ID: 1184804923

View in Genome Browser
Species Human (GRCh38)
Location 22:46788557-46788579
Sequence GGTCCCAGTGGGGCTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 8, 3: 49, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184804923_1184804931 -1 Left 1184804923 22:46788557-46788579 CCAGCACCAGCCCCACTGGGACC 0: 1
1: 0
2: 8
3: 49
4: 447
Right 1184804931 22:46788579-46788601 CCGCCTGTGGTTCATGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 93
1184804923_1184804935 23 Left 1184804923 22:46788557-46788579 CCAGCACCAGCCCCACTGGGACC 0: 1
1: 0
2: 8
3: 49
4: 447
Right 1184804935 22:46788603-46788625 CGTCTGTGTCCTCAGCACCCAGG 0: 1
1: 0
2: 4
3: 39
4: 403
1184804923_1184804932 0 Left 1184804923 22:46788557-46788579 CCAGCACCAGCCCCACTGGGACC 0: 1
1: 0
2: 8
3: 49
4: 447
Right 1184804932 22:46788580-46788602 CGCCTGTGGTTCATGCCACAGGG 0: 1
1: 0
2: 1
3: 27
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184804923 Original CRISPR GGTCCCAGTGGGGCTGGTGC TGG (reversed) Intronic
900090349 1:917602-917624 GGTCCCAGTGCTGCAGGTGTGGG + Intergenic
900119063 1:1040957-1040979 GGGGCCAGTGGGGCGGGGGCAGG + Intronic
900144231 1:1150945-1150967 GTGCCCGGTGGGGCTGCTGCCGG + Intergenic
900156640 1:1205857-1205879 AGGCCCAGTGTGGCTGGTGGTGG - Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900497186 1:2981066-2981088 GGTAACAGGGGGTCTGGTGCCGG + Intergenic
900600403 1:3500323-3500345 GCTCCAAGTGAGCCTGGTGCAGG + Intronic
900933542 1:5751403-5751425 TTTCCCAGTGGTGCTTGTGCGGG - Intergenic
901420124 1:9145139-9145161 GATCCCACCCGGGCTGGTGCAGG + Intergenic
901761804 1:11476835-11476857 GGTGGCAGTGGAGCTGGTGCAGG - Intergenic
902090207 1:13897027-13897049 AGTCCCAGTTTGGCTGTTGCTGG + Intergenic
902285908 1:15408993-15409015 GGCCCCAGTGGTTCTGATGCTGG + Intergenic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
902405556 1:16181629-16181651 GGGCCCAGAAGGCCTGGTGCAGG - Intergenic
902655991 1:17868786-17868808 GAGATCAGTGGGGCTGGTGCGGG + Intergenic
903173808 1:21569119-21569141 GGCCCCCGTGGGGATGGTGGGGG + Intronic
903330663 1:22595406-22595428 GGTCCCCGTGTGCCTGGGGCTGG + Intronic
903476429 1:23622186-23622208 GGCCTCAGTGGTGCTGGTGAAGG - Intronic
903501285 1:23801198-23801220 GGTCGCAGGGGGCCTGGTGCTGG + Intergenic
903546143 1:24124472-24124494 AGTCCAAGTGGGGCTTGTGAAGG + Intronic
904402011 1:30263116-30263138 GAGCTCTGTGGGGCTGGTGCTGG + Intergenic
904827031 1:33280479-33280501 GGTCCGAGTGGGCTTGGGGCTGG + Intronic
905089624 1:35418486-35418508 GGTTCCAGTGGGGGTGGAGATGG + Exonic
905809612 1:40902515-40902537 GGCCACAGTGGGGCTGGTTCTGG + Intergenic
906510447 1:46407668-46407690 GTCCCCAGTGAGGCAGGTGCTGG + Intronic
906948090 1:50312862-50312884 GATCCCAGCGGGGCTAGAGCTGG - Intergenic
907306303 1:53514924-53514946 GGCCCCAGTGAGGGAGGTGCTGG + Intronic
909024657 1:70468323-70468345 GGTGCTGGTGGGGCTGGGGCTGG - Intergenic
910209541 1:84779071-84779093 GGACCCAGTGGGGGTGGGGAGGG - Intergenic
911046831 1:93635682-93635704 GGTCCCACAGGGGATGGCGCTGG + Intronic
912524010 1:110267198-110267220 GGGCCCAGGAGGGCTGCTGCTGG + Intronic
915016366 1:152737751-152737773 GGGGCCAGTGGGGCTTGTGGTGG - Intronic
915940531 1:160115782-160115804 TGTCCCAGACGGGCTGGTGTGGG + Exonic
920560062 1:206932510-206932532 GGTGCCCCTGGGCCTGGTGCTGG - Exonic
922572616 1:226642934-226642956 GGTCCCAGTGTGGATGGAGAAGG + Intronic
922734505 1:227972003-227972025 GGTCGCAGTGGGGCGAGAGCTGG + Intergenic
922813480 1:228432091-228432113 GGTCCGTGTGGGTCTGGTTCTGG + Intergenic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1063116631 10:3076385-3076407 GGTAGCAGAGGGGCTGGGGCGGG - Intronic
1063295418 10:4800300-4800322 GGTCCCTGTGGGACTGTTGAAGG + Intronic
1064042734 10:11982418-11982440 GGAGCCAGTGGGCCTGGTGCAGG - Intronic
1065435855 10:25703160-25703182 GGACCCAGTTGGGCTGGGCCTGG + Intergenic
1065484196 10:26221468-26221490 GGTGCTAGTGGTGGTGGTGCTGG + Intronic
1066733043 10:38450813-38450835 GGTCACAGTGGGGCGAGAGCTGG + Intergenic
1067078780 10:43202608-43202630 GGTCTGAGTGGGGCTGGTGTGGG - Intronic
1067337910 10:45379325-45379347 GGTCTGAGTGTGGCTGCTGCAGG - Intronic
1067446456 10:46351127-46351149 GGCCCCTGTGGAGCTGGTGGTGG - Intergenic
1067478082 10:46579200-46579222 GGTCGCAGAGGGGCCGGGGCTGG - Intronic
1067590926 10:47509640-47509662 GGCCCCTGTGGAGCTGGTGGTGG + Intronic
1067616658 10:47762587-47762609 GGTCGCAGAGGGGCCGGGGCTGG + Intergenic
1067638045 10:48017740-48017762 GGCCCCTGTGGAGCTGGTGGTGG + Intergenic
