ID: 1184803177

View in Genome Browser
Species Human (GRCh38)
Location 22:46774764-46774786
Sequence TGCATCCGCTCTGTTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803169_1184803177 2 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803165_1184803177 19 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803166_1184803177 14 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803171_1184803177 0 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803164_1184803177 20 Left 1184803164 22:46774721-46774743 CCCTTTCCGGCTTCGGGGCCCCT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124
1184803170_1184803177 1 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803177 Original CRISPR TGCATCCGCTCTGTTCCCAC GGG Intronic
901659341 1:10788863-10788885 GGCTTCCCCTCTGTCCCCACTGG - Intronic
902482758 1:16720157-16720179 TGAACCCGCTCTCCTCCCACAGG - Intergenic
902531040 1:17090963-17090985 TGCATCCCTCCTGCTCCCACTGG + Intronic
904648499 1:31986730-31986752 TGCACCCACTCTGTTCCCCTTGG + Intergenic
905831546 1:41073069-41073091 TGCCTCTGCTCTGCTCCCTCAGG - Intronic
908034791 1:60040362-60040384 TGCATCAGCTCTCTTCCTTCAGG + Intronic
910743671 1:90549875-90549897 TTCATCTCTTCTGTTCCCACTGG - Intergenic
912694747 1:111832821-111832843 AGCAGCCGCTCTGTTCCCTATGG + Intronic
915110515 1:153561848-153561870 TGCATCAGCTCGAATCCCACAGG + Intronic
915604839 1:156943934-156943956 CTCATCCGCTCTGTGGCCACAGG - Exonic
918008576 1:180564946-180564968 TGCCCTCGCTCTGTTCCCAGTGG + Intergenic
919789007 1:201278030-201278052 TGCTTCCTCACTGTTCACACTGG - Intergenic
919991178 1:202709572-202709594 TGCTTCAGCTCTGTCCCCAAGGG - Intronic
1063261108 10:4390400-4390422 TGCATCAGCTCTGCCCCCACAGG - Intergenic
1063312489 10:4967512-4967534 TGCTTCCTCTCTTTTCACACTGG + Intronic
1063315443 10:5000053-5000075 TGCTTCCTCTCTTTTCACACTGG - Intronic
1070762104 10:79030295-79030317 AGCATCCGCTCTGTTCCCCCTGG + Intergenic
1076255604 10:129022157-129022179 TGCACTCTCTCTGTACCCACAGG - Intergenic
1078535108 11:12166975-12166997 TCCATCCACTCTGTTCTCTCCGG - Intronic
1080897074 11:36455803-36455825 TGCGTCAGCTGTGTCCCCACTGG - Intronic
1081765671 11:45608365-45608387 TGCCTCCCCTCTGGCCCCACAGG - Intergenic
1082129404 11:48470676-48470698 TGTGTCAGGTCTGTTCCCACTGG - Intergenic
1082247680 11:49943026-49943048 TGTGTCAGGTCTGTTCCCACTGG + Intergenic
1083262780 11:61532192-61532214 AGCACCTGCTCTGTTCCTACTGG - Intronic
1088597191 11:111449398-111449420 TGCAGCTCCTGTGTTCCCACTGG - Intronic
1096446061 12:51693057-51693079 TGCTTCCTGTCTGATCCCACTGG - Intronic
1100200839 12:92296355-92296377 TACCTCCGCTCTGTACTCACAGG + Intergenic
1102094710 12:110228169-110228191 TTCATCTTCTCTGTTCCCTCCGG - Intergenic
1104050205 12:125189661-125189683 TTCATCCCCTCTCCTCCCACCGG + Intronic
1105998929 13:25700799-25700821 TGCACCATTTCTGTTCCCACTGG + Intronic
1113391409 13:109900795-109900817 AGAATATGCTCTGTTCCCACCGG - Intergenic
1113571265 13:111359943-111359965 CTCATACGCACTGTTCCCACAGG + Intergenic
1118785145 14:69039437-69039459 TGCACCCACTGTGTTTCCACAGG + Intergenic
1121659710 14:95625617-95625639 TGCAGCCTCTGTGTTCCCAGGGG - Intergenic
1121848405 14:97196242-97196264 TGCATCAGCTGTGGTCCTACAGG + Intergenic
1121994637 14:98592828-98592850 CGCCCCCGCTCTGTTCCCCCAGG - Intergenic
1122601922 14:102925752-102925774 TGCCCCTGCGCTGTTCCCACCGG - Intronic
1122604938 14:102941930-102941952 TGCATCTGCACTGTGCCCGCAGG + Intronic
