ID: 1184808415

View in Genome Browser
Species Human (GRCh38)
Location 22:46811781-46811803
Sequence GAAAAGCCAAAAATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 453}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184808409_1184808415 16 Left 1184808409 22:46811742-46811764 CCCTGCAGGACTGATAGTTTCAG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 453
1184808410_1184808415 15 Left 1184808410 22:46811743-46811765 CCTGCAGGACTGATAGTTTCAGA 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 453
1184808408_1184808415 27 Left 1184808408 22:46811731-46811753 CCAGTCTGTCGCCCTGCAGGACT No data
Right 1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184808415 Original CRISPR GAAAAGCCAAAAATGCAGCT GGG Intronic
900251582 1:1673208-1673230 GAAAACACAAAAATGAGGCTGGG + Intronic
900261943 1:1735744-1735766 GAAAACACAAAAATGAGGCTGGG + Intronic
900544651 1:3221941-3221963 GAAAAGCCACAAATTTAGATGGG + Intronic
901795231 1:11675958-11675980 GAACAGCCAAACATGGACCTGGG + Intronic
902119765 1:14153428-14153450 AAAAAGACATAAATGAAGCTGGG - Intergenic
902166860 1:14579462-14579484 AAAAATACAAAAAAGCAGCTGGG + Intergenic
903153703 1:21430263-21430285 GGAAGGCCGGAAATGCAGCTCGG - Intergenic
903609875 1:24602877-24602899 GAAAATACAAAAAATCAGCTGGG + Intronic
903628692 1:24749659-24749681 CAAAAGTAAAAAAGGCAGCTGGG + Intronic
904242292 1:29155650-29155672 GAAAACACAAAAAATCAGCTGGG - Intronic
904915778 1:33969815-33969837 GAAAAGGCAGAAATTCAGCCGGG + Intronic
905464529 1:38142762-38142784 ACAAAGCCAAAACTCCAGCTGGG + Intergenic
905745500 1:40413826-40413848 GAAAAGCCAAGAATAAAGGTAGG - Intronic
907127234 1:52061799-52061821 AAAAATACAAAAATTCAGCTGGG - Intronic
907141916 1:52194320-52194342 CAGAAGCCAAAAATGAAGATTGG + Intronic
907274049 1:53307223-53307245 GAAAACCCAAAACTGGAGCCTGG - Intronic
907694011 1:56702376-56702398 GAAAAGATAAAAATGATGCTGGG - Intronic
908221957 1:62015948-62015970 AAAAATACAAAAATTCAGCTGGG - Intronic
908688935 1:66754966-66754988 GAAATAGCAAAAATGCTGCTAGG - Intronic
909202307 1:72705976-72705998 GAAAAGCCATTAATGCAATTTGG + Intergenic
909369731 1:74870065-74870087 AAAAGGCCCAAAATACAGCTTGG + Intergenic
909624935 1:77705011-77705033 GAAAAACCGAAAAAGCAGATAGG - Intronic
910064366 1:83135438-83135460 GAAATGCATAAAATACAGCTTGG + Intergenic
910413261 1:86968563-86968585 AAAAAGTCAAAAAAACAGCTGGG - Intronic
910466359 1:87504546-87504568 GAAAAGCAATGAATGCAGCATGG + Intergenic
910472399 1:87568957-87568979 GAAATGCCTAAAACACAGCTAGG - Intergenic
911428892 1:97757910-97757932 GAATACCCAATAAGGCAGCTTGG + Intronic
912054820 1:105581607-105581629 GAAAATACAAAAACGTAGCTGGG - Intergenic
912396319 1:109346970-109346992 GGAAAACCAAAACTCCAGCTGGG - Intronic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
915235727 1:154479982-154480004 GAAAAGAGAAAACTGCAGTTGGG - Exonic
916078876 1:161219627-161219649 GAAAAGCCAAATATGCAGAACGG + Intronic
916728563 1:167545642-167545664 GAAAATACAAAAAATCAGCTGGG + Intronic
