAGCCACACTGTTCCCAGGG + Intergenic
1160074274 18:75657676-75657698 CTGCAGCCGCTCCATTCCCAGGG + Intergenic
1161440391 19:4288255-4288277 CTGCATCCGCCCTGTTCAGGGGG - Exonic
1161498592 19:4600681-4600703 CTGCACCCCCTCTGCACCCAGGG - Intergenic
1162139570 19:8577617-8577639 CTGCAGCAGCCCTGTCCCCAAGG - Intergenic
1163323223 19:16586666-16586688 CTCCATGTGCACTGTTCCCAGGG - Intronic
1164041730 19:21498511-21498533 CTGCATAGGCTCTGTTCAGAAGG + Intronic
1166547428 19:43641561-43641583 CAGCATCCTCTCTGTCCTCAGGG + Intergenic
1167022244 19:46886164-46886186 ATGCCTCCTCTCTGTTTCCAAGG + Intergenic
1167617273 19:50542308-50542330 CTGCACCCGGTCTTCTCCCAGGG + Intronic
1168172878 19:54600874-54600896 CATCATCAGATCTGTTCCCAAGG - Exonic
1168257542 19:55174951-55174973 CTCCCTCCGCTATGTCCCCACGG - Exonic
1168484737 19:56751397-56751419 CTGTTTCCACTCTGTTTCCATGG - Intergenic
926939412 2:18119108-18119130 ATGCATCCGCTGAGTCCCCAGGG - Intronic
929432833 2:41902924-41902946 ATGCATCTGCTCTTTTGCCATGG - Intergenic
929576587 2:43056260-43056282 CTGCATCCCCCCAGTTCCCAGGG - Intergenic
929905724 2:46044810-46044832 GTGGATCCACTCTGTGCCCAGGG + Intronic
929927373 2:46225829-46225851 CTGAATCCTCTGTTTTCCCAAGG - Intergenic
929940671 2:46331548-46331570 ATGCATCTGTTCTTTTCCCATGG - Intronic
929941750 2:46339401-46339423 CAGCAGGCGCTCTGTTCACAGGG + Intronic
932593053 2:73078620-73078642 CTGTCTCCACTCTGTTCCCAAGG - Intronic
936092891 2:109512290-109512312 CTGCATCCCTGCTGCTCCCAGGG + Intergenic
936877821 2:117213755-117213777 CTGCATGTGCTCACTTCCCAAGG + Intergenic
937198409 2:120180579-120180601 CTGAATCTGCTATGTCCCCAAGG + Intergenic
937339563 2:121082494-121082516 CTGGATCCCCTCTCTTCCAATGG - Intergenic
947648315 2:231761902-231761924 CTGGAGCCTTTCTGTTCCCAAGG - Intronic
947938831 2:234030921-234030943 CTGTCTCCGCTCTAATCCCATGG - Intergenic
948687320 2:239677425-239677447 CTGCGTCTCCTCAGTTCCCAGGG + Intergenic
949068110 2:242006243-242006265 TTGGATCTGCTCTGTTCCCCGGG - Intergenic
1169117082 20:3072644-3072666 CAGCACCCGCTCTGTCCCCTCGG - Intergenic
1172447460 20:35000704-35000726 CTGCACCTGCTCTGTCCCCAGGG - Intronic
1173429618 20:42974926-42974948 CTGCATCATCTCTATTTCCAAGG + Intronic
1174048082 20:47747995-47748017 CTGCTTCCGCTCTTGTCCCTGGG + Intronic
1174512060 20:51060876-51060898 CTGCATCTCCTCTGATTCCAGGG - Intergenic
1174536782 20:51257542-51257564 CTGCACATGCTCAGTTCCCAAGG + Intergenic
1175188390 20:57195195-57195217 CTGCATCCCCTCCTTTACCAAGG - Intronic
1175403827 20:58714827-58714849 CAGCAGCCACTCTGTTCCCAGGG - Intronic
1175459083 20:59137520-59137542 CTGCATCAGCTCTCTGCCCCTGG + Intergenic
1175794698 20:61764423-61764445 AGGCATCCTCTCTCTTCCCAGGG - Intronic
1177059371 21:16352192-16352214 CTGCATGTGCTCAATTCCCAAGG + Intergenic
