ID: 1184804818

View in Genome Browser
Species Human (GRCh38)
Location 22:46787769-46787791
Sequence GTAGAGAACCAGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184804812_1184804818 -5 Left 1184804812 22:46787751-46787773 CCACCTCAGAGGAGGCAGGTAGA No data
Right 1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 347
1184804813_1184804818 -8 Left 1184804813 22:46787754-46787776 CCTCAGAGGAGGCAGGTAGAGAA 0: 1
1: 0
2: 2
3: 37
4: 442
Right 1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184804818 Original CRISPR GTAGAGAACCAGAATGGGGA GGG Intronic
900342832 1:2196945-2196967 GTTGGGAGCCAGAGTGGGGAAGG - Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
900846282 1:5104567-5104589 GTTGAGATTCACAATGGGGATGG + Intergenic
901076084 1:6555505-6555527 GCAGACAGCCAGAATGGAGAGGG - Exonic
902237545 1:15067228-15067250 GGAACCAACCAGAATGGGGAGGG - Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906371125 1:45254724-45254746 GTAGAGAACAAGTCTGGGAATGG + Intronic
906690136 1:47787105-47787127 GTGAAGAACCATGATGGGGAAGG + Intronic
907228939 1:52976891-52976913 GAAGTGACCCAGAGTGGGGACGG - Intronic
907270903 1:53290609-53290631 GTAAAGAACCGGGCTGGGGATGG - Intronic
907409453 1:54274154-54274176 GGCGAGACCCAGAATGGGGAGGG + Intronic
907772667 1:57481288-57481310 GTAGAAAACGGAAATGGGGAGGG - Intronic
908079186 1:60557019-60557041 GTAGAGCCCCAGAATGGGACTGG - Intergenic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
911721647 1:101197619-101197641 GTGGAGAACTAGATTGGAGATGG - Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
912424306 1:109573024-109573046 GTTGAGAGTCAGAATTGGGAGGG + Intronic
912849632 1:113111479-113111501 TTAGAGATTCAGAATGGAGAGGG - Intronic
912901910 1:113660271-113660293 GTATAGGAACAGAATGGAGAAGG - Intronic
913158685 1:116125957-116125979 GCAGAGATTCAGAATGGGCAAGG + Intronic
913322918 1:117601949-117601971 GTAGGGATCCAGAAGGGGGATGG - Intergenic
913442503 1:118913372-118913394 GGAGAGAATCAAAATGGGTAGGG - Intronic
914340471 1:146755769-146755791 TTAGAGAAACATTATGGGGATGG + Intergenic
915211539 1:154313243-154313265 GGAGAGATACAGAAAGGGGACGG - Intergenic
915462808 1:156080313-156080335 GGAGAGATCCAGAATGGAGGAGG - Intronic
915621890 1:157091257-157091279 GGAGAGACCCAGAGTGGGGCAGG - Intergenic
915749101 1:158187859-158187881 GCGGAGCACAAGAATGGGGAGGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916083679 1:161252935-161252957 GTAGGGATCCATACTGGGGATGG - Intergenic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
917333194 1:173903638-173903660 GTAGACAGCCAGAAAGGGAAGGG - Intergenic
917853772 1:179085795-179085817 GTGGAGAACCTGTATCGGGACGG + Exonic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919722100 1:200849137-200849159 GTAGTGAAAAAGAAAGGGGATGG + Exonic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
920136011 1:203769900-203769922 GTAGGGAACAAGAAGGGGCAAGG + Intronic
920672808 1:208017309-208017331 GAAGAAAACCAGATGGGGGATGG + Intergenic
921949155 1:220911102-220911124 ATAGAGAGCCAGAATGGGTCAGG - Intergenic
922204815 1:223437028-223437050 GTGGAGCACCAGAGTGGGCATGG - Intergenic
922725976 1:227923248-227923270 GTAGAGCCCCAGCCTGGGGAGGG - Intronic