1067879001 10:50027442-50027464 GATGGCAGTGGCGCTGGTGCTGG - Intergenic
1068566279 10:58579119-58579141 GGTCCCAGTGGGGCTTCAGTGGG - Intronic
1069059594 10:63881938-63881960 GGTCCCATGGTGGATGGTGCTGG + Intergenic
1069565640 10:69461677-69461699 GGGCACAGTGTGGCTGGTGGTGG + Intronic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069787504 10:70998140-70998162 ACTCTCAGTGGGGCTGGGGCTGG + Intergenic
1069850010 10:71398178-71398200 GGTCGCAGTGGGGCGGCGGCTGG - Intronic
1069858818 10:71457554-71457576 GGTCCACATGGGGCAGGTGCTGG + Intronic
1069863042 10:71483123-71483145 GGTGCCAGTAAGGCTGGGGCTGG + Intronic
1069948051 10:72000943-72000965 GGGCCTAGTGTGGCTGGTGTGGG - Intronic
1070134645 10:73682163-73682185 GGCCCCTGTGGAGCTGGTGGTGG + Intronic
1070590786 10:77799504-77799526 GGTGCCAGTGTGGTTGGTTCTGG - Intronic
1072220780 10:93325930-93325952 GGGCCCCGAGGTGCTGGTGCAGG + Exonic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1072551271 10:96479499-96479521 GATTGCAGTGGGGATGGTGCTGG - Intronic
1072728038 10:97826717-97826739 GGTGGCAGTGAGCCTGGTGCAGG + Intergenic
1073430146 10:103480634-103480656 AGTCCCAGAGGGGCTGTTGGAGG + Intergenic
1074455283 10:113590631-113590653 GGTCGCAGGTGGGCTGGGGCAGG + Exonic
1074855963 10:117473662-117473684 GGAGCCAGTGGGGATGGAGCAGG + Intergenic
1074977626 10:118594437-118594459 GGTCCCAGTCGGCCTGGCTCTGG + Exonic
1075468753 10:122672246-122672268 GGTCACAGTGGGGCCACTGCAGG - Intergenic
1075469854 10:122679964-122679986 GCTCCCAGTGGGGCCTGTGTTGG + Intergenic
1075807378 10:125199748-125199770 GGTCCCTGTGGGGCCACTGCAGG - Intergenic
1075871215 10:125773781-125773803 GGTCCCCGAGGGGCTGGGTCGGG + Intronic
1076252187 10:128993720-128993742 GGACCCAGAGGGGCTGGAGCAGG - Intergenic
1076743040 10:132497546-132497568 GGGCCCCTTGGGGCTGGTGTTGG - Intergenic
1076836386 10:133023211-133023233 GTGCCCTGTGGGGCTGGTCCAGG + Intergenic
1076904589 10:133355694-133355716 GGCCCCAGTGGGGATGGGGCAGG + Intronic
1077010090 11:375811-375833 GGTCACAGGGTGGCTGGGGCAGG - Intronic
1077099993 11:818468-818490 GCCCCCAGTAGGGCTGGGGCAGG + Intergenic
1077144786 11:1040031-1040053 GGGCCCAGCGGGGCAGGGGCAGG - Intergenic
1077168205 11:1153155-1153177 GGTCCGGGTGGGGCTGCAGCAGG - Intergenic
1077410955 11:2403672-2403694 CTTCCCAGTGGGGCTGGTCAGGG + Exonic
1080797819 11:35581859-35581881 TGTCCCTGTGGGGCCTGTGCTGG - Intergenic
1080853535 11:36091878-36091900 GGTCCCATGGGGCCTGGTCCAGG - Intronic
1081600370 11:44488536-44488558 GGTGCCACTGGGGCTGGTGCTGG - Intergenic
1083176402 11:60952545-60952567 AGACCCAGTGGGGCTAGGGCAGG + Intergenic
1083176680 11:60954516-60954538 GGTACCAGGGGGCCAGGTGCTGG + Intergenic
1083618648 11:64038287-64038309 GGTCCCAGAGGGGAGGCTGCAGG - Intronic
1084109880 11:67007224-67007246 TGGCCCAGAGGGGCTGGTACGGG + Exonic
1084515823 11:69637553-69637575 GGTCTGAGAGGGGCTGGGGCCGG + Intergenic
1085013767 11:73159323-73159345 GGCCTCAGTGGGGATGGTGTGGG - Intergenic
1085257481 11:75183953-75183975 GGTCCCAGTGAAGATGGAGCAGG + Intronic
1086664018 11:89457347-89457369 AGTGGCAGTGTGGCTGGTGCAGG - Intronic
1086753539 11:90529738-90529760 GGCCACAGTGGGGCAGGGGCAGG - Intergenic
1088588355 11:111379491-111379513 GGTCCCCGCGGGGCCGGTGCAGG - Exonic
1089392300 11:118110489-118110511 AGTCCCAGCTGGGCTGGTGACGG - Intronic
1089611223 11:119670512-119670534 GGTCCCAGTGGGCCCCATGCAGG - Intronic
1091743651 12:2977207-2977229 GGTCCCTGTGAGGCTGGGCCAGG + Intronic
1092291717 12:7163304-7163326 GGTCGCAGTGTGGCTGGCTCTGG + Intergenic
1092888783 12:12949670-12949692 CGTCCCACTGGGGCTGTCGCTGG + Exonic
1096500329 12:52060701-52060723 GGTCCGAGTGAGGCTGGGGTAGG + Intergenic
1096669819 12:53191948-53191970 CGTGGCAGTGGGGCTGGGGCTGG - Exonic
1099034816 12:77573084-77573106 GGACCCAGTAGCGATGGTGCTGG + Intergenic
1102706270 12:114883594-114883616 TGTCCCAGTAAGGTTGGTGCTGG - Intergenic
1104467100 12:128999545-128999567 GGCCCCACTGGGGCTGGGACCGG - Intergenic
1104745514 12:131207939-131207961 GATCTCAGTGGGGCTGGCTCAGG - Intergenic
1104788826 12:131469170-131469192 GATCTCAGTGGGGCTGGCTCAGG + Intergenic
1105034423 12:132908493-132908515 GGTCCCAGAGGGGCGGGTCGGGG + Intronic
1105209402 13:18249031-18249053 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1106289161 13:28344485-28344507 GGTGACAGTGGGGCAGATGCTGG - Intronic
1106698017 13:32199157-32199179 ATTCCCACTGGGGCTGCTGCTGG + Intronic
1108817099 13:54305379-54305401 GGTCCTACTGGGGCTGCTGTGGG - Intergenic
1109136125 13:58653719-58653741 AGTGCCACTGGTGCTGGTGCTGG - Intergenic