1178036618 21:28590905-28590927 TTGCATCCTCTCTGTTTTCAAGG + Intergenic
1179999667 21:44989638-44989660 CTGCAGTGGCACTGTTCCCAGGG - Intergenic
1182395767 22:30034692-30034714 CTGCAAGCGCTCAGTTCCTAGGG - Intergenic
1184803176 22:46774763-46774785 CTGCATCCGCTCTGTTCCCACGG + Intronic
950966663 3:17151540-17151562 CTGTATCTGCTTTGTTCCCATGG + Intergenic
952839429 3:37631674-37631696 CTGCAGCTTCTCTGTTCCCTGGG - Intronic
953212381 3:40887516-40887538 CTGCATCAGCACTGTTTACATGG - Intergenic
954619065 3:51985500-51985522 CTGCATCATGTCTGTCCCCAAGG - Intronic
955283661 3:57617974-57617996 CTGCATCCACTTTGTTGCGAAGG - Intergenic
955473015 3:59306365-59306387 CTGAATCCCCTCTCTTCTCAGGG + Intergenic
957878159 3:86175907-86175929 CAGCATCCACTCTGTTTCTAGGG - Intergenic
959494230 3:107030675-107030697 CTGCATCCCCTCTTTCCCTAGGG - Intergenic
960447353 3:117764350-117764372 CTCCATCAGCTGCGTTCCCAAGG + Intergenic
960467029 3:118008835-118008857 CTGCATTAGCTCTGTTCTCTGGG + Intergenic
960582560 3:119293766-119293788 CTGCAGCCTCTCTTTGCCCAGGG + Intergenic
964444287 3:156742361-156742383 CTGCATACCCACTGTTCTCAGGG + Intergenic
965870310 3:173256415-173256437 CAGCATCTGCTCAGTTTCCAGGG - Intergenic
967438389 3:189477821-189477843 CTGCATCCTCTCTGTATCTATGG - Intergenic
968286721 3:197513208-197513230 TTCCAACCCCTCTGTTCCCAGGG - Intronic
970074582 4:12203080-12203102 CTCCTTCCTCTGTGTTCCCATGG - Intergenic
973849320 4:54945607-54945629 CTGTATCTGCTTTGTTCCCCAGG + Intergenic
973982258 4:56316274-56316296 CAGCAGCCGCTCTGTTCCTGTGG + Exonic
975632724 4:76418981-76419003 CTGCATTCCCTCTTTTCCCCAGG + Intronic
985862882 5:2488093-2488115 CAGCCTCCGCTCTGTGTCCACGG - Intergenic
986167483 5:5287888-5287910 CTGCAGCCGCACAGTTCCTAAGG - Intronic
988458873 5:31414097-31414119 CTGCATCAGCTCTCCTCCCTTGG - Intronic
989498984 5:42143760-42143782 CTGCCTCCGCCATCTTCCCATGG - Intergenic
990341107 5:54823814-54823836 CTGCATGTGTTCAGTTCCCAAGG + Intergenic
991361542 5:65826157-65826179 CTGCCTCCTGTCTCTTCCCATGG - Exonic
999310175 5:150546740-150546762 CTGCCTCCTCTTTGCTCCCATGG + Intronic
1001278632 5:170369690-170369712 ATGCAGCCACTCTATTCCCATGG + Intronic
1001723356 5:173875229-173875251 CTCCATCTGCTCTGGGCCCAGGG + Intergenic
1001936516 5:175709541-175709563 CTGCACCTGCTCTGCTCCCCAGG + Intergenic
1003142352 6:3482104-3482126 GTGCAGGCGCTCTGTCCCCATGG + Intergenic
1006679167 6:35785080-35785102 CTGCATGTGCTCACTTCCCAAGG - Intronic
1006785832 6:36666549-36666571 CTGCAACCCATCTGTGCCCAAGG + Intergenic
1006806003 6:36789636-36789658 CTGCAACAGCTCTGTTCCACAGG + Intronic
1007250636 6:40492644-40492666 CTGCAACAGCCCTGTTCTCAGGG + Intronic
1007432774 6:41786328-41786350 CTGCATCCTCTCCCTTACCAAGG - Exonic
1008962221 6:57277561-57277583 CGGCTTCTGCTGTGTTCCCAAGG - Intergenic