922828781 1:228539930-228539952 TTAGAATACCGGAATGGGGAAGG + Intergenic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923764125 1:236876981-236877003 GAAGAGAACCAGAAGAGGCAGGG - Intronic
1063414813 10:5864691-5864713 CTGGAGATCCATAATGGGGACGG - Intronic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1065203023 10:23331561-23331583 GAAGGGAACCGGGATGGGGAAGG + Intronic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1065817024 10:29491641-29491663 GTGGAAAACCAGACTAGGGAAGG + Intronic
1066317016 10:34258260-34258282 GTGGAGAACAAGACTGGAGATGG + Intronic
1066334657 10:34463283-34463305 GAACAGAACAAGAAAGGGGAGGG + Intronic
1066385679 10:34939468-34939490 GTAGATAACCAGAAGTGGAAAGG + Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1067849841 10:49747450-49747472 GGAGAGCACAAGAGTGGGGAAGG + Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068637470 10:59362991-59363013 GGAGAGAACAAGAAGGGGGAGGG + Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071577458 10:86739755-86739777 GGAGAGATCCTGAATGGGAACGG - Intergenic
1071834870 10:89408885-89408907 GTGGGGATCCATAATGGGGATGG - Intronic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1072252551 10:93593111-93593133 GTAGAGAAACAAAATGGGCCAGG - Intronic
1073775308 10:106778776-106778798 CTAGAAAATCAGAGTGGGGAAGG - Intronic
1075565988 10:123504773-123504795 GTAGAGCACATGGATGGGGAGGG - Intergenic
1075740392 10:124692333-124692355 GTAGGGGACAAGAGTGGGGAGGG + Intronic
1076115235 10:127891046-127891068 GTAGAGATCCAGCAAAGGGAAGG + Intronic
1076502454 10:130947996-130948018 GTAGTTACCAAGAATGGGGAAGG + Intergenic
1076740797 10:132483282-132483304 GAAGAGAACCAGGATTGGAAAGG + Intergenic
1077166472 11:1142023-1142045 GGAGAGAAAGAGGATGGGGATGG + Intergenic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1081033446 11:38114002-38114024 GTGGGGATCCATAATGGGGACGG - Intergenic
1081520210 11:43874109-43874131 GAAGAGACCCTGAAGGGGGAAGG - Intergenic
1083431764 11:62616965-62616987 GGTGAGCACCAGGATGGGGATGG - Exonic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087599801 11:100299171-100299193 GAAGAGTTTCAGAATGGGGAAGG + Exonic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1088412213 11:109546964-109546986 GTAGAGGTTCAGAATGGGGAAGG + Intergenic
1088638046 11:111843551-111843573 GTAGAAAAGCAGAATGGAGGTGG + Intronic
1088755951 11:112885327-112885349 GTAGAGAACTAAAAAGGGGGAGG - Intergenic
1088852842 11:113719474-113719496 GCAGGGAATCAGGATGGGGAAGG - Intergenic
1089907434 11:122055537-122055559 GTAGAGACCCTCAATGGGTAAGG - Intergenic
1093049219 12:14487247-14487269 CTAGAGAACAGGCATGGGGATGG - Intronic
1093106945 12:15098245-15098267 GAAGAATACAAGAATGGGGAGGG - Intergenic
1093143695 12:15539142-15539164 GAAGAGAATCAGAAGGGTGAGGG + Intronic
1093841497 12:23907995-23908017 GGAGAGAGCAAGAGTGGGGATGG - Intronic
1094455906 12:30632653-30632675 ATAGAGACCTGGAATGGGGAGGG - Intronic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1099808974 12:87556641-87556663 TTAGAGAGTCAGTATGGGGAAGG + Intergenic
1100857946 12:98774986-98775008 GTAGAAAACCAAATTAGGGATGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1103484507 12:121273857-121273879 GTCGTGAATCAGCATGGGGAAGG - Intronic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1105894746 13:24708392-24708414 GTAGAAAACAAGAGAGGGGAAGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1110300409 13:73920020-73920042 GTAGAGCACCCGAACGGAGAGGG - Intronic
