ID: 1184803179

View in Genome Browser
Species Human (GRCh38)
Location 22:46774774-46774796
Sequence CTGTTCCCACGGGTCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 172}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803166_1184803179 24 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803164_1184803179 30 Left 1184803164 22:46774721-46774743 CCCTTTCCGGCTTCGGGGCCCCT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803173_1184803179 -6 Left 1184803173 22:46774757-46774779 CCCCGACTGCATCCGCTCTGTTC 0: 1
1: 0
2: 0
3: 1
4: 66
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803174_1184803179 -7 Left 1184803174 22:46774758-46774780 CCCGACTGCATCCGCTCTGTTCC 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803170_1184803179 11 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803169_1184803179 12 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803165_1184803179 29 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803172_1184803179 -5 Left 1184803172 22:46774756-46774778 CCCCCGACTGCATCCGCTCTGTT No data
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803171_1184803179 10 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172
1184803175_1184803179 -8 Left 1184803175 22:46774759-46774781 CCGACTGCATCCGCTCTGTTCCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803179 Original CRISPR CTGTTCCCACGGGTCCCTCC TGG Intronic
900352349 1:2241169-2241191 TTGTTCCCACTGGTCCCCACAGG - Intronic
901199424 1:7458190-7458212 CTGGTCCCCTGTGTCCCTCCAGG + Intronic
902199352 1:14822239-14822261 CTGTTCTCCCAGGTGCCTCCTGG - Intronic
902228110 1:15009405-15009427 CTGTTCCCAGGCAACCCTCCTGG - Intronic
902542363 1:17164192-17164214 CTGTTGCCCCGGGTTCCTTCGGG + Intergenic
903224293 1:21886102-21886124 CTGCGCCCACGGCTACCTCCTGG - Intronic
903628107 1:24745655-24745677 CAGATCCCCCGGCTCCCTCCCGG + Intronic
903739918 1:25552782-25552804 CTCTTTCCACGTGTCCCTCCTGG + Intronic
904467945 1:30719064-30719086 CTCTTCCCCCGGGTGCCGCCTGG - Intronic
904563297 1:31413061-31413083 CCCTTCCCTAGGGTCCCTCCTGG + Intronic
905094896 1:35461793-35461815 CTGTTCCCTCTCTTCCCTCCTGG + Intronic
905314504 1:37073344-37073366 CTGTTCCCAGGGGTGCCTCAGGG - Intergenic
905960702 1:42040270-42040292 GTGTTCCCACGGCCTCCTCCTGG - Intergenic
907385308 1:54121962-54121984 ACGCTCCCTCGGGTCCCTCCTGG - Intergenic
910747450 1:90588977-90588999 GGGTTCCCATGGGTCCCTGCTGG - Intergenic
913392218 1:118326838-118326860 CTGTTCCCCCTTGTCCCACCTGG + Intergenic
920612440 1:207454646-207454668 TTGTCCCCACTGGCCCCTCCGGG + Intronic
920782795 1:209011081-209011103 CTGTTCTCACGTGGCCCACCAGG + Intergenic
921829368 1:219710264-219710286 TTGTTGACACGGGACCCTCCAGG + Intronic
1063351667 10:5362450-5362472 CGGCTCCCACTGGTCCATCCTGG - Intergenic
1064301055 10:14123280-14123302 CTGTTCCCAAGACTCCCTGCAGG + Intronic
1070541071 10:77415751-77415773 CTGTTCCCATGGGTCCTGCATGG + Intronic
1070691914 10:78533341-78533363 CTGCTCCCCCGTGACCCTCCAGG + Intergenic