1122693783 14:103543255-103543277 TGCATCCCCTCTGTGTCCCCAGG - Intergenic
1124028335 15:25987385-25987407 TGCAACCCCATTGTTCCCACAGG - Intergenic
1124367320 15:29081291-29081313 CACATCCCCTCTGGTCCCACAGG - Intronic
1128033119 15:64499442-64499464 TGCATCCACTCCTTTCCCTCCGG - Exonic
1129973973 15:79805593-79805615 TGAATCTTCTCTGTTCCCAGTGG - Intergenic
1130284752 15:82545710-82545732 TGCATCTGGGCTGTACCCACAGG - Intronic
1132627729 16:899787-899809 GTCATCTGCTCTTTTCCCACAGG - Intronic
1137758847 16:50924459-50924481 TGCATCCTCATTGTTCCTACAGG + Intergenic
1138576110 16:57908345-57908367 AGCATCCCACCTGTTCCCACTGG + Intronic
1138995838 16:62452000-62452022 TGCATGTGCTCAGTTCCCAAGGG - Intergenic
1141624339 16:85253427-85253449 AGCAGCAGCTCTGTTCCCCCTGG - Intergenic
1142023092 16:87796146-87796168 TGCCTCCACTCTGAGCCCACTGG + Intergenic
1143672271 17:8405041-8405063 TGTATCCACTCTGTCCCCACAGG - Intergenic
1151699525 17:75735951-75735973 TCCCACAGCTCTGTTCCCACAGG + Intronic
1152407201 17:80104597-80104619 GGCACCCGCCCTGCTCCCACCGG + Intergenic
1155956056 18:31957699-31957721 TGCATCCCCTTTGTTCCTATAGG - Intergenic
1157146246 18:45165601-45165623 TGCATCTGCTTGGTTCCCTCTGG - Intergenic
1157173168 18:45426912-45426934 TCCATCTGCTCTTTTCCCTCAGG + Intronic
1157648557 18:49303411-49303433 TTCATCATCTGTGTTCCCACAGG - Intronic
1160074275 18:75657677-75657699 TGCAGCCGCTCCATTCCCAGGGG + Intergenic
1160280513 18:77485688-77485710 TGAATGCGCTGTCTTCCCACAGG - Intergenic
1160588364 18:79925623-79925645 TGGAGCTGGTCTGTTCCCACAGG - Intronic
1161779927 19:6285202-6285224 TGCATCCCCTGGGCTCCCACTGG + Intergenic
1165458269 19:35927756-35927778 TGCATCTCCATTGTTCCCACAGG - Intergenic
1166546352 19:43636542-43636564 TGCTTCCGTTCTGATGCCACAGG + Intronic
1167978643 19:53254455-53254477 TGCTTCCCCTCTGTTCTCCCTGG + Intronic
926385804 2:12334711-12334733 TCCATCAGCTCTGACCCCACAGG - Intergenic
926939411 2:18119107-18119129 TGCATCCGCTGAGTCCCCAGGGG - Intronic
929432832 2:41902923-41902945 TGCATCTGCTCTTTTGCCATGGG - Intergenic
929905725 2:46044811-46044833 TGGATCCACTCTGTGCCCAGGGG + Intronic
935130311 2:100256672-100256694 GACATCCCCTCTGCTCCCACCGG + Intergenic
936935936 2:117838268-117838290 TCCATCCTCTGGGTTCCCACAGG - Intergenic
939011997 2:136857324-136857346 TGGAACCACTCTGATCCCACTGG + Intronic
940430432 2:153583909-153583931 TCCTTCCGCTCAGTTCCCAGAGG - Intergenic
942754572 2:179324879-179324901 TGCAACCCTTCTGTTCCCAAAGG - Intergenic
944507543 2:200428419-200428441 TGCTTCCTCTCTGTTCCCTTTGG + Intronic
946485345 2:220095839-220095861 TGCATCTGCTCTGCTCCTTCAGG + Intergenic
948255263 2:236563838-236563860 TGCAGCCGCTGTGCCCCCACAGG + Intergenic
949068109 2:242006242-242006264 TGGATCTGCTCTGTTCCCCGGGG - Intergenic
1169117081 20:3072643-3072665 AGCACCCGCTCTGTCCCCTCGGG - Intergenic
1170221900 20:13950365-13950387 TGAAACAGCTTTGTTCCCACAGG + Intronic
1171207398 20:23291706-23291728 TGTGTCCGGTCTGTACCCACTGG - Intergenic
1172009016 20:31835704-31835726 TGGAACCTCTCTGTTCCCACAGG - Intergenic
1172991352 20:39039283-39039305 TTCATCAGCTCAGATCCCACAGG + Exonic
1173564186 20:44027556-44027578 TGCATCCAGTAAGTTCCCACTGG - Intronic
1178615488 21:34129371-34129393 TGCCTCTGCTCTGTTTCTACCGG + Intronic
1184113086 22:42406557-42406579 TGCATCCACTATTCTCCCACTGG + Intronic
1184803177 22:46774764-46774786 TGCATCCGCTCTGTTCCCACGGG + Intronic
1185339902 22:50286582-50286604 TTCATACCCTCTGTTCCCGCAGG + Intronic
949328327 3:2892226-2892248 TCCATCTGGTATGTTCCCACTGG - Intronic