1110342564 13:74409841-74409863 GTAAACAACCACTATGGGGAGGG + Intergenic
1112426964 13:99311359-99311381 GCACAGGATCAGAATGGGGATGG + Intronic
1112519142 13:100080785-100080807 GTAGGGATCCATACTGGGGATGG - Intergenic
1113652346 13:112043053-112043075 GAAGAGAACAAGAATGGAGAAGG - Intergenic
1114447285 14:22798693-22798715 GTAGAGACCCAGGAACGGGAAGG - Intronic
1115872266 14:37817769-37817791 ATAGAGTACAAAAATGGGGAGGG + Intronic
1117316936 14:54580337-54580359 GTAAAGAAACAGAAAGGGGTGGG - Intronic
1117574806 14:57087205-57087227 GGAGACTACAAGAATGGGGAGGG + Intergenic
1120277023 14:82388910-82388932 GTGGAGAACCAGAAGGGGACTGG + Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1122286542 14:100655789-100655811 GGAGAGCACCAGAGTGAGGAGGG - Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1125912177 15:43450810-43450832 GTAGAGATTCTGAGTGGGGAGGG - Intronic
1127647371 15:60971969-60971991 GGAGAGAACAAGAATGGGAGAGG + Intronic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128552286 15:68606088-68606110 GCAGAGAAGCAGATTGGGGTGGG + Intronic
1129154540 15:73709650-73709672 GCTGAGGACCAGGATGGGGAGGG + Exonic
1129640421 15:77371217-77371239 GGAGTGAACCAGAATGTGAAAGG - Intronic
1129786715 15:78314559-78314581 GTAGAGATTCAGAAGGGGAATGG + Intergenic
1132148318 15:99441816-99441838 GTAGAGAAAAAGCTTGGGGATGG - Intergenic
1133100123 16:3474391-3474413 GCAGAGAACCACCCTGGGGAGGG + Intronic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1134802854 16:17101322-17101344 GTAGAGAGCCAGACAGGTGAAGG - Intergenic
1135053001 16:19207521-19207543 GAAGAGACAGAGAATGGGGAGGG + Intronic
1135660177 16:24289606-24289628 GTAGGGAGCTAGAATGGGGATGG - Intronic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1139993816 16:70961637-70961659 TTAGAGAAACATTATGGGGATGG - Intronic
1141794278 16:86259462-86259484 AAAGAGTACCAGAATTGGGATGG - Intergenic
1141984465 16:87570946-87570968 GCAGAGACCCAGGATGGGGAGGG - Intergenic
1143045654 17:4076822-4076844 GTAAAGAACCGGAAGGGGGTTGG - Intronic
1143250988 17:5522837-5522859 GTAGAGAACAAGGAGGAGGAAGG + Intronic
1143523803 17:7461389-7461411 GTAGAGACCCACGCTGGGGAAGG + Exonic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1146455219 17:33004418-33004440 GAAGAGAAAGAGAAAGGGGAAGG + Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147159028 17:38560016-38560038 GGAGAGAACAAGGATGGGGGAGG + Intronic
1147870384 17:43582965-43582987 GTTTAGAAACAGAATGGGAATGG - Intergenic
1147888222 17:43698698-43698720 GTAGAGAGCCAAGATAGGGAGGG + Intergenic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1150159980 17:62888984-62889006 GGAGAGAACCAGAAAGGAGGAGG - Intergenic
1151394886 17:73816402-73816424 GAAGGCAACCAGAATGGAGAGGG + Intergenic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1155535106 18:26809013-26809035 GTATAGAACCATAATGGCCATGG + Intergenic
1158212975 18:55070724-55070746 GAAGAGAACAGGCATGGGGAGGG - Intergenic
1159945889 18:74444703-74444725 GTCGAGAACCGGACTGGTGAAGG + Intronic
1160735748 19:661680-661702 GTAGAGACCCAGGAAGGGGCTGG - Intronic