1113593828 13:111518047-111518069 GGAGCCAGGGGGGCTGGTGAGGG - Intergenic
1113835492 13:113326026-113326048 GGTCCTCGGGGAGCTGGTGCGGG - Exonic
1113848917 13:113407096-113407118 GGTCCCAGTGGGGATGATGCAGG + Intergenic
1114429205 14:22645907-22645929 TGTCACAGTGGGGCTGGAGAGGG - Intergenic
1114527733 14:23377010-23377032 GGTCTCTAGGGGGCTGGTGCAGG + Exonic
1114568020 14:23646728-23646750 GCTTCCAGTGAGGCTGGTGGAGG + Intergenic
1114664352 14:24369213-24369235 GGGTCCAGAGGGGCTGGAGCTGG - Intronic
1118561416 14:67087367-67087389 GGGCCCAGTGGTGCTTGTCCAGG - Intronic
1119264092 14:73253973-73253995 GGCCCGCATGGGGCTGGTGCTGG + Intronic
1121321643 14:92995055-92995077 GCTCCCAGTGGTGGTGGTGGTGG - Intronic
1121893069 14:97616032-97616054 GGTGCCAGTGGTGATGGTGGTGG + Intergenic
1122206475 14:100150359-100150381 GGTGGGAGTGGGGCTGGAGCTGG - Intronic
1122632370 14:103112793-103112815 GGTGCCGGTGGGGGTGGGGCTGG + Intergenic
1122799643 14:104223221-104223243 GGGCCCAGAGGGGCTTGTACAGG - Intergenic
1122836984 14:104435295-104435317 GGTCACAGTGAGGCTGGGCCAGG - Intergenic
1202846658 14_GL000009v2_random:183546-183568 GGTAACAGTGGGGCTGGGGGAGG - Intergenic
1124046632 15:26156405-26156427 AGGCCCAGTTGGGCTTGTGCAGG + Intergenic
1124954036 15:34348187-34348209 TGCCTCAGTGGGGCTGGGGCTGG + Exonic
1127047559 15:55043187-55043209 GGTACCAGTGGTGGTGGTGGTGG + Intergenic
1127811349 15:62568173-62568195 TGTCCCAGTGTGGCTGGGGCTGG + Intronic
1128374710 15:67066423-67066445 CGACCCAGTGGGGCTGGAGATGG + Intronic
1128849914 15:70943928-70943950 GGCTCCAGTGGGGCTGGAGAGGG - Intronic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1131559773 15:93429529-93429551 AGCCCCTGTGGGGCTGGTGGTGG + Intergenic
1132660366 16:1058335-1058357 GGTCCCAGGGAGGCCGGCGCTGG + Intergenic
1132662792 16:1069061-1069083 GGTCCCAGCTGGGCTGCGGCAGG + Intergenic
1134062269 16:11206287-11206309 GGCCCCAGTGGGGCTGCTATGGG + Intergenic
1136070249 16:27783103-27783125 GGGCCCAGTGGGCGTGGAGCTGG + Intergenic
1136158736 16:28403716-28403738 GGTCCGGGTGGGGCCGGTGAGGG - Intronic
1136204352 16:28711567-28711589 GGTCCGGGTGGGGCCGGTGAGGG + Intronic
1136565557 16:31067871-31067893 GGTCACTGTGGGGCTGGCGGAGG - Intronic
1136606581 16:31338302-31338324 GGTGCCAGTGAGGCTGGGGGAGG + Intergenic
1137494572 16:48959872-48959894 GGTCCCAGTGGGTCTGAGACTGG + Intergenic
1137667326 16:50259359-50259381 GGTCACACTGGGCCGGGTGCAGG + Intronic
1138247271 16:55477360-55477382 GAGCCCAGTGGGGCTGGGCCAGG + Intronic
1138535169 16:57656110-57656132 GGTCCAAATGGGGCGGGTGGTGG + Intronic
1139348984 16:66323469-66323491 ATTCCCAGTGGGGCTGGGTCAGG + Intergenic
1139357685 16:66377129-66377151 GGGTCCAGTGAGGCTGGGGCAGG + Intronic
1140524703 16:75612908-75612930 GATCCCATTGTGGCTGGTCCAGG - Intronic
1141311802 16:82920621-82920643 GGCCCCACTGTGGATGGTGCTGG + Intronic
1141656547 16:85419795-85419817 GGTCCGAGTAGGGCTTCTGCAGG + Intergenic
1141832199 16:86516030-86516052 GCACCCAGGGGGGCTTGTGCAGG + Intergenic
1141984779 16:87572685-87572707 GGTCCCACAGGTGCAGGTGCTGG + Intergenic
1142010569 16:87711838-87711860 GGCCCAAGGGGGGCTGGTGCAGG - Intronic
1142033013 16:87847715-87847737 GGTCACAGTGGGGGTGGGGAGGG + Intronic
1142352520 16:89586660-89586682 AGTCCCACTGGGCCTGGGGCAGG - Exonic
1142803078 17:2357108-2357130 GGTCACATCGGGGCTGGTGAAGG + Intronic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143245922 17:5485964-5485986 AGGCCCAGAGGGGCTGGTCCCGG - Intronic
1143625907 17:8110051-8110073 GGGCCCAGCGGGGCAGGGGCCGG - Intronic
1143915425 17:10288955-10288977 GCTCCCAGGGGTGCTGATGCTGG - Intergenic
1144855255 17:18263990-18264012 GGTGCCACTGGTGCTGGAGCCGG + Exonic
1145205556 17:20983328-20983350 GGTCCCAGTATGGCTGTTGCAGG - Intergenic
1145413562 17:22694597-22694619 GGTCTCTGTGTGACTGGTGCGGG - Intergenic
1145414595 17:22704182-22704204 GGTCCCAGTGCGACCGGTGAGGG + Intergenic
1146280609 17:31541886-31541908 GCTCCCAGTGGACTTGGTGCAGG - Intergenic
1146576826 17:34001444-34001466 GGGTCCAGTGGGGCTGGTGCTGG + Intronic
1146603429 17:34237784-34237806 GGTCAATGTGGTGCTGGTGCTGG + Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1146941551 17:36847220-36847242 GGTGGCAGTGGGGCTAGTCCAGG - Intergenic
1147786263 17:42980696-42980718 GGCCCCAGTGGGGGCGGTGGCGG + Exonic
1148740467 17:49889887-49889909 GGTTCCAGTGGGGGTGGGGCAGG + Intergenic
1148751696 17:49948994-49949016 GGTGCCAGTGGGGCTGAGGAAGG + Intergenic
1149655928 17:58309613-58309635 TGTCCCACAGGGGCTGGTGATGG - Intronic