916809375 1:168292121-168292143 GGAAAGCCAAACAGGCAGGTGGG - Intronic
917919366 1:179737538-179737560 AAAAAGACCAAAAAGCAGCTGGG + Intergenic
917953104 1:180062239-180062261 AAGAAGCCAATAAGGCAGCTCGG + Exonic
918036298 1:180875570-180875592 GAAAAATGTAAAATGCAGCTAGG + Intronic
918162786 1:181916931-181916953 GAAGAGACAAAAATGGAGCCAGG + Intergenic
918870098 1:189960677-189960699 CAAAAGCCATAGATGCAGGTAGG - Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919365619 1:196657120-196657142 GAAAAGAAAAAAATTTAGCTAGG - Intronic
920605464 1:207379050-207379072 CGAAAGCTGAAAATGCAGCTTGG - Intergenic
920808388 1:209256931-209256953 GAAAAGCCCAAAGAGCACCTAGG + Intergenic
922008210 1:221553333-221553355 GTAAAGCCAAACATGCAGCCTGG + Intergenic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924420371 1:243903829-243903851 GAAAAGCCAAAAATGTATAAAGG + Intergenic
1063831014 10:9953093-9953115 GATAAGCCAAAAATGAATCTAGG - Intergenic
1063858851 10:10286739-10286761 GAAAAGCAAAAAATGTTGCTTGG + Intergenic
1064060970 10:12136923-12136945 AAAAATACAAAAATTCAGCTGGG - Intronic
1064190410 10:13200983-13201005 GAAAATCCAAAAATTTAGCTGGG + Intronic
1068409869 10:56640882-56640904 CAAAAGCCAAAATTGCAAATGGG - Intergenic
1068875822 10:61995726-61995748 GAAAAGCCAAGGTTGAAGCTAGG - Intronic
1070432020 10:76350133-76350155 GAAAAACTCAAAATGCAGGTAGG + Intronic
1070677985 10:78426815-78426837 GAAATGCTAAATATGCAGGTAGG - Intergenic
1071840622 10:89467118-89467140 GAAAAGCCTAAGAAGAAGCTAGG - Intronic
1073314767 10:102571815-102571837 GAAAAGAAAAGAATGCAGCATGG - Intronic
1073494423 10:103878824-103878846 GGAAAGCAAGAAATGCATCTGGG + Intergenic
1073951481 10:108814236-108814258 CAGAAGTCAAAAATGCAGCAGGG - Intergenic
1074666991 10:115738531-115738553 GAAAATTCCAAAATGCAGCTGGG - Intronic
1075387458 10:122066560-122066582 GAAAATACAAAAATTAAGCTGGG - Intronic
1075517661 10:123121580-123121602 CCAAAGACAAAAATGCAGCCAGG + Intergenic
1075883152 10:125872200-125872222 GAGAAGACAAAGATGCAACTGGG - Intronic
1077438336 11:2555672-2555694 GAACAGTCAAAAAGGCAGGTGGG - Intronic
1077804881 11:5580470-5580492 GAAAATACAAAAAATCAGCTGGG - Intronic
1078139259 11:8680165-8680187 GCAAAGGCAAAAATGCAAATGGG + Intergenic
1079236739 11:18696463-18696485 GAAGAGCCAAGAATGAATCTAGG + Intronic
1079491956 11:20998966-20998988 GAAAAGCAGCAAATGCAACTTGG + Intronic
1079700063 11:23534949-23534971 AAAAATCCAAAAATGTAGCCTGG - Intergenic
1080313735 11:30924910-30924932 GAAAATACAAAAAATCAGCTAGG + Intronic
1081459389 11:43257808-43257830 AAAAAGACAAAAACGGAGCTGGG + Intergenic
1081602756 11:44506622-44506644 TAAGAGCCAAAAATGCAGCTTGG - Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1082953569 11:58844915-58844937 AAAAAGCCAAAAATGCCTCAAGG + Intronic
1083778096 11:64903922-64903944 GAAGAACCACAAATGCAGCAGGG - Intronic
1083937659 11:65878651-65878673 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1084631760 11:70356797-70356819 GAAGAGAGAAAAATGCAGCATGG - Intronic