1163001482 19:14370590-14370612 GTAAAGAAAAAAAATGGGGAAGG + Intergenic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167045682 19:47047507-47047529 GTAAAGGACGTGAATGGGGACGG - Intronic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1168454313 19:56494089-56494111 GGAGAAGACCTGAATGGGGAGGG + Intergenic
925949889 2:8900205-8900227 GTGGAGATCCATACTGGGGATGG + Intronic
927067828 2:19491762-19491784 GAAGAGAAACAGAAGAGGGAGGG + Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927699970 2:25261785-25261807 GGAGAGGACCAGGATAGGGAGGG - Intronic
927886342 2:26721062-26721084 TTAGACATCCAGGATGGGGACGG - Intronic
928059302 2:28094695-28094717 ATAGAGAACCGGAAAGGGAATGG - Intronic
928119739 2:28575022-28575044 GTAGATACCCAGAAGTGGGATGG + Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928994679 2:37275118-37275140 GGACAGAACCAGAATGGGAGTGG - Intronic
929266948 2:39928983-39929005 CTAGAGAACCAATACGGGGAAGG - Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
935867583 2:107407629-107407651 GAAGAGAAAGAGAAAGGGGAGGG - Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938049777 2:128158180-128158202 GTAGGGTAGGAGAATGGGGAAGG + Intronic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938199350 2:129360480-129360502 CTAGAGAAGCAGTGTGGGGAGGG - Intergenic
938814033 2:134881517-134881539 GTAGAGGTACAGAAGGGGGATGG - Intronic
941325348 2:164107509-164107531 GTAATGAACCAGAATACGGAGGG - Intergenic
943924215 2:193750800-193750822 GGAGAGAAGGAGAATGGAGAAGG - Intergenic
944729009 2:202499413-202499435 GTGGGGATCCATAATGGGGATGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946733362 2:222730341-222730363 GGAGAGAAAATGAATGGGGAGGG + Intergenic
947084816 2:226438853-226438875 GTAGAAAACAAGAATGAAGAGGG - Intergenic
948169629 2:235890492-235890514 GGACAGCACCAGAGTGGGGAGGG + Intronic
1169081740 20:2801394-2801416 GTAAAGAACCAGACCGTGGAAGG - Intergenic
1171316397 20:24199508-24199530 GCAGAGAAACAGGATAGGGAAGG - Intergenic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172808767 20:37632231-37632253 GGAGAGAAATAGAGTGGGGATGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1177972117 21:27803037-27803059 CTAGAGAAAGAGAATGGAGAGGG - Intergenic
1178901380 21:36601611-36601633 TTAGAGACCCAGGAAGGGGAGGG + Intergenic
1178965001 21:37108551-37108573 GTAGAGCTCCAGAATGTGAAAGG + Intronic
1179302857 21:40128174-40128196 GCAGAGAAACAGGATGGGCATGG - Intronic
1182830932 22:33304086-33304108 GCAGAGACCCAGAAAGGGGAAGG - Intronic
1184039829 22:41936213-41936235 GGAGAGAAGCAGAGTGGGGCTGG + Intergenic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
949167466 3:959517-959539 ATATATAAACAGAATGGGGATGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952973963 3:38678499-38678521 AAAGAGAATCAGAATGGGAAGGG + Intergenic
953081239 3:39620530-39620552 TTAGAGACCCAGAAATGGGAGGG + Intergenic
953328134 3:42029884-42029906 GTGGAGAGCCAGAATAGGGGAGG + Intronic
953622937 3:44548420-44548442 GTAGGGATCCATACTGGGGAAGG + Intergenic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
958549213 3:95592980-95593002 GTGGAGATCCATACTGGGGATGG + Intergenic
958847548 3:99283073-99283095 ATAGAGAACCAGAGGCGGGAGGG + Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
960301784 3:116011388-116011410 GTAGAAAGCCAGAATTGTGAAGG + Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