1149895075 17:60422677-60422699 GGTCCCGGAGGGGCTGGTTTTGG + Intronic
1151122456 17:71808231-71808253 GATCCCAGAGGGTCTGGTGCGGG + Intergenic
1151422455 17:74007401-74007423 GGTCACAGTGGAGCTGCTCCTGG + Intergenic
1152037120 17:77880363-77880385 GGTCCCAGCAGGGCAGGTTCAGG + Intergenic
1152093477 17:78259163-78259185 GGTCCCAGTTGGGGAAGTGCAGG - Intergenic
1152097045 17:78278443-78278465 GGTCCCAGCAGAGCTGCTGCTGG - Intergenic
1152298551 17:79482493-79482515 GGCCCCAGTGGGGCTCCTTCTGG + Exonic
1152335666 17:79699208-79699230 GGTGCCAGTGGGGTGGGTCCAGG - Intergenic
1152377834 17:79927892-79927914 GGTCCCTGCGGGGCTGGCTCTGG - Intergenic
1152590304 17:81208445-81208467 GGCCCCAGTGGGGGTGTTGTGGG - Intronic
1152610540 17:81313136-81313158 GGCCCCGGTGGGGCTGGGGCTGG + Exonic
1152628398 17:81398834-81398856 GGTCCCGCTGGGGCTGGGGAGGG + Intronic
1152754519 17:82081691-82081713 GGACCATGTGGGGCTGGTTCAGG + Exonic
1152756740 17:82090197-82090219 GGGGCCAGTGGGGCAGCTGCAGG + Intronic
1152938854 17:83155156-83155178 GGTGACAGTGGGGTTGTTGCTGG + Intergenic
1154015431 18:10612298-10612320 GGTTCCAGAAGAGCTGGTGCTGG + Intergenic
1154139460 18:11810524-11810546 GGTCCCAGTGGGGCTGAATATGG + Intronic
1154190080 18:12223333-12223355 GGTTCCAGAAGAGCTGGTGCTGG - Intergenic
1154293482 18:13130643-13130665 GCACCCAGTGGGGATGGGGCTGG - Intergenic
1156046617 18:32884767-32884789 GTTCCCACAGGGGCTGGTGGAGG + Intergenic
1156536750 18:37871785-37871807 GGGGCCAGTGGGGCTGGAGGAGG + Intergenic
1157721280 18:49926467-49926489 GGTCCCAGTGGGACAGGCTCTGG + Intronic
1158947488 18:62459566-62459588 GATCTCCGTGGGGCTGGGGCGGG + Intergenic
1159143469 18:64424689-64424711 GGTGGCAGTGGGGCTGGGGGAGG + Intergenic
1159563796 18:70024974-70024996 GAGCCCAATGGGGCTGGGGCAGG - Intronic
1160080761 18:75725221-75725243 GGGCCCTGTGGGGCGGGGGCGGG - Intergenic
1160257268 18:77258557-77258579 GGTCATAGTGGGGGTGGTGGTGG + Intronic
1160257321 18:77258808-77258830 GGTCATAGTGGTGGTGGTGCTGG + Intronic
1160257362 18:77258999-77259021 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160257385 18:77259111-77259133 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160257413 18:77259247-77259269 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160257438 18:77259365-77259387 GGTCACAGTGGTGGTGGTGTTGG + Intronic
1160730677 19:640421-640443 GGCTCCAGAGGGGCTGGGGCAGG + Intronic
1160781082 19:878244-878266 GGGGCCCGTGGGGCTGGGGCTGG - Intronic
1160838010 19:1133484-1133506 GGCCCCAGTGGGGCTGGCACAGG - Intronic
1160877675 19:1304806-1304828 GGTCTCACTGGGGCTGGGGTCGG - Intergenic
1160933570 19:1582452-1582474 GGACCCAGTGGGGTTGGGGATGG - Intronic
1160936690 19:1599508-1599530 GGGCGCCGTGGGGCTGGTGTGGG - Exonic
1160987866 19:1848040-1848062 GGTCCCAGGGTGGGTGGTTCCGG + Intronic
1161107923 19:2453751-2453773 GCGTCCAGTGGGGCTGGGGCTGG + Intronic
1161312034 19:3600163-3600185 GGCCACCGTGGGGCTGGTGTGGG - Exonic
1161513281 19:4683309-4683331 CGGCCCCGTGGGGCTGCTGCAGG + Intronic
1161646161 19:5454775-5454797 GGTCAGGGTGGGGCTGGTGGGGG - Intergenic
1161696437 19:5771209-5771231 GGGGCCAGTGGGGCTGGGGCAGG - Intronic
1161812236 19:6477377-6477399 GGCCTCAGTGGGGCTTGAGCTGG - Exonic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1162934728 19:13976197-13976219 GACCCCAGTGGGCCTGGTCCAGG - Intronic
1162937591 19:13989130-13989152 GCTCCCAGAGGGTCTGGGGCAGG + Intronic
1163617940 19:18340785-18340807 GGGCCGAGAGGGGCAGGTGCTGG + Intronic
1164617155 19:29674091-29674113 GGTCACACTGGAGCTGTTGCCGG + Exonic
1165094054 19:33401050-33401072 GGTACCAGTGGGGCCTGTGCAGG + Intronic
1165283803 19:34820372-34820394 GGACACAGTGGTGGTGGTGCAGG + Intergenic
1166139133 19:40796582-40796604 GGCCCCAGCAGGGCTGGTCCTGG - Exonic
1167116770 19:47493081-47493103 GGTCCCTGCGGGGCTGGGGCAGG + Intronic
1167274437 19:48528043-48528065 GGTCCTAGTGCAGCTGCTGCAGG + Intergenic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1167557509 19:50205394-50205416 GTTCCCAGCCGGGCAGGTGCTGG + Intronic
1167639979 19:50675883-50675905 GGTCCCAGGGAGGCTGAGGCAGG + Intronic
1167862544 19:52297130-52297152 GGTCCGAGCGGGGCGGGGGCGGG - Intergenic
1168114143 19:54211584-54211606 GGAACCAGTGGGGCTGCCGCAGG + Intronic
1168254199 19:55157096-55157118 CGTCTGATTGGGGCTGGTGCAGG + Exonic
1168280866 19:55304774-55304796 GGTCCCGGTGGGACTGGCCCGGG - Exonic
1168284619 19:55324695-55324717 TGTCCCAGTGGGGCTGATAGAGG + Intronic
1168312001 19:55465114-55465136 GCTCCCAAAGGGGCTGGTGCGGG + Intergenic