1087191989 11:95264648-95264670 GAAAAAACAAAAAAACAGCTGGG + Intergenic
1087865480 11:103221577-103221599 GAAAAGTCGATAATACAGCTGGG + Intronic
1088120579 11:106364180-106364202 GAAATGCCAAAAATGCTGGGAGG + Intergenic
1088565663 11:111170088-111170110 TAAAAGCCAATAATGCAGAGAGG - Intergenic
1088815401 11:113417255-113417277 GAAAAGCCTGAAATCCAGGTGGG - Intronic
1089935219 11:122357627-122357649 AAAAATTCAAAAATGTAGCTGGG + Intergenic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090576025 11:128104841-128104863 CCAAAGCCAAAAGTTCAGCTTGG + Intergenic
1092411082 12:8253292-8253314 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1093445756 12:19255900-19255922 GAAAAGCTCAGAATGCAGATGGG + Intronic
1094306262 12:29022963-29022985 GAAAATCCAAAAAATTAGCTGGG + Intergenic
1095304072 12:40620384-40620406 GAATAGAGAAAATTGCAGCTAGG - Intergenic
1095563339 12:43591130-43591152 GAAAAGCTAAAAAAGGAGCCAGG - Intergenic
1095837901 12:46658414-46658436 GAATAGCTAAAAAAGCAGCAAGG - Intergenic
1097105826 12:56623708-56623730 CAGAAGCCAAAGATGCTGCTAGG + Intronic
1097256139 12:57675919-57675941 GAAAATACAAAAAATCAGCTGGG - Intergenic
1098301861 12:69062430-69062452 GCAAAGCCGAAAGCGCAGCTTGG - Intergenic
1099468329 12:83015175-83015197 GAAAACCCCAACATGGAGCTTGG - Intronic
1100803995 12:98262088-98262110 GAAAAGCTAAAGATGTGGCTTGG - Intergenic
1101201029 12:102436521-102436543 GAGAAGCCAAAAAGGCAGTGTGG + Intronic
1101235418 12:102784042-102784064 GAAAAGTCAAAATTGGAACTAGG - Intergenic
1101644897 12:106622613-106622635 AAAAAAAAAAAAATGCAGCTTGG - Intronic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1103066666 12:117904411-117904433 GAGAACTCAAAAGTGCAGCTTGG + Intronic
1103384396 12:120520628-120520650 AAAAATACAAAAATTCAGCTGGG - Intronic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1104169889 12:126269907-126269929 GAAAAGGCAAAAATGAAGAAAGG - Intergenic
1106641868 13:31593066-31593088 AAAAAGTAAAAAATGCAGCTGGG - Intergenic
1107909626 13:45093216-45093238 AAAAACACAAAAAAGCAGCTGGG + Intergenic
1108485510 13:50919632-50919654 AAAAAGCACAAACTGCAGCTTGG - Intronic
1108527418 13:51297659-51297681 GAACAGACAAAAATCCAGTTGGG - Intergenic
1108846338 13:54681997-54682019 GAAAAGACAAACATGCAGAAAGG - Intergenic
1109080992 13:57901055-57901077 TAGAAGCCAAAAATACTGCTGGG + Intergenic
1109377475 13:61515783-61515805 GAAGAGAAAAAAATACAGCTGGG + Intergenic
1109660329 13:65450367-65450389 GGAAAGACAAGAATGCAGGTTGG + Intergenic
1109670138 13:65594417-65594439 ATTAAGACAAAAATGCAGCTGGG + Intergenic
1112013752 13:95314028-95314050 AAAAACCCAAAAAATCAGCTAGG + Intergenic
1112113864 13:96331907-96331929 GAAAAGCCAAATATTCGGTTGGG + Intronic
1112124997 13:96455378-96455400 GAAAAAAAAAAAATGTAGCTGGG - Intronic