962371900 3:134827750-134827772 GCAGAGACTGAGAATGGGGAGGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963021254 3:140874849-140874871 GTAGGGATCCACACTGGGGATGG - Intergenic
964417924 3:156469133-156469155 GAAGAGAAAAAGAATGGAGAAGG + Intronic
964577067 3:158183064-158183086 GTAAAGAATTAGAAAGGGGAAGG - Intronic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
967883074 3:194315310-194315332 GGAGAGACCCAGAAAGGGAAAGG + Intergenic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969728569 4:8940002-8940024 GGAGAGAACCGGAGTGGGGAGGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970471165 4:16380708-16380730 GCACAGAACCACAATGGGCAGGG - Intergenic
971219146 4:24689097-24689119 GTAGAGAAACAGAAGGGATACGG - Intergenic
971459961 4:26884488-26884510 GAAAAGAACCAGAATAGGGCTGG + Intronic
972609999 4:40647566-40647588 GTAGAAAACCACAATGAGGCTGG - Intergenic
974205421 4:58696493-58696515 GCAGAGAACAGGAGTGGGGAAGG + Intergenic
977163201 4:93662251-93662273 GAAGAGAACCAGAGTTGGCAGGG - Intronic
977695459 4:99960041-99960063 GTAGATACCCAGAAGTGGGATGG - Intergenic
978270185 4:106879117-106879139 GAAGGGAAACAGAATGGGAAGGG + Intergenic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979428568 4:120598473-120598495 GTAGAGACCCAGTAATGGGATGG - Intergenic
979547314 4:121952181-121952203 GAAGAGAAAGAGAGTGGGGAGGG - Intergenic
980000388 4:127480690-127480712 CTAGAGATCCAGATTGGGGAAGG - Intergenic
980551016 4:134335350-134335372 GTAGAGAAATGGAATGGTGATGG + Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
981213140 4:142132246-142132268 GTAGAGAATAAGATTGGAGAAGG + Intronic
981462493 4:145029501-145029523 CTAGAGAACAAGCATGGGAATGG + Intronic
981673187 4:147311156-147311178 GGAGAGAAACAGAAAGAGGAGGG + Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
984563012 4:181293070-181293092 GGAGAGAATCTGAATGGGCATGG - Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986182774 5:5409058-5409080 GTAGGAAACCAGATTTGGGAAGG - Intergenic
986243748 5:5985590-5985612 GTCCAGCACCAAAATGGGGAAGG - Intergenic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
987929885 5:24389669-24389691 GTGGAGATCCATACTGGGGATGG - Intergenic
988161110 5:27519173-27519195 CTAGAGAACCAGTATGGGAATGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988629757 5:32916418-32916440 GTAGATTAACAGAATGAGGATGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989022681 5:37028277-37028299 GGAGAAAACCAGATAGGGGAAGG - Intronic
991052417 5:62287394-62287416 CTAGTGAACCAGAAAAGGGAGGG + Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992349684 5:75916299-75916321 GAAGAGGACGAGAAAGGGGAAGG - Intergenic
992779595 5:80116040-80116062 TGAGAGAACCATGATGGGGAAGG + Intronic
993174580 5:84467252-84467274 GTTGAGAACCAGAAATGTGAGGG + Intergenic
994367684 5:98934059-98934081 GGAGAGAAGTAGAATTGGGAAGG + Intergenic
994455712 5:100004786-100004808 GGAGAGAACCAGAGTGAGGGAGG - Intergenic
995972760 5:117992673-117992695 GTAGAGAAATAGATTGGGGTGGG + Intergenic
997413546 5:133708110-133708132 GAAGAGAAAGAGAAGGGGGAGGG + Intergenic
997922773 5:137998811-137998833 GAAGAGGACCATGATGGGGATGG - Intronic