1168722359 19:58561160-58561182 GGGCCCAGTGAGCCTGGTTCTGG - Intergenic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925357533 2:3252702-3252724 CGTCTAAGTGGGGCTGGTGATGG + Intronic
926111484 2:10187003-10187025 GGTGCGTGCGGGGCTGGTGCCGG + Intronic
927217191 2:20674459-20674481 GGCCCAACGGGGGCTGGTGCTGG + Intergenic
927492869 2:23532109-23532131 GGCCCCAGTGGAGCGGGTTCTGG - Intronic
927554392 2:24022084-24022106 TGGCTCAGAGGGGCTGGTGCCGG + Intronic
927862957 2:26571404-26571426 GGTCCCACTTGGGTTGGAGCTGG + Intronic
927976575 2:27343018-27343040 GGAACCAGTGGGGCTGATGGAGG + Exonic
928167227 2:28980179-28980201 GGTCCCTCTGGGGCAGGTGCTGG - Intronic
928247231 2:29641072-29641094 GCTCCCAGTGGGGCTGCTGAAGG + Intronic
928407264 2:31024185-31024207 GGTGACAGTGGTGCAGGTGCTGG - Intronic
929429748 2:41877258-41877280 CGTCGGAGTGGGGCTAGTGCTGG - Intergenic
932292774 2:70596514-70596536 GCTAACAGTGGGGCTGGGGCCGG - Intergenic
932715788 2:74100178-74100200 ACCCCCAGTGGGGCTGGGGCTGG + Intronic
933744563 2:85561317-85561339 GGTCTCAGAGGGGCGGGGGCGGG - Intronic
933946609 2:87291755-87291777 ACTCCCAGTGGGGCAGTTGCTGG + Intergenic
933975272 2:87504505-87504527 GGTCCAAGAGGGGCTGCTGCAGG + Intergenic
934051885 2:88218139-88218161 GGTCCCAGGGAGGCTGGTTCTGG + Intergenic
934977652 2:98816027-98816049 TGTCCCATAGGGGCTGGTGGTGG + Intronic
935220865 2:101011274-101011296 GCTCCTAGTGGGGGTGTTGCTGG - Intronic
935530603 2:104228563-104228585 GGTTGCAATGGGTCTGGTGCAGG - Intergenic
935684282 2:105669875-105669897 GGTCCCAGTAAGGTTGGGGCTGG + Intergenic
936083731 2:109452784-109452806 GGTCCCTGGGAGGCTGGTGCTGG + Intronic
936083749 2:109452841-109452863 GGTCCCTGGGAGGCTGGTCCCGG + Intronic
936318554 2:111446308-111446330 GGTCCAAGAGGGGCTGCTGCAGG - Intergenic
936333583 2:111569786-111569808 ACTCCCAGTGGGGCAGTTGCTGG - Intergenic
936979021 2:118246882-118246904 GCTCTCAGTGGGGCTGGCCCAGG + Intergenic
937310156 2:120897109-120897131 CGTGTCAGTGGGGGTGGTGCTGG - Intronic
937457589 2:122055791-122055813 AAACCCAGTGGGGCTGGTGGGGG - Intergenic
938169975 2:129066855-129066877 GGCACCACTGGGGCTGGTCCAGG + Intergenic
938730010 2:134140099-134140121 CAACCCAGTGGGGCAGGTGCAGG - Intronic
943314117 2:186364643-186364665 AGTTCCAGTGGGGGTGGTGGGGG - Intergenic
944599725 2:201290961-201290983 GGTGGCAGTGAGGCTGGTGGAGG + Intronic
945889160 2:215409935-215409957 GGTCACAGGTGTGCTGGTGCTGG + Exonic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946417509 2:219547780-219547802 GGGTCCACTGGGGCTGTTGCTGG + Exonic
947704741 2:232265167-232265189 GGTTTCAAAGGGGCTGGTGCAGG - Intronic
948427512 2:237897032-237897054 GGACCCACTGAGGCTGGGGCAGG - Intronic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948850060 2:240701440-240701462 GGTGCCAGGGGGGCTGCGGCCGG - Intergenic
1169265008 20:4162161-4162183 GGCCCGGGTGGGGCTGGGGCAGG + Intronic
1169340884 20:4795433-4795455 GGTCCCAGTGGGGAGGGTGCTGG + Intronic
1169786045 20:9360120-9360142 GGTCACAGAGCAGCTGGTGCAGG - Intronic
1169867072 20:10213689-10213711 GCTCCCAGGGGGGCTTGTGCAGG + Intergenic
1171252808 20:23662403-23662425 GGGGTCAGTGGGTCTGGTGCTGG + Intergenic
1171290555 20:23980698-23980720 GGTCCTTCTGGGGCTGGGGCTGG - Intergenic
1171377357 20:24702608-24702630 GGTCCCAGTGGCCCTGGTCAGGG - Intergenic
1171814091 20:29768119-29768141 GGTGGCAGTGGGGCTGGTGGAGG + Intergenic
1172117416 20:32581265-32581287 GGCCCAAGTGGGGGTGGGGCAGG - Intronic
1172281687 20:33712307-33712329 GACCTCAGTGGTGCTGGTGCAGG - Intronic
1173147290 20:40535663-40535685 ATTCCCACTGGGGCAGGTGCAGG + Intergenic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1173385570 20:42584333-42584355 GAGGCCAGTGGGGCTGGAGCAGG - Intronic
1173461034 20:43243543-43243565 GGTGGCAGTGGGGATGGTGGTGG - Intergenic
1173551419 20:43935423-43935445 GGTACCAGTGGAGTTGGGGCGGG + Intronic
1174358564 20:50014314-50014336 GATCTCACTGGGGATGGTGCAGG + Intergenic
1174373766 20:50112314-50112336 GGTCCGAGTGGGGCAGTTGGTGG - Intronic
1175795448 20:61767681-61767703 GAGCCCAGTGGGGCTGAAGCAGG + Intronic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176104710 20:63380549-63380571 GCTCCCTGTGAGGCTGGCGCTGG - Intergenic
1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG + Intergenic
1176155686 20:63619229-63619251 GGTGCCATTGGGGCTGATGGGGG - Intronic
1176167699 20:63682667-63682689 GGTGCCCATAGGGCTGGTGCTGG + Intronic
1176257191 20:64158660-64158682 GGGACCAGTGGGGCAGGTGGGGG - Intronic