1017656541 6:156634499-156634521 CTGCATCCTCTCTGCTCACAAGG + Intergenic
1017771235 6:157645957-157645979 CGGCACCGTCTCTGTTCCCAAGG - Intronic
1019153740 6:170025501-170025523 CTGGATCCCCTCTGGTCACAGGG + Intergenic
1020076220 7:5260680-5260702 CTGCATCCGTGCTGGGCCCAGGG - Intergenic
1020088437 7:5323982-5324004 CTGCCTCCTCCCTGGTCCCAGGG + Intronic
1021919666 7:25472161-25472183 CTGCAACCACTCTTTTCCCTTGG - Intergenic
1025205876 7:56993130-56993152 CTGCCTCCTCCCTGGTCCCAAGG - Intergenic
1025666064 7:63583808-63583830 CTGCCTCCTCCCTGGTCCCAAGG + Intergenic
1026640260 7:72117996-72118018 CTGCCTGCTGTCTGTTCCCAGGG - Intronic
1026674239 7:72415894-72415916 CTGAGTCTGATCTGTTCCCAGGG + Intronic
1029023345 7:97388472-97388494 CTGCATCCACACTGTAGCCAAGG - Intergenic
1029519365 7:101050391-101050413 CTTCACCCTCTCTGATCCCAAGG - Intronic
1034452206 7:151143077-151143099 CCGCATCCCCACTGTCCCCAGGG + Intronic
1037529306 8:19757696-19757718 CTCCACCCGCTCTGTTCCCTTGG + Intronic
1037833713 8:22204094-22204116 CAGGAACCCCTCTGTTCCCACGG + Intronic
1039602550 8:38852769-38852791 CTGCTTCCACTGTGTTCCCACGG + Exonic
1040072662 8:43201097-43201119 CTGCAGCTGCTCTGTTCTCATGG + Exonic
1040692953 8:49962020-49962042 CAGCTTCCCCTCTGCTCCCAGGG + Intronic
1041827281 8:62110005-62110027 CTGCACAGGCTCAGTTCCCAAGG - Intergenic
1042667412 8:71221902-71221924 CTGCACAGGCTCAGTTCCCAAGG + Intronic
1044088223 8:87968394-87968416 CTGCATATGCTCACTTCCCAAGG + Intergenic
1046133678 8:109998583-109998605 CTGCATGAGCTCAGTTCTCAAGG - Intergenic
1046595664 8:116258577-116258599 CTGCATCTCTTCTCTTCCCAAGG + Intergenic
1049423549 8:142527215-142527237 CAGCTTCCCCTCTGTGCCCAGGG - Intronic
1051997284 9:23233209-23233231 CTGCATGTGCTCACTTCCCAGGG + Intergenic
1053482964 9:38429619-38429641 ATGCAACAGCTCTGTTCCCCAGG - Intergenic
1056636901 9:88338709-88338731 CTGCCTTCCCTCTGGTCCCAAGG - Intergenic
1057847795 9:98538884-98538906 CTGACTCCTCTCTGTGCCCAAGG - Intronic
1062070176 9:134551208-134551230 CTGGGGCCGCTCTGTTCCCCAGG + Intergenic
1062281784 9:135755100-135755122 CTGCCTCCTTTCTCTTCCCAGGG + Exonic
1185956683 X:4498530-4498552 CTGCGTGTGCTCGGTTCCCAAGG - Intergenic
1186722758 X:12323318-12323340 CTGGATTCCCTCTGTTCACAGGG - Intronic
1188032755 X:25282549-25282571 CTGCATCTGCTATCATCCCATGG - Intergenic
1192161180 X:68789079-68789101 TTGCATCCCCACTGTTCCCATGG - Intergenic
1192177716 X:68896175-68896197 TGGCATCCTCTCTGCTCCCATGG - Intergenic
1193963339 X:87952070-87952092 CTGCATTCCCTTTGTTCCAAAGG - Intergenic
1196419835 X:115510025-115510047 CTGCACTTGCTCAGTTCCCAAGG - Intergenic
1199404745 X:147443945-147443967 CTGCATGTGCTCACTTCCCAAGG + Intergenic
1200022012 X:153219674-153219696 CTGCATGTGCTGTGTTCGCATGG - Intergenic
1200122040 X:153795642-153795664 CTGCCTCCACGCTGTTCCTAGGG + Intronic