1072219420 10:93315240-93315262 CTGCTTCCAGGGGTCCCTCCTGG - Intronic
1074546535 10:114405317-114405339 CTTTTGCCACCGGTCCTTCCAGG + Intergenic
1074963868 10:118471859-118471881 CTGTCCCAATGGGGCCCTCCAGG - Intergenic
1075724288 10:124603698-124603720 CTGGACCCTCCGGTCCCTCCAGG + Intronic
1076211281 10:128646976-128646998 CTGGTCCCGCAGGGCCCTCCAGG - Intergenic
1076394748 10:130130380-130130402 ATGTGCCCACGGGTTCCTCCTGG - Intergenic
1076707641 10:132310328-132310350 CTGAGCCCACAGGCCCCTCCAGG - Intronic
1077043654 11:535257-535279 CTGTGCCCGCGGGCCCCGCCCGG + Intronic
1077195672 11:1278847-1278869 GGGATCCCAGGGGTCCCTCCAGG - Intronic
1077341002 11:2026270-2026292 CTCTTCCCACCAGCCCCTCCTGG - Intergenic
1078334153 11:10450827-10450849 CTCCTCCCGCGGGGCCCTCCTGG + Exonic
1084166096 11:67375406-67375428 CTTTTCACAAGGGTCCCTCCAGG - Intronic
1084963533 11:72731147-72731169 CTGTTCCCTCCTGTCCCTTCAGG - Intronic
1085856935 11:80185907-80185929 GTGTTCCCAAGGGTCCATCCTGG + Intergenic
1089684368 11:120137577-120137599 CTGTTCCGCCGGGTCTCCCCGGG + Exonic
1091056237 11:132421502-132421524 ATGTTCCCATCAGTCCCTCCTGG - Intronic
1202823987 11_KI270721v1_random:81459-81481 CTCTTCCCACCAGCCCCTCCTGG - Intergenic
1091399941 12:175521-175543 CTCCTCCCACCTGTCCCTCCAGG - Exonic
1091753041 12:3034322-3034344 CTCTTCCCACTGGTGCCACCCGG + Intronic
1093884608 12:24445044-24445066 CTGATTCCACCGGTACCTCCAGG + Intergenic
1100591496 12:96034814-96034836 CTGATCCCACGGTTGCCTCCCGG - Intronic
1101909334 12:108850288-108850310 CTTTTCCCCCAGCTCCCTCCTGG - Intronic
1103561936 12:121797400-121797422 CTGTTCCTGCTGGTCCCTCGAGG - Intronic
1104636841 12:130442788-130442810 CTGTTCCCAGGAGTCCATGCTGG + Intronic
1105038194 12:132941716-132941738 CACTTCCCACGGGTACCTCCAGG + Intronic
1106343284 13:28851878-28851900 CTGTTTCCACTCTTCCCTCCTGG + Intronic
1111785082 13:92776410-92776432 GTGATCCCACGGGGCCCACCCGG + Intronic
1113653983 13:112056938-112056960 CTCTGCCCACGGGCACCTCCCGG - Intergenic
1113692931 13:112324422-112324444 CAGTTTCCACGCATCCCTCCCGG - Intergenic
1114318096 14:21525392-21525414 CCGTGCCCACGGATCCCACCTGG - Exonic
1117247507 14:53900619-53900641 CTGTTACCACGGCTTCCTCTGGG - Intergenic
1122270724 14:100567559-100567581 CTGGTCCCCGGGGACCCTCCGGG - Intronic
1126010647 15:44299093-44299115 CTGTTCCCACTGGAGCCTCTAGG - Intronic
1129181758 15:73882160-73882182 CTGTGCCCACTGTTTCCTCCCGG + Intronic
1130259847 15:82346406-82346428 CTGTGCTCTGGGGTCCCTCCAGG + Intronic
1130268878 15:82433030-82433052 CTGTGCTCTGGGGTCCCTCCAGG - Intronic
1130281384 15:82522603-82522625 CTGTGCTCTGGGGTCCCTCCAGG - Intergenic
1130472757 15:84238786-84238808 CTGTGCTCTGGGGTCCCTCCAGG - Intronic
1130480248 15:84353357-84353379 CTGTGCTCTGGGGTCCCTCCAGG - Intergenic
1130484479 15:84390928-84390950 CTGTGCTCTGGGGTCCCTCCAGG - Intergenic
1130491521 15:84434772-84434794 CTGTGCTCTGGGGTCCCTCCAGG + Intergenic
1130503136 15:84513812-84513834 CTGTGCTCTGGGGTCCCTCCAGG + Intergenic
