ID: 1184803180

View in Genome Browser
Species Human (GRCh38)
Location 22:46774775-46774797
Sequence TGTTCCCACGGGTCCCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184803169_1184803180 13 Left 1184803169 22:46774739-46774761 CCCCTGATATTTCTGGGCCCCCG 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803172_1184803180 -4 Left 1184803172 22:46774756-46774778 CCCCCGACTGCATCCGCTCTGTT No data
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803166_1184803180 25 Left 1184803166 22:46774727-46774749 CCGGCTTCGGGGCCCCTGATATT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803171_1184803180 11 Left 1184803171 22:46774741-46774763 CCTGATATTTCTGGGCCCCCGAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803173_1184803180 -5 Left 1184803173 22:46774757-46774779 CCCCGACTGCATCCGCTCTGTTC 0: 1
1: 0
2: 0
3: 1
4: 66
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803175_1184803180 -7 Left 1184803175 22:46774759-46774781 CCGACTGCATCCGCTCTGTTCCC 0: 1
1: 1
2: 0
3: 13
4: 166
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803170_1184803180 12 Left 1184803170 22:46774740-46774762 CCCTGATATTTCTGGGCCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803174_1184803180 -6 Left 1184803174 22:46774758-46774780 CCCGACTGCATCCGCTCTGTTCC 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data
1184803165_1184803180 30 Left 1184803165 22:46774722-46774744 CCTTTCCGGCTTCGGGGCCCCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1184803180 22:46774775-46774797 TGTTCCCACGGGTCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184803180 Original CRISPR TGTTCCCACGGGTCCCTCCT GGG Intronic
No off target data available for this crispr