954613789 3:51959411-51959433 TTCATCCACTTTGTCCCCACAGG - Exonic
957607163 3:82416147-82416169 TGCTTCTGTTCTGTTCCCACTGG - Intergenic
962960410 3:140306175-140306197 TGTATCCCCTTTATTCCCACAGG + Intronic
965711373 3:171559440-171559462 TGCATCCTCTTCATTCCCACTGG - Intergenic
967033464 3:185629931-185629953 TGCATCACTTCTGTTCTCACAGG + Exonic
980892833 4:138833193-138833215 TGCATCCGTTCCGTTCACATTGG - Intergenic
981511866 4:145566415-145566437 TGGAGCTGCTCTGCTCCCACTGG - Intergenic
982740794 4:159054873-159054895 AGCATGTGCTCTGCTCCCACTGG + Intergenic
985196995 4:187442421-187442443 TGCATCCCCACTGTTCCTACAGG + Intergenic
985891370 5:2717639-2717661 CACCTCCCCTCTGTTCCCACTGG + Intergenic
989344734 5:40417148-40417170 TGCATCCCCATTGTTCCTACAGG - Intergenic
997849326 5:137316861-137316883 TGGGCCCGCTCTGTGCCCACTGG + Intronic
998040332 5:138947365-138947387 CGCACCAGCCCTGTTCCCACAGG + Exonic
998528227 5:142861733-142861755 TGCATCATCTCTCTTCTCACAGG + Intronic
1001278633 5:170369691-170369713 TGCAGCCACTCTATTCCCATGGG + Intronic
1008654297 6:53595914-53595936 AGCATCTGCTCTGCTCTCACTGG - Intronic
1010166230 6:72918077-72918099 TGCATACAGTCTGTTCCCCCTGG - Intronic
1011819506 6:91235014-91235036 TGCATTGGCTCTGTCCCCATTGG + Intergenic
1013097734 6:106961226-106961248 TGCCTCTGCTCTGTGTCCACCGG - Intergenic
1013532457 6:111032536-111032558 TGCATCCCCATTGTTCCTACAGG - Intergenic
1016937728 6:149460162-149460184 TGCAGCTGCTCTCTTCTCACAGG + Intronic
1017656542 6:156634500-156634522 TGCATCCTCTCTGCTCACAAGGG + Intergenic
1019713305 7:2527124-2527146 AGCCCCTGCTCTGTTCCCACAGG + Exonic
1020912902 7:14155625-14155647 TGCCTCCACTCTGTTCCCATTGG - Intronic
1021688073 7:23206403-23206425 GGTGACCGCTCTGTTCCCACTGG + Intergenic
1022142110 7:27501319-27501341 TGCCTCCACTCTGTCCCCTCTGG - Intergenic
1023154480 7:37234528-37234550 TGCATCCCCTCTGTTGCCCCTGG - Intronic
1034459113 7:151188135-151188157 TGCCTGGGCTCTGATCCCACTGG + Intergenic
1035383817 7:158457440-158457462 CGCATCCGCTGTGGTCCCGCAGG - Intronic
1035383853 7:158457597-158457619 CGCATCCGCTGTGGTCCCGCAGG - Intronic
1035383887 7:158457754-158457776 CGCATCCGCTGTGTTCCCGCAGG - Intronic
1035591448 8:817961-817983 TGCATCAGCTGTGGTCCCATAGG + Intergenic
1036614497 8:10378097-10378119 TGCTTCCGCCCTGTGCCCTCAGG - Intronic
1039602551 8:38852770-38852792 TGCTTCCACTGTGTTCCCACGGG + Exonic
1040724279 8:50362960-50362982 TCCATCCTTTCTCTTCCCACAGG - Intronic
1049410198 8:142470623-142470645 TGCGTCCTCTGTGTGCCCACAGG + Intronic
1051069052 9:13140149-13140171 TGCATTCTTTTTGTTCCCACAGG - Exonic
1053480808 9:38414943-38414965 GGCATCTGCTCTGCTCACACTGG + Intronic
1056625574 9:88250248-88250270 TGCCTCTGTTCTTTTCCCACAGG - Intergenic
1059875697 9:118632100-118632122 TGCACCTGCTTTGTTCCCAGAGG + Intergenic
1060825262 9:126684093-126684115 TGCAGCCCTTCTGTTCCCACCGG - Intronic
1060874047 9:127067419-127067441 TGCATCCTCTGTGGTCCCAGAGG + Intronic
1061237909 9:129352737-129352759 TCCATCCCTTCTGTGCCCACCGG - Intergenic
1185477641 X:424967-424989 TGCACCCCCTCTGTCCCCACTGG - Intergenic
1185789762 X:2919844-2919866 TGCATCCTGTGTGATCCCACTGG + Intronic
1186363832 X:8871182-8871204 TCCATCCTCTCTGTACCCTCAGG - Intergenic
1188390867 X:29617436-29617458 TGCTTCCTTTCTGTTCCCAGAGG - Intronic
1189726240 X:43970280-43970302 CCCATCCCCTCTGCTCCCACTGG + Intronic
1200653174 Y:5867518-5867540 TGCACCCTCTCTGTGCACACTGG + Intergenic
1200844540 Y:7818210-7818232 TGCCTCTGCTCTGCTCCCACAGG - Intergenic