1130595053 15:85243420-85243442 CTGTGCTCTGGGGTCCCTCCAGG - Intergenic
1131392683 15:92062041-92062063 ATGTTGCCCCGGGCCCCTCCTGG + Intronic
1131890581 15:96967746-96967768 CTGATTCCAGGTGTCCCTCCAGG - Intergenic
1132976848 16:2715401-2715423 CTCTGCCCACCGGCCCCTCCTGG - Intronic
1136102593 16:28006873-28006895 CTGTTCCCGAGGGGTCCTCCAGG - Intronic
1138475887 16:57270432-57270454 CTATTCCCACTGCTCCATCCAGG + Intronic
1138534858 16:57654357-57654379 CTGTTCACACGGGTGGCCCCAGG - Intronic
1140457768 16:75114778-75114800 CTGCTCCCACGGTGCCCTCAGGG + Intronic
1141476205 16:84275171-84275193 CTCTTCCCACGTTTCCTTCCTGG - Intergenic
1142111141 16:88332360-88332382 GGGTTCCCACGGGTGCTTCCAGG - Intergenic
1142313619 16:89329126-89329148 CTACTCCCACGGCTTCCTCCAGG + Intronic
1143269490 17:5665350-5665372 CTGCTCCCACGGGGCGGTCCTGG - Intergenic
1143773854 17:9185287-9185309 CGCTTCCCAGGGGGCCCTCCTGG - Intronic
1143812268 17:9481567-9481589 CTATTCCCACTTGACCCTCCTGG - Intronic
1150007624 17:61479525-61479547 CTGTCCCCATGGGTCTCTCCTGG - Intronic
1151375982 17:73689433-73689455 CTCTTCCCACGGGCCCCTCTTGG - Intergenic
1151555850 17:74846359-74846381 CTCTGCCCATTGGTCCCTCCCGG - Intronic
1151600613 17:75103959-75103981 CTGTTCCCCAGGGTTGCTCCTGG + Exonic
1152945158 17:83194094-83194116 CTGTGCCTAGGGGTCCCTCCTGG + Intergenic
1154382489 18:13865326-13865348 CTGTTCACACGCCTGCCTCCAGG + Intergenic
1156466194 18:37349074-37349096 CTTTTCCCAGGGCTCTCTCCAGG - Intronic
1159426592 18:68296704-68296726 ATGTTCCCAGTTGTCCCTCCTGG - Intergenic
1160751464 19:736366-736388 CTAATCTCACGGCTCCCTCCTGG + Intronic
1162806398 19:13139955-13139977 CTGCTCCCAGGGGTCTCTCCAGG + Exonic
1163547878 19:17950252-17950274 CTGTTCCCACAGGGCTCTTCAGG - Intergenic
1164564293 19:29314898-29314920 CTGCTCTCTTGGGTCCCTCCTGG + Intergenic
1165153422 19:33773777-33773799 CTGTTCCTATGGGGGCCTCCTGG + Intergenic
1165318796 19:35073807-35073829 CTCTTCCCATGGGGCCCTGCTGG - Intergenic
1165749242 19:38250371-38250393 CTGCTCCCTTGGGACCCTCCAGG + Intronic
1166442103 19:42823912-42823934 CTGCTCCCCGGGGTTCCTCCCGG - Intronic
1166461527 19:42992195-42992217 CTGCTCCCCGGGGTTCCTCCCGG - Intronic
1166478820 19:43152180-43152202 CTGCTCCCCGGGGTTCCTCCCGG - Intronic
1166501493 19:43344511-43344533 CTGCTCCCCGGGGTTCCTCCCGG - Intergenic
1166508623 19:43388947-43388969 CTGCTCCCCGGGGTTCCTCCCGG + Intergenic
1167951942 19:53034882-53034904 CAGTTCACAGGGGTTCCTCCAGG + Intergenic
931287079 2:60841221-60841243 CTGTGCCCAGGTGTCTCTCCAGG - Intergenic
935177658 2:100663890-100663912 CTGCTCTCACAGGTCCCCCCTGG - Intergenic
935193135 2:100794156-100794178 CTGTTCCCACTGGTTCTGCCTGG - Intergenic
936280944 2:111139152-111139174 CTCTTCCCACGCCCCCCTCCAGG - Intronic
936577485 2:113668438-113668460 CTGGGCCCCTGGGTCCCTCCAGG - Intergenic
939140970 2:138354236-138354258 CCGTTCCCACAGGTCCTTGCTGG - Intergenic
942893207 2:181017297-181017319 CTCGTCCCACTGGCCCCTCCTGG - Intronic