1113837956 13:113341560-113341582 GATAAGAAAAAAATGTAGCTGGG - Intronic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1115619497 14:35127275-35127297 GAAAACCCAAAAAAGTAGATTGG - Intronic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1116419344 14:44714668-44714690 GAAAAGCTAAAAATATAGATAGG - Intergenic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1117921920 14:60733803-60733825 CAAAACCCAAAAATACAGTTGGG - Intergenic
1118196083 14:63627790-63627812 GAAAAAAAAAAAATTCAGCTGGG + Intronic
1118834513 14:69467437-69467459 GAATAGCCAGAAATGTAGGTGGG + Intergenic
1119531565 14:75365013-75365035 GAGGAGCCCAAAATGCAGCTTGG + Intergenic
1120477396 14:85005733-85005755 GAAAAGCCAGAAGAGAAGCTTGG - Intergenic
1121136452 14:91503284-91503306 GAAAAAAAAAAAATGTAGCTCGG - Intronic
1122103567 14:99433596-99433618 GAAAATACAAAAAATCAGCTGGG - Intronic
1123968438 15:25481633-25481655 GGAAAGCCAAAACTGCAGGGAGG - Intergenic
1124009024 15:25820700-25820722 GAAAATTCAAAAATGCTGCTTGG + Intronic
1125099222 15:35890953-35890975 AAAAACACAAAAATGTAGCTGGG + Intergenic
1125129746 15:36269686-36269708 TAAAAACAAAAAATGTAGCTGGG - Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1126770947 15:52055244-52055266 CAAAAAACAAAAATGTAGCTGGG + Intronic
1129147490 15:73662094-73662116 AAAATACAAAAAATGCAGCTGGG - Intergenic
1129598160 15:76981028-76981050 AAAAATCCAAAAATTTAGCTGGG + Intergenic
1131316180 15:91339800-91339822 AAAATGCAAAAAAAGCAGCTGGG - Intergenic
1131719080 15:95147702-95147724 GAAAATCCAAAATTCAAGCTGGG + Intergenic
1131809251 15:96155329-96155351 CAAGGGTCAAAAATGCAGCTGGG + Intergenic
1132049160 15:98592498-98592520 GAAAAGCTAAAAACAGAGCTGGG - Intergenic
1132740043 16:1407533-1407555 AAAAATACAAAAATTCAGCTGGG + Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1134070333 16:11256291-11256313 GAGAAACCAAAAGTGGAGCTGGG - Intronic
1134355974 16:13482638-13482660 GAAAAGTAAAAAATTTAGCTTGG + Intergenic
1135160209 16:20087665-20087687 CAACAGACAAAAATGCAGCTAGG - Intergenic
1135464613 16:22674687-22674709 GAAAAGCCACACTGGCAGCTGGG + Intergenic
1136344338 16:29665213-29665235 AAAAATACAAAAAAGCAGCTGGG - Exonic
1137397088 16:48123864-48123886 GAAATGCCAGCAAGGCAGCTTGG - Intronic
1137751376 16:50863461-50863483 GAAAAGACAAAAATATAGATGGG - Intergenic
1138275560 16:55731543-55731565 AAAAAGCAAAAAATTAAGCTGGG + Intergenic
1138378094 16:56580745-56580767 GAAAAGATCAAAATGCTGCTAGG - Intergenic
1138378095 16:56580819-56580841 GAAAAGATCAAAATGCTGCTAGG - Intergenic
1138383902 16:56622849-56622871 TAAAAGTCAAAAATCCAGCAGGG - Intergenic
1139355718 16:66366212-66366234 AAAGAGCCAAAAATCTAGCTGGG - Intergenic
1139540676 16:67613613-67613635 GAAAATACAAAAAATCAGCTGGG + Intronic
1139660591 16:68418135-68418157 AACAAGCCAGAAATGCACCTTGG - Intronic
1139706740 16:68746262-68746284 AAAAATTCAAAAATTCAGCTGGG + Intronic
1140317801 16:73915928-73915950 AAAAAGAAAAAAATGCAACTAGG + Intergenic
1140319434 16:73934395-73934417 GAAAAGAATAAAATACAGCTAGG + Intergenic
1140330926 16:74056059-74056081 AAAAAGGCAAATATGAAGCTGGG + Intergenic
1140517202 16:75552156-75552178 CAAAAAACAAAAATTCAGCTGGG + Intronic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1141452159 16:84111903-84111925 AAAAAAAAAAAAATGCAGCTGGG + Intronic