998396625 5:141822773-141822795 GTACGAAACCAGAATGTGGAAGG - Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000909791 5:167008037-167008059 GTAGAGAAGAGGAACGGGGAAGG - Intergenic
1001040881 5:168334319-168334341 GCAGAGAAACAGGATGGGGCCGG - Intronic
1001148083 5:169202533-169202555 TTAGAGAAGCAGAATGGCAAGGG - Intronic
1002056271 5:176599533-176599555 GGAGAGAAGCAGGTTGGGGAGGG + Exonic
1002774745 6:319078-319100 CTAGAGAACTAGAATGGGAGGGG + Intronic
1002952536 6:1829129-1829151 TGAGAGAACAAGAAAGGGGAGGG + Intronic
1003366086 6:5476197-5476219 GGAGAGAACCAGGATATGGATGG + Intronic
1004531349 6:16458196-16458218 GTGGGGATCCATAATGGGGATGG - Intronic
1006165539 6:32062300-32062322 GTCCAGTACAAGAATGGGGATGG - Intronic
1006300589 6:33191900-33191922 TTAGAGACCCTGAATGGGGATGG - Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1010540705 6:77088515-77088537 GTAGAAAACAACAATGGGAATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010900950 6:81426781-81426803 GGAGAGAACTAGGATGTGGATGG - Intergenic
1011336356 6:86265689-86265711 GAAGTGAAACAGACTGGGGAAGG - Intergenic
1011472729 6:87723953-87723975 AAAGAGACCCAGAATGGGGCTGG - Intergenic
1011888316 6:92125768-92125790 GGAGAGAGGCAGAATGGGGTGGG - Intergenic
1014175940 6:118331284-118331306 CTAGAGAACGAGAATGTGGGTGG + Intergenic
1014334492 6:120115976-120115998 GTTGAGAGCCAGGGTGGGGAAGG - Intergenic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1018430944 6:163722419-163722441 GTGGAGAACCACATTGGGGTGGG + Intergenic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019702650 7:2481445-2481467 GTAAAGAACCAAGATGGGGATGG + Intergenic
1020242795 7:6408846-6408868 GTACAGAACCTTAAGGGGGAAGG - Intergenic
1020674140 7:11160069-11160091 GGAGACTACTAGAATGGGGAGGG - Intronic
1021498594 7:21304314-21304336 TCAGAGACCCAAAATGGGGAGGG + Intergenic
1022762502 7:33370783-33370805 GTACAGAAACAGAAAGGGGCAGG - Intronic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1023033773 7:36112692-36112714 GGAGAGAACCAGAGTGAGTAAGG + Intergenic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1024867172 7:53917008-53917030 GTAGAGAAGAATAATGGTGATGG + Intergenic
1026647700 7:72186576-72186598 GGAGACTACCAGAGTGGGGAAGG - Intronic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1030947718 7:115746083-115746105 GTAGGGAACCATCCTGGGGATGG - Intergenic
1032176485 7:129632525-129632547 GGAGAGGACTAGGATGGGGAAGG - Intronic
1032404129 7:131643561-131643583 ATAGAGAACCAGTAGGGAGAGGG - Intergenic
1034757015 7:153632018-153632040 GCAAAGAACCAGACTGGGCATGG - Intergenic
1036419610 8:8583552-8583574 GGAGAGAACCTGAAGTGGGATGG + Intergenic
1036827771 8:11991748-11991770 GTATGGAAACAAAATGGGGAAGG - Intergenic
1038430805 8:27497879-27497901 GTGGAGATCCATACTGGGGACGG + Intronic
1039022519 8:33223511-33223533 GCAGAGATCCAGATGGGGGAAGG + Intergenic
1039337506 8:36608151-36608173 GGAGAGAAACAGATTGGGGGTGG - Intergenic
1039693194 8:39882981-39883003 GTGGGGATCCATAATGGGGATGG + Intergenic
1040507240 8:48059884-48059906 AAAGAGCAACAGAATGGGGATGG - Intronic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1041707552 8:60862484-60862506 GTAGATTAACAGAAAGGGGAGGG + Intronic
1042074867 8:64981282-64981304 GTAGTGAGGAAGAATGGGGAGGG + Intergenic
1043257031 8:78150090-78150112 GTGGGGATCCATAATGGGGATGG - Intergenic