945193619 2:207216661-207216683 CTGTTGCCACGGGTTACTGCAGG - Intergenic
1169986571 20:11451849-11451871 GTATTCCCACAGTTCCCTCCTGG - Intergenic
1170871825 20:20212997-20213019 CTGTTCCCACCCTCCCCTCCCGG - Intronic
1171439012 20:25146713-25146735 CTGCCCCCTGGGGTCCCTCCAGG - Intergenic
1175816521 20:61885919-61885941 CTGTTCCCACTGCTTCCTCCTGG - Intronic
1175840250 20:62022060-62022082 GTGTCCCCAGGGGTCCATCCTGG - Intronic
1175904434 20:62372529-62372551 CTCTGCCCACTGGGCCCTCCTGG - Intergenic
1176383879 21:6127416-6127438 ATCTTCCCTCGGCTCCCTCCAGG - Intergenic
1178808219 21:35857255-35857277 CTTTTTCCACTGGCCCCTCCTGG - Intronic
1180050347 21:45328246-45328268 CTGTGCCCACGAGGCCCTCAAGG + Intergenic
1180852618 22:19029311-19029333 CGGTTCCCAGGGGACCCTGCGGG - Intergenic
1180980082 22:19874258-19874280 ATGTCCCCACTGGCCCCTCCAGG - Intergenic
1184803179 22:46774774-46774796 CTGTTCCCACGGGTCCCTCCTGG + Intronic
1184812811 22:46848312-46848334 CTGTTCTCTCGGGTCCCTGAAGG - Intronic
1185199418 22:49492367-49492389 CTGTACCCAGTGGCCCCTCCAGG + Intronic
1185422747 22:50744226-50744248 CTGGGCCCCTGGGTCCCTCCAGG + Intronic
949109282 3:239121-239143 CTGATCTCAAGTGTCCCTCCCGG + Intronic
950170842 3:10838154-10838176 CTATTCCCACATGGCCCTCCTGG + Intronic
953497767 3:43403200-43403222 CAGTTCCCAGGGGTGCCTCTGGG - Intronic
954156180 3:48686035-48686057 CTGTCTCCTCTGGTCCCTCCCGG + Intronic
954578444 3:51689896-51689918 CAGCTCCCCAGGGTCCCTCCAGG - Intronic
954636608 3:52074316-52074338 CTTTTCCCACGTGGCCCTGCCGG - Intergenic
954799357 3:53178351-53178373 CTGTTCCCGCTGGTCCCGCCCGG + Intronic
959017399 3:101150739-101150761 CATGTCCCACAGGTCCCTCCTGG - Intergenic
959866851 3:111280794-111280816 CTTTACCCACGGGTGCTTCCAGG + Intergenic
961169503 3:124786614-124786636 CTCTTTCCAGGGCTCCCTCCTGG - Intronic
962251435 3:133838386-133838408 CTGATCCCAAGGGTCCCTCCCGG + Intronic
964626300 3:158763389-158763411 CTGTTCCCATGGGCCTCTCCAGG - Intronic
969995659 4:11309902-11309924 CTGTTTCCAAGGCTCCCTTCTGG + Intergenic
970683434 4:18537027-18537049 CTGTTCCCAGGGGTTCCCGCTGG + Intergenic
971869749 4:32219411-32219433 CTGTTTCCTAGGGTCACTCCTGG - Intergenic
977901230 4:102424613-102424635 CTTCTCTCACGTGTCCCTCCTGG - Intronic
977989891 4:103428813-103428835 TTATTCCCACAGGTCCCTACTGG - Intergenic
978760962 4:112356245-112356267 CTGTGCCCGCGGGGCTCTCCAGG - Intronic
982178449 4:152728283-152728305 CTGCTCCTTCGGGTCCCTCAAGG - Intronic
986412513 5:7494583-7494605 CTGTTTCCAAGGGCTCCTCCAGG + Intronic
987516829 5:18920773-18920795 CTGTTGCCACAGATCCCTACAGG - Intergenic
990776537 5:59311110-59311132 CTGGTCCCACATTTCCCTCCAGG - Intronic
992638997 5:78752460-78752482 CTGATCCCAGGGGTCCAACCAGG - Intronic
997211038 5:132076931-132076953 CTGTTCCCTCATCTCCCTCCAGG + Intergenic
997623220 5:135314149-135314171 CTGTTCCCACACCTTCCTCCTGG - Intronic
999304038 5:150508355-150508377 CTGTACCCCCAGATCCCTCCTGG - Intronic
999713961 5:154344111-154344133 ATCTTCCCATGGCTCCCTCCAGG + Intronic