1141949273 16:87330282-87330304 GAAAAGCCACACCTGCATCTGGG - Exonic
1141964837 16:87434828-87434850 GAAAAGACAAAAAATTAGCTGGG + Intronic
1142043339 16:87909367-87909389 GAAAACCCAAAAAGGCTACTGGG + Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1144116620 17:12099604-12099626 GAAAAGTCCAAAGTACAGCTTGG + Intronic
1144227403 17:13162990-13163012 AAAAAGGGAAAAATGCACCTGGG + Intergenic
1144568630 17:16380956-16380978 GAAAAGCCTAAACTGCCTCTCGG + Exonic
1144636795 17:16915185-16915207 AAAAATACAAAAAAGCAGCTGGG + Intergenic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1144818719 17:18055783-18055805 GAAAAACCAAAAAAACAGGTTGG - Intronic
1145089354 17:19973906-19973928 AAAAATCCAAAAATGCAGCCGGG + Intronic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1146657377 17:34642695-34642717 TAAAAAACAAAAATGTAGCTGGG - Intergenic
1147272342 17:39283569-39283591 CAAAAATCCAAAATGCAGCTGGG - Intronic
1147366035 17:39959907-39959929 GAAAAGAAAAAGACGCAGCTGGG + Intergenic
1148352355 17:46950233-46950255 GAAGACCCAAGAATCCAGCTGGG - Intronic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149704953 17:58686581-58686603 GAAAAGCCAAATATGTAGAAAGG + Intronic
1150240016 17:63623150-63623172 GAAAAGACACAACAGCAGCTGGG - Intronic
1151176361 17:72291607-72291629 GAAAAGGCAAGACTGCAGGTAGG - Intergenic
1151186298 17:72366457-72366479 GAAAGGCCAAAGATGCCACTGGG - Intergenic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1151648774 17:75452502-75452524 GAAAAGAAAAAAAGGGAGCTGGG - Intronic
1153171826 18:2325498-2325520 GAAAACAAAAAAATGGAGCTGGG + Intergenic
1155512346 18:26590734-26590756 GAAATACCAAAAATGCATATAGG - Intronic
1156412019 18:36839703-36839725 TAAAAGCTCAAAATGAAGCTTGG - Intronic
1159010428 18:63054130-63054152 GAAAATCCAAGAATGTAGCTTGG + Intergenic
1159184424 18:64950244-64950266 GTAAAGCCAAAAATTCTCCTGGG - Intergenic
1159433826 18:68389660-68389682 GCAAAGACAAACATGAAGCTTGG + Intergenic
1160682784 19:419458-419480 GAAAAGGAAAACATGCAGATGGG + Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162288495 19:9759948-9759970 ATAAAGTGAAAAATGCAGCTTGG + Intronic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1162838107 19:13334871-13334893 GAAAAATAAAAAATGTAGCTGGG + Intronic
1163067325 19:14807733-14807755 AAAAATACAAAAATTCAGCTGGG + Intronic
1163467692 19:17478169-17478191 AAAATCACAAAAATGCAGCTGGG + Intronic
1164437536 19:28244368-28244390 GAAAAGCCTAAGATGAAGCAAGG - Intergenic
1164564053 19:29313359-29313381 GAGAAGCAAAAAATGCTGTTTGG + Intergenic
1165492109 19:36129816-36129838 GAAAAGCCAATAAGGAAACTGGG + Intergenic
1167694199 19:51004537-51004559 GAAAATACAAAAAATCAGCTGGG + Intronic
1167736929 19:51300491-51300513 TAAAAGCCAAAGATGGTGCTAGG + Intergenic
1168005237 19:53481506-53481528 AAAAATCCAAAAATTTAGCTGGG - Intronic
1168111289 19:54192557-54192579 CAAAAAAGAAAAATGCAGCTGGG - Intronic