1043389186 8:79775404-79775426 GTAGGGGAACAGAACGGGGATGG - Intergenic
1043448757 8:80344960-80344982 GTAGACATCCAGAAATGGGATGG + Intergenic
1044319486 8:90786455-90786477 AAAGAGAACAAGAATGGGAAGGG + Intronic
1044772130 8:95647086-95647108 GAAGAGAATAGGAATGGGGAGGG + Intergenic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1046104944 8:109653829-109653851 CTAAAGAACCAGAAATGGGAAGG - Intronic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049757672 8:144318010-144318032 GTAGAGATCTGGAATGGGAATGG + Exonic
1049847556 8:144810428-144810450 GTAGGGCACCAAGATGGGGAGGG + Intronic
1050192629 9:3044180-3044202 GTAGAAAACTACAATGGGGATGG - Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1053338640 9:37302432-37302454 GGAGAGAAACAGAAAGGGAAAGG - Intronic
1057435181 9:95033400-95033422 GTAGAGAAACACAACAGGGAGGG - Intronic
1058001330 9:99869092-99869114 TTAGAGGCCCAGCATGGGGATGG - Intergenic
1058026895 9:100150917-100150939 TAAGAGAACCAGAGAGGGGATGG + Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058836711 9:108863750-108863772 GTAGAGAAACACACTGTGGAGGG - Exonic
1059220354 9:112610434-112610456 GTAGATAACCAAAAGGGGTATGG + Intronic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1060556780 9:124512130-124512152 GCAGAGAACGAGAAGCGGGAAGG + Intergenic
1060724282 9:125996963-125996985 GCAGAGAGCAAGAAGGGGGAAGG - Intergenic
1060995660 9:127873856-127873878 GCAGAGAACCAGAGAGGGGCAGG - Intronic
1061178241 9:129009929-129009951 GTAGAGGACGGGGATGGGGACGG - Intronic
1061216490 9:129224786-129224808 GTACAGACCCAGAATGAGGGGGG - Intergenic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1186099825 X:6144269-6144291 GTAGAATCCCAGAATGGAGAGGG + Intronic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1188889504 X:35592852-35592874 GTGGACTACCAGAGTGGGGAAGG - Intergenic
1189346853 X:40248337-40248359 GGAGAGAAGCAGAGTGGGGGTGG - Intergenic
1190691041 X:52913428-52913450 GAAGACAGCCAGAGTGGGGAGGG + Intergenic
1190694942 X:52942364-52942386 GAAGACAGCCAGAGTGGGGAGGG - Intronic
1190870077 X:54417491-54417513 GGGGACTACCAGAATGGGGAGGG + Intergenic
1191051053 X:56193081-56193103 TTTGAGAACCAGAATGTGTAAGG + Intergenic
1191961728 X:66710837-66710859 AGAGAGAACCAAAATGGGGTTGG + Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1192341877 X:70269633-70269655 GGAGAAAACCAGAAAGAGGATGG - Intronic
1192725112 X:73741771-73741793 TTAGAGAACCAGCATGGTGAGGG - Intergenic
1193053134 X:77122878-77122900 ACAGAGAACAAGAATGGGAATGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195116771 X:101707164-101707186 GCAGATAACCAGAAGGGAGATGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197154920 X:123259914-123259936 GAAGACAACCAGGATAGGGAGGG - Intronic
1197854041 X:130895697-130895719 ACAGAGCACCAGAAAGGGGAGGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198714312 X:139540137-139540159 GAATAGAACCAGAAGGGAGATGG - Intronic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199421129 X:147645718-147645740 GTAGATACCCAGTATTGGGATGG - Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200075513 X:153548661-153548683 GTAGAGGACCAGGATGATGACGG - Exonic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201604693 Y:15771965-15771987 GTGGGGAACCATATTGGGGATGG - Intergenic