1002300437 5:178254639-178254661 CTGTTCCCACCGGTGTCTCCTGG - Intronic
1006427563 6:33975848-33975870 CTGTTCCAAGGCGTCCCACCTGG - Intergenic
1007294760 6:40813637-40813659 CAGAGCCCACGGGTCCCTGCTGG + Intergenic
1017542367 6:155415941-155415963 GTGTTCCCACTGGTCACTCCTGG + Intronic
1018825375 6:167404764-167404786 CTGTCCCCGCTGGTCCCTGCAGG + Intergenic
1019513221 7:1428861-1428883 CTGCTCCCCGGGGACCCTCCCGG - Intronic
1019630716 7:2047594-2047616 CTTTTCCCACGAGACCCTCATGG - Intronic
1022955030 7:35372869-35372891 CTATCCCCACAGGTCCCTACAGG + Intergenic
1025877320 7:65495012-65495034 CTGTTCCCAGGGGTCACCTCAGG - Intergenic
1026583560 7:71637616-71637638 CTGTTCCCATGGTTCCATCCTGG - Intronic
1026973492 7:74481823-74481845 CTGTTCCCACCCTTCGCTCCAGG - Intronic
1029193424 7:98787674-98787696 CTGTTCCCTCTGTTGCCTCCTGG - Intergenic
1029566626 7:101342830-101342852 CTGTCCCCTCCAGTCCCTCCAGG - Intergenic
1035354710 7:158270203-158270225 CTCTGCCCACGGGGCTCTCCAGG - Intronic
1035361027 7:158314580-158314602 CTTTCCCCACGGGAGCCTCCAGG - Intronic
1035553483 8:545999-546021 CCGTTCCCGCGGCTCCGTCCCGG - Intergenic
1035936941 8:3851833-3851855 CTGCTCCCACCCGACCCTCCTGG - Intronic
1036580630 8:10071963-10071985 CTGTGTCCAGGGGTCCCTCGTGG + Intronic
1038404075 8:27309013-27309035 CTCTTCCCTCGGGTCTCTGCTGG + Intronic
1038610194 8:29053869-29053891 CTGTTCCCACTGAGCTCTCCAGG - Intronic
1040387034 8:46920817-46920839 CTGTTCCCACCCATCCCTGCTGG - Intergenic
1041720882 8:60974245-60974267 CTGCCTCCACGAGTCCCTCCCGG + Intergenic
1046651369 8:116839871-116839893 CTGTTCCCTCTGGTCACTCAGGG + Intronic
1047254691 8:123206638-123206660 CTGGTCTCAAGGCTCCCTCCTGG - Intronic
1047314507 8:123720173-123720195 CTCTTCCCGGGGGCCCCTCCTGG - Intronic
1049179150 8:141212205-141212227 CTGTCTCCACCGGTCCCTGCAGG + Exonic
1052840538 9:33288820-33288842 CTGCTCCCAGGGGTCTCTCCAGG + Intergenic
1053201040 9:36151731-36151753 CTGTGCCCCGGGGTCCCTCTGGG + Intronic
1053294373 9:36902481-36902503 CTCTGCCCACGGCACCCTCCCGG - Intronic
1056936667 9:90919925-90919947 CTGTTCCAGCGAGTCCTTCCTGG + Intergenic
1058061725 9:100504279-100504301 CAGTTTCCATGGGTCTCTCCTGG - Intronic
1061283367 9:129609673-129609695 CTCTTCCCCGGGGGCCCTCCGGG - Intronic
1061359757 9:130133583-130133605 CTGTGCACATGGATCCCTCCTGG + Intronic
1062249557 9:135587408-135587430 CTGTCCCCGCGTGTCACTCCCGG - Intergenic
1185546259 X:947955-947977 CAGATACCACGGGTCCCTCAAGG + Intergenic
1185856915 X:3544435-3544457 CTGTTTCCATGGGATCCTCCTGG - Intergenic
1186341432 X:8650136-8650158 CAGTTCTCCTGGGTCCCTCCTGG + Intronic
1197782425 X:130171640-130171662 TTCTTCCCTCGGGTCCGTCCCGG + Exonic
1200222385 X:154397584-154397606 CTGTGCTCAAGAGTCCCTCCGGG - Intronic
1202366790 Y:24171114-24171136 CTGTGCTCTGGGGTCCCTCCAGG - Intergenic
1202373617 Y:24214368-24214390 CTGTGCTCTGGGGTCCCTCCAGG + Intergenic
1202497164 Y:25455752-25455774 CTGTGCTCTGGGGTCCCTCCAGG - Intergenic
1202503992 Y:25499009-25499031 CTGTGCTCTGGGGTCCCTCCAGG + Intergenic