1176407858 21:6431223-6431245 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1176637915 21:9266342-9266364 GGTTACAGTGGGGCTGGGGGAGG + Intergenic
1178027839 21:28488449-28488471 GGACACTGTGGGGCTGGTTCTGG + Intergenic
1179586724 21:42378117-42378139 TGTGCCAGTGTGGCTGGTCCAGG - Intronic
1179683349 21:43039554-43039576 GGCCCCAGGAAGGCTGGTGCAGG - Intergenic
1179730215 21:43363532-43363554 GGGCAGGGTGGGGCTGGTGCTGG + Intergenic
1179888958 21:44326338-44326360 GGTGCCAGTGGGGCTGGGCCTGG - Intronic
1179923630 21:44520950-44520972 CGTCCCAGTGAGGCTGGTACAGG - Intronic
1179979291 21:44888042-44888064 GGTCACCGTGGGGCTGGGCCTGG + Intronic
1179979306 21:44888105-44888127 GGTCACTGTGGGGCTGGGACTGG + Intronic
1179979320 21:44888168-44888190 GGTCACTGTGGGGCTGGGACTGG + Intronic
1179979557 21:44889023-44889045 GGCCCAAGTGGGGCAGATGCGGG + Intronic
1180189046 21:46154016-46154038 GGGTCCAGTGGGGCTGGCTCTGG - Intronic
1180192559 21:46173057-46173079 GAACCCAGAGGGTCTGGTGCAGG + Intronic
1180421955 22:12873839-12873861 GGTTACAGTGGGGCTGGGGGAGG + Intergenic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1180766868 22:18350369-18350391 GGTCCTGCTGGGGCTGGGGCTGG + Intergenic
1180779445 22:18512009-18512031 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1180812161 22:18769330-18769352 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1181058374 22:20270411-20270433 GCTTCCAGTGGGGAGGGTGCTGG - Intronic
1181127602 22:20711082-20711104 GGGCGGAGTGGGGCTGGTCCAGG - Intronic
1181198320 22:21203577-21203599 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1181240934 22:21476386-21476408 GGGCGGAGTGGGGCTGGTCCAGG - Intergenic
1181401424 22:22652222-22652244 GGTCCTGCTGGGGCTGGGGCTGG + Intergenic
1181672219 22:24430980-24431002 GGTACAAGTGGAGCTGGTGCTGG - Intronic
1182396752 22:30041642-30041664 GAACACAGTGGGGCTGGGGCTGG - Intergenic
1183829056 22:40408461-40408483 GGGCACAGCAGGGCTGGTGCAGG - Intronic
1184099896 22:42336506-42336528 GATGGCAGTGGGGCTGGAGCTGG - Intronic
1184235161 22:43179390-43179412 GATCCCAGGGTGCCTGGTGCTGG - Intronic
1184593316 22:45500052-45500074 AGTCCCAATGGGGATGGAGCAGG - Intergenic
1184729349 22:46364422-46364444 GGTGGGAGTGGGGCTGGGGCTGG - Intronic
1184777854 22:46632236-46632258 GGTAACTGTGTGGCTGGTGCTGG + Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1203228487 22_KI270731v1_random:91260-91282 GGTCCTGCTGGGGCTGGGGCTGG + Intergenic
949519117 3:4833691-4833713 GGCTCCAGTGTGGCTGGAGCTGG - Intronic
950103739 3:10375349-10375371 GGAATCACTGGGGCTGGTGCTGG - Intronic
950171566 3:10842380-10842402 GGACCCAGTGGGTCTGGTGGGGG + Intronic
950207715 3:11093286-11093308 GGTCCCTGTGAGGCTGCAGCTGG - Intergenic
950275418 3:11656416-11656438 GTTCCCAGGGGTGCTGGTGTTGG + Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
950742768 3:15063420-15063442 GGTCCCAGTGGGGCAGCTGAAGG + Intronic
953910738 3:46891706-46891728 GGTGGCAGTGGTGCTGGTGCTGG + Intronic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954132971 3:48569524-48569546 GGACCCCGTGGGGCTGGCCCAGG - Intronic
954636132 3:52071794-52071816 TGTGCCAGTGGGGATGGTGGGGG - Intergenic
954713574 3:52516459-52516481 GGTCCCAATGGGGAGGGGGCAGG + Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
955405404 3:58622741-58622763 GGGCCCAGTGGGGAGGCTGCTGG + Intronic
959308278 3:104696768-104696790 GGACCCAGTGAGCCAGGTGCGGG + Intergenic
960149110 3:114232678-114232700 GGGCCCAGGGGGACTGGGGCTGG - Intergenic
960243584 3:115374506-115374528 AGTGCCAGTGGAGCTGGTGCAGG - Intergenic
961658514 3:128456276-128456298 GGTGGCAGTGGGGTTGGTGCAGG + Intergenic
963903528 3:150755134-150755156 AGTCACAGTGGGGCTGGAGTTGG + Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
967859017 3:194137886-194137908 GGTCCCGGTGGGGGCGGTGGCGG - Exonic
1202748980 3_GL000221v1_random:138679-138701 GGTTACAGTGGGGCTGGGGGAGG - Intergenic
968637017 4:1685669-1685691 AGTCCCAGCGGGGCTGGGGAGGG + Intergenic
969190285 4:5512931-5512953 TGTCCCAGTGGGGACTGTGCGGG + Intergenic
969621241 4:8280000-8280022 GGTACAACTGGGGCTGCTGCGGG + Intronic
969662867 4:8540570-8540592 GGTTCCGGTGGGGCAGGGGCGGG + Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
970608194 4:17702035-17702057 GGGCCCAGTGTGGGTGGTGTTGG + Intronic
971478170 4:27091240-27091262 GGTCCCAGAAGGGCTGGAGTGGG + Intergenic
972898577 4:43654768-43654790 GGTGGCAGTGAGGCTGGGGCAGG + Intergenic
973786484 4:54337289-54337311 GGACACGGTGGGGCTGGTGATGG + Intergenic
973923675 4:55715226-55715248 TGTACCTGTGGGGCTGGGGCAGG + Intergenic