1168589788 19:57623775-57623797 CAAAAGCCAAAAATATAGATAGG + Intergenic
925591488 2:5514341-5514363 GCAAATCCAGAAATGCAGCAAGG + Intergenic
925746343 2:7047021-7047043 GAAAAGCCCAAAATGCAAAAGGG + Intronic
926412487 2:12618754-12618776 TAACAGTAAAAAATGCAGCTGGG - Intergenic
926451524 2:13010311-13010333 AAAAAGCCAAAAATCCATCATGG - Intergenic
928510499 2:31998637-31998659 AAAAATACAAAAATTCAGCTGGG + Intronic
928568460 2:32578633-32578655 AAAAATACAAAAATTCAGCTGGG + Intronic
928714786 2:34047861-34047883 CAAAAGCCATAAATGCAGAGGGG + Intergenic
928820521 2:35355940-35355962 AAAAATCCAAAAAAGTAGCTGGG - Intergenic
929348714 2:40920759-40920781 GACAAGCCAAATTTTCAGCTTGG - Intergenic
929452503 2:42047216-42047238 CTAAAGCCCCAAATGCAGCTGGG - Intergenic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930043370 2:47146797-47146819 GAAAAACCAAAAATGAGGATAGG + Intronic
930324157 2:49893044-49893066 GAAAAGCAACAAATCCAGGTGGG - Intergenic
930341743 2:50124675-50124697 GAAAAGTCAAAATTGCAGGGAGG - Intronic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
934511461 2:94947583-94947605 GAAAAGCCAAAAATGACGTGTGG - Intergenic
934750509 2:96790822-96790844 AAAAATACAAAAATCCAGCTGGG + Intronic
936024223 2:109018982-109019004 GTATAGCCAAAAATGCATTTAGG + Intergenic
936343227 2:111655971-111655993 GAAAATCCAAGAATGCAACTGGG + Intergenic
936371399 2:111905015-111905037 GAAGTGCTAAAAATGCAGCCTGG + Intronic
936450643 2:112631311-112631333 GAAAAGACAAACATACCGCTAGG - Intergenic
936710045 2:115121528-115121550 CAAGAGCCAAAAATGCCCCTGGG - Intronic
936877671 2:117212050-117212072 GAAAAGCACAAAAAGGAGCTAGG - Intergenic
937693628 2:124783464-124783486 AAAAAGCTGAAAATGGAGCTTGG - Intronic
939071872 2:137553914-137553936 CAAAAGTCAAAAAAGCAGCAGGG - Intronic
939075180 2:137592617-137592639 GATAACAGAAAAATGCAGCTTGG - Intronic
939339891 2:140881735-140881757 GGAAAGTCAAAAATGCTTCTGGG - Intronic
940220956 2:151350834-151350856 GAAAATACAAAAATGAACCTGGG + Intergenic
940834315 2:158503710-158503732 TAAAAGACAAAAAGGCAGTTTGG - Intronic
941371007 2:164664099-164664121 GAAAAGCCTATAATGCAGAGAGG + Intronic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
942108769 2:172659415-172659437 GAAGACCCAAAGATGCAGTTAGG - Intergenic
942627883 2:177922699-177922721 GAACAGCCAGAAAGGTAGCTTGG - Intronic
943226253 2:185182480-185182502 GAAGAGTAGAAAATGCAGCTTGG + Intergenic
943414765 2:187588238-187588260 TAGAAGCCAAGATTGCAGCTAGG - Intergenic
943819526 2:192302572-192302594 GACAAGCCAAACCTGAAGCTGGG + Intergenic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
944939777 2:204610951-204610973 GAAAAGCAGGAAATGCAGTTTGG - Intronic
945230771 2:207587230-207587252 AAAAATCCAAAAATTCAGCCAGG + Intronic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
948630030 2:239296393-239296415 GAAAAACCAGAAAACCAGCTGGG - Intronic
948780437 2:240318502-240318524 GAAAAACCAAGAATGGAGTTTGG + Intergenic
1169070024 20:2720255-2720277 AAAAATACAAAAATTCAGCTGGG - Intronic
1169551136 20:6702609-6702631 GAAAGGCCCAAAATGCATATGGG + Intergenic
1172159860 20:32859886-32859908 GAAAAAACAAAAATGCTGCAAGG - Intronic
1172419781 20:34805979-34806001 GAAAAGCCAAAAAGAGGGCTGGG - Intronic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1173511213 20:43630121-43630143 TAAGAGCCAAACATGCAGCCAGG - Intronic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1175156214 20:56973281-56973303 GAAAAGCCCAAAATGGAGGGGGG - Intergenic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1176732729 21:10517107-10517129 AAAAAGCCAAAAAATTAGCTAGG - Intergenic
1176732861 21:10518111-10518133 AAAAATACAAAAATTCAGCTGGG + Intergenic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177879329 21:26673456-26673478 GAAAATTTAAAAATGTAGCTGGG - Intergenic
1178924576 21:36764101-36764123 CAAAAAACAAACATGCAGCTGGG + Intronic
1179677572 21:42994199-42994221 AAAAATCCAAAAATTTAGCTGGG - Intronic
1179941847 21:44645265-44645287 GAAGAGACAAAAATAAAGCTTGG + Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1180650939 22:17376393-17376415 GGAAAGCCTAAAATACACCTTGG + Intronic
1181466241 22:23112199-23112221 CAGAAACCAGAAATGCAGCTGGG - Intronic
1181484485 22:23221928-23221950 GAAAAGACAAAAAATTAGCTGGG + Intronic
1181693285 22:24578393-24578415 GAGAAGCCACCAAGGCAGCTAGG + Intronic
1182196268 22:28521473-28521495 GAAAAGCCAAGATTGCAGAGAGG + Intronic
1182294324 22:29304312-29304334 CAAAACCCCAAAATGCAGCAAGG + Intergenic
1182489388 22:30660728-30660750 GAAAATCTTAAAAAGCAGCTGGG + Intronic
1183287773 22:36978295-36978317 GAAAAGGGAAAACTGCAGCTGGG - Intergenic
1183511635 22:38238799-38238821 CAAAGGCCAAACTTGCAGCTGGG - Intronic
1183887193 22:40893988-40894010 GAAGAGCCAAAAAGAGAGCTAGG - Intronic
1184115036 22:42417374-42417396 GAATAACCAGAAAAGCAGCTGGG - Intronic
1184681362 22:46073912-46073934 TAAAAGCCCAAAATGGAGCGAGG - Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1184832463 22:46997557-46997579 CAAAAGGGAAAAAGGCAGCTGGG - Intronic
1184984503 22:48120346-48120368 GGAAAGCAAAAGATGGAGCTGGG - Intergenic
1185407984 22:50666549-50666571 GAAAATACAAAAACGTAGCTGGG - Intergenic
949550307 3:5107088-5107110 AAAAAGTCAAAAAAGGAGCTGGG + Intergenic
949736512 3:7178641-7178663 GGAAAGGCAAAATTGCAGATGGG + Intronic
951258644 3:20481305-20481327 TAAAAGCCAAATATTCAGCCCGG + Intergenic
951920341 3:27847859-27847881 AGAAAACCAAGAATGCAGCTGGG + Intergenic
953635355 3:44658994-44659016 AAAAATCCAAAAACCCAGCTTGG + Exonic
953769643 3:45770226-45770248 GCAAATCAAAAACTGCAGCTTGG - Exonic
953999914 3:47548225-47548247 AAAAACCAAAAAATGTAGCTGGG + Intergenic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
954974776 3:54682980-54683002 GAAAAGCAAAAATTGGATCTTGG + Intronic
956601250 3:71025150-71025172 GACAAGCCAAAAATGGAGAATGG + Intronic
956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG + Intronic
958488752 3:94745747-94745769 GAAAAGCGCAATATTCAGCTGGG - Intergenic