977908353 4:102501862-102501884 AGTCCGAGTGGGGCTGGAGGGGG - Intronic
978245204 4:106563798-106563820 GGTGGCAGTGAGGCTGGTGGAGG - Intergenic
978839668 4:113196403-113196425 AGGCCACGTGGGGCTGGTGCAGG + Exonic
979158649 4:117429959-117429981 GATCCCAGAGGGTTTGGTGCAGG - Intergenic
980136954 4:128867326-128867348 TCTTCCAGTGGGCCTGGTGCAGG + Intronic
980148259 4:129015598-129015620 GATCCCAGAGGGTTTGGTGCAGG - Intronic
980480447 4:133380273-133380295 GCTCACAGAGGGGCAGGTGCGGG - Intergenic
981401793 4:144322052-144322074 GGGCCCAGAGGGTTTGGTGCAGG + Intergenic
983924979 4:173390777-173390799 GATCCCAGTGAGGCTGGGCCCGG - Intronic
985049985 4:185980457-185980479 AGTTGCAGTGGGGCTGGTGTTGG - Intergenic
985431798 4:189888257-189888279 TGCCCCAGTGGGGATGGTGTGGG + Intergenic
1202752816 4_GL000008v2_random:24759-24781 GGTTACAGTGGGGCTGGGGGAGG + Intergenic
985616290 5:923638-923660 GGGCCCAGGGCCGCTGGTGCTGG - Intergenic
986310092 5:6545126-6545148 GGACCCAGTGGGGATGGTGATGG - Intergenic
987474038 5:18368876-18368898 GGGCCCAGTGTGGCTGCAGCAGG + Intergenic
987518507 5:18947238-18947260 GGTCCCTGAGTGGCTTGTGCAGG - Intergenic
988336342 5:29913610-29913632 GGGCCCAGAGGGCTTGGTGCAGG + Intergenic
988470450 5:31532440-31532462 GCTCCCAGTGTGGGTGGTGGAGG + Exonic
988583760 5:32491183-32491205 GCTCCCAGTGGGGCTGAATCCGG - Intergenic
989207376 5:38824476-38824498 GGTGCTGGTGGTGCTGGTGCTGG - Intergenic
992013880 5:72557002-72557024 GGGCCCAGAGGGGCTGCTTCGGG + Intergenic
992676654 5:79112165-79112187 GGTCCAAGCTGGGCTGGGGCTGG - Intronic
997283852 5:132664761-132664783 GGTCTGAGGGGTGCTGGTGCTGG - Intergenic
999059692 5:148620132-148620154 GCTCTCACTGGGTCTGGTGCAGG - Intronic
999374537 5:151077654-151077676 GGTGCCAGTGCCGCTGGTCCGGG - Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000171610 5:158707989-158708011 GTTCCCGTTGGTGCTGGTGCAGG + Exonic
1000380979 5:160629144-160629166 GGTGCCAGATGGGCAGGTGCAGG + Intronic
1002056289 5:176599596-176599618 AGCCCCAGTGGGGCTGGGGAAGG - Exonic
1002531993 5:179852729-179852751 GGTGGCACTGGGGCTGGAGCAGG + Intronic
1002667093 5:180832941-180832963 GGTTCCAGTGTGGCTGGGGGTGG + Intergenic
1002839387 6:892989-893011 GGTCCCACTGTGGCTGGAGGCGG - Intergenic
1002897673 6:1389136-1389158 GGGCCGAGTGGTGCTGCTGCGGG - Intergenic
1003330528 6:5124884-5124906 CAACCCAGTGTGGCTGGTGCTGG - Intronic
1003556344 6:7142724-7142746 GGTCCTAGAGTGGCCGGTGCTGG - Intronic
1004180886 6:13379518-13379540 GCTTGCAGTGGTGCTGGTGCTGG - Intronic
1004453573 6:15770314-15770336 GGGCACAGTGAGGCTGGTGGTGG + Intergenic
1005398878 6:25411288-25411310 GGACCCTGTGGGCCTGGAGCTGG + Intronic
1005972107 6:30769544-30769566 AGTCCCTGTGGGGCTGGTACAGG - Intergenic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006166993 6:32070945-32070967 GCTCCCACTGGGCCTGGTGAAGG + Intronic
1006415271 6:33899997-33900019 GGTCTCAGAGGGGCCAGTGCCGG + Intergenic
1006641553 6:35492056-35492078 CCTCCCAGCAGGGCTGGTGCAGG - Intronic
1007496616 6:42264356-42264378 GGCCCCAGTGGGCCTGGTCTTGG + Intronic
1008691853 6:53987846-53987868 GCTCCCAGTTGGGTTGGTTCAGG + Intronic
1009413418 6:63392388-63392410 GGTCCCTTTGGAGCTGGAGCTGG - Intergenic
1012616480 6:101284443-101284465 GAGCCCAGTGGGTTTGGTGCAGG + Intergenic
1012999457 6:106008080-106008102 GGTCCCAGTGGGGCTGGGCGCGG + Intergenic
1013495377 6:110692180-110692202 GGTACCAGTGAGGCTGAGGCAGG + Intronic
1019154371 6:170029337-170029359 GGTCACTTTGGGGTTGGTGCAGG - Intergenic
1019418200 7:936940-936962 AGGCCCAGTGGGGCTGGGGCTGG + Intronic
1022361951 7:29669291-29669313 GGTTCCAGTGGGGAGGGGGCAGG - Intergenic
1023754685 7:43405593-43405615 GGGGACAGTGGGGGTGGTGCTGG + Intronic
1023817349 7:43961342-43961364 GGTCCCAGTGGGTAGGGGGCTGG + Intergenic
1023843716 7:44109847-44109869 GATTCCAGGTGGGCTGGTGCAGG + Intronic
1023865019 7:44234408-44234430 CGTCCCTTTGGGGCTGGTGGCGG + Exonic
1024233446 7:47380134-47380156 GCTCCGAGTGGGGCTGTGGCAGG + Intronic
1026909491 7:74083951-74083973 GGGCCCGGCGGGGCTGGGGCTGG - Exonic
1026973975 7:74485201-74485223 GGCAGCAGTGGGGCTGCTGCAGG + Intronic
1027202887 7:76074099-76074121 GGTTCCAGGGGGGCTGGTGTGGG + Intergenic
1029183886 7:98724766-98724788 GGTCCCAGTGGTGCTGACGGTGG + Intergenic
1029211062 7:98908773-98908795 GGTCGCTGAGGGGCAGGTGCTGG - Exonic
1029741975 7:102496216-102496238 GGTCCCAGTGGGTAGGGGGCTGG + Intronic
1029759964 7:102595381-102595403 GGTCCCAGTGGGTAGGGGGCTGG + Intronic
1033224285 7:139548390-139548412 GGTCCCTGTGGGGATGGGTCTGG - Intergenic
1033243596 7:139701050-139701072 GGTCCCAGTTAGTTTGGTGCTGG - Intronic
1033363521 7:140654689-140654711 GGTGACAGTGGTGCTGGTGACGG - Intronic
1033763888 7:144466166-144466188 GGTCGGGGAGGGGCTGGTGCAGG - Intronic
1035381578 7:158444347-158444369 GGACCCAGTGGGGCTGCAACAGG - Intronic
1035567056 8:648388-648410 GGTCGCAGTAGGGGAGGTGCTGG + Intronic
1035613750 8:987331-987353 GGTCTCAGTGGGGCTGGGCTGGG + Intergenic
1036707487 8:11056109-11056131 GGACCCAGTGCTGCTGGGGCTGG + Intronic
1037803977 8:22049304-22049326 GGTCCCCGCGGGGCCGGGGCGGG + Intronic
1038178126 8:25199822-25199844 GGAACCAGAGGTGCTGGTGCTGG + Intronic
1038478498 8:27885553-27885575 GGACCCAGATGGGCAGGTGCTGG + Intronic
1039309254 8:36297870-36297892 TGTCCCAGTGGGGATGCTGTGGG - Intergenic
1040707029 8:50141022-50141044 TGTTCCAGTGGGTCTGGTGTGGG - Intronic
1040948612 8:52912781-52912803 GGACCCAGGCAGGCTGGTGCAGG - Intergenic
1041935373 8:63326568-63326590 AGCCCCAGTGGGCCTGGAGCAGG - Intergenic
1042795824 8:72662366-72662388 GGCCTCAGTGGGGCTGGGGAGGG + Intronic
1046407226 8:113790508-113790530 GGTCCCTGTGAGGCTGAGGCTGG + Intergenic
1047807229 8:128373150-128373172 GGTGCCAGTGTTGCTGGTGTTGG + Intergenic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1047807280 8:128373576-128373598 GGTCCTGGTGTTGCTGGTGCAGG + Intergenic
1049164608 8:141118184-141118206 GGCCCCAGTGGTGTAGGTGCCGG - Intronic
1049258764 8:141627701-141627723 GGTCCCAGGGAGGCCGGAGCGGG - Intergenic
1049283477 8:141762291-141762313 GGTCACTGTGGGGCTGGGGAGGG + Intergenic
1049304508 8:141893774-141893796 GCACCCTGTGGGGCTGGTGTTGG - Intergenic
1049644021 8:143728077-143728099 GGTCCCACTGGTACTGCTGCTGG + Exonic
1051330528 9:16020739-16020761 GGTCCCAGGTGGGATGGTGCCGG + Intronic
1051604230 9:18905014-18905036 GGTTCCACTGGGGGTGGTGCTGG - Intronic
1052834098 9:33237595-33237617 CCTCCCAGTGGGGCTGCTGTAGG + Intronic
1053357974 9:37462932-37462954 TTTCCCAGTGTGGCTGGTTCCGG - Intronic
1056716782 9:89037966-89037988 GCACCCAGTGGGGGTGGGGCCGG - Intronic
1057310498 9:93940137-93940159 GGTCCCATTGTGTCTGGAGCTGG - Intergenic
1057883302 9:98808947-98808969 GTTCCCATTGGAGCTGGTGGTGG + Intronic
1060214678 9:121731658-121731680 TTGCCCAGTGGGGCTGGGGCTGG + Intronic
1060367577 9:123034060-123034082 GGTGCCAGTAGGGGTGGAGCGGG + Intronic
1060663140 9:125416022-125416044 AGACCCAGTGGGCCTGGTGTTGG + Intergenic
1060806549 9:126581194-126581216 GGTCCCTCTGGGGTTGGGGCAGG + Intergenic
1061412143 9:130427566-130427588 GAAGCCAGTGGGGCAGGTGCAGG - Exonic
1061582303 9:131545640-131545662 GGTGCCGGAGGGGCAGGTGCTGG + Intergenic
1061582363 9:131545830-131545852 GGTGCTGGTGGGGCGGGTGCTGG + Intergenic
1061732985 9:132630935-132630957 GGACTGAGTGGGGCTGCTGCAGG - Intronic
1061850399 9:133411544-133411566 GGTACAAGTGGGGTTGGTGGTGG - Intronic
1061932788 9:133841910-133841932 GGTCCCACTGCGGCTGGCTCTGG - Intronic
1061957089 9:133969464-133969486 TGTCTCAGTGGTGCTGATGCTGG - Intronic
1062035139 9:134379627-134379649 GGTCAGAGAGGGGCTGGAGCAGG - Intronic
1062283864 9:135764491-135764513 GAGGCCAGTGGGGCCGGTGCTGG + Intronic
1062402229 9:136377770-136377792 AGCCTCACTGGGGCTGGTGCGGG - Exonic
1062414324 9:136439979-136440001 GGTCCCAGCGAGGCAGGTGCAGG + Intergenic
1062624464 9:137436520-137436542 GCTCCTCGTGGGGCTGGTACAGG - Exonic
1062716526 9:138013262-138013284 GGTGGCAGTGGGGCTGCTGCAGG + Intronic
1203717620 Un_KI270742v1:168769-168791 GGTTACAGTGGGGCTGGGGGAGG - Intergenic
1203533607 Un_KI270743v1:9464-9486 GGTTACAGTGGGGCTGGGGGAGG + Intergenic
1203651834 Un_KI270751v1:132360-132382 GGTTACAGTGGGGCTGGGGGAGG - Intergenic
1185593187 X:1291963-1291985 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593211 X:1292088-1292110 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1189526509 X:41828055-41828077 TGTCCTCATGGGGCTGGTGCAGG - Intronic
1190735055 X:53250594-53250616 GGCCCTGGTGGGGCTGGGGCTGG + Exonic
1190840012 X:54135056-54135078 GGTCCCACTGGGAATGGTGGTGG + Exonic
1191252208 X:58265085-58265107 GACCCCAGCGGGCCTGGTGCAGG - Intergenic
1191743647 X:64463389-64463411 GATCCCAGAGGGTTTGGTGCTGG - Intergenic
1192088748 X:68130207-68130229 GGTACCAGTGTGGCTGTTTCTGG - Intronic
1192486189 X:71528840-71528862 GTTGCCAGTGGGGCTGGGGGCGG + Intronic
1199242896 X:145568963-145568985 GGTGCCAGTGGTGGTGGTGGTGG - Intergenic
1200105012 X:153707183-153707205 GGTGCCTGGGGGGCTGCTGCAGG - Intronic
1200223849 X:154405694-154405716 GGTCACTGGGAGGCTGGTGCTGG - Intronic
1201178210 Y:11322477-11322499 GTCCGCGGTGGGGCTGGTGCCGG + Intergenic