959156189 3:102668663-102668685 TAACAGCCAACAATGCAGCTGGG - Intergenic
959326440 3:104943391-104943413 GATAATCTAAAAATGCTGCTGGG - Intergenic
959708719 3:109362910-109362932 TAAAAGTTAAAAATACAGCTGGG - Intergenic
960215955 3:115037442-115037464 AAAAATCCAAAAATTGAGCTGGG - Intronic
960976853 3:123184202-123184224 GAAAATACAAAAATTCGGCTGGG + Intronic
961050423 3:123740876-123740898 GCAAAGCCAGCAAGGCAGCTGGG + Intronic
961093020 3:124131820-124131842 GAAAAGCCAGAAATGGGCCTGGG - Intronic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962288207 3:134106335-134106357 GAAAAGCAAAGCAGGCAGCTGGG + Intronic
963144840 3:141982537-141982559 GAAAAGCCAAGAGTGAAGCAGGG + Intronic
963626027 3:147674037-147674059 GAAAAGTTAAAAATGTATCTAGG + Intergenic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
965753796 3:172004946-172004968 AAAAAGTTAAATATGCAGCTGGG + Intergenic
967135981 3:186512970-186512992 GAATGGCCAAAGATCCAGCTGGG - Intergenic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
969392320 4:6900191-6900213 AAAAAACCAAAAATGTAGCTGGG + Intergenic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971939318 4:33193753-33193775 GAAAAGACAAAAATGTAGGCGGG - Intergenic
972017727 4:34267017-34267039 GAAAAGAAAAAAATATAGCTGGG - Intergenic
972280825 4:37600470-37600492 CTAAAGGCAAAAATGCATCTTGG + Intronic
972325663 4:38013086-38013108 TAAAAGCCAAAATTTCAGCCAGG - Intronic
972863154 4:43196792-43196814 GAAAACTCAGAAATGCAGATAGG + Intergenic
973620162 4:52718202-52718224 AAAAAGCCAAAAACTTAGCTGGG + Intergenic
974353469 4:60780756-60780778 GAAAAGCAGAAAATTCAGCAAGG - Intergenic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
979476619 4:121165763-121165785 CAAAATCCAAAAATACAGGTAGG + Intronic
980310615 4:131125366-131125388 TAAAACTCCAAAATGCAGCTCGG + Intergenic
980326021 4:131347507-131347529 CAAAAACAAAAAATGTAGCTTGG - Intergenic
980570527 4:134611065-134611087 AAAAAGTTAAAAATGTAGCTGGG + Intergenic
980820824 4:138014442-138014464 GAGAAACAAAAAATGCAGTTAGG + Intergenic
980929499 4:139171761-139171783 AAAAAGACAAAAAATCAGCTGGG + Intronic
980977739 4:139626995-139627017 AAAAATCCAAAAATTTAGCTGGG + Intergenic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982191394 4:152859220-152859242 AAAAATACAAAAATTCAGCTGGG - Intronic
983958841 4:173728019-173728041 AAAAAAACAAAACTGCAGCTAGG + Intergenic
984038430 4:174698337-174698359 AAAAACCCAAAAAAGTAGCTGGG - Intronic
984768293 4:183416326-183416348 AAAAAGAAAAAAATCCAGCTAGG - Intergenic
984872929 4:184343299-184343321 GTAAGCCCACAAATGCAGCTGGG + Intergenic
984893635 4:184515992-184516014 GCAAAGCTAAAAATCAAGCTTGG + Intergenic
984955039 4:185036806-185036828 GAGAAGCCAAAAAAGTAGCCTGG - Intergenic
986010742 5:3712761-3712783 GACAAGCAAATAATGAAGCTAGG - Intergenic
988170472 5:27648658-27648680 AAAAATACAAAAATTCAGCTGGG - Intergenic
988265945 5:28951338-28951360 GTATAGCCAAAAATGCATTTAGG - Intergenic
989451307 5:41589263-41589285 GAAAAGGCAAAAAAGAAGCATGG - Intergenic
989599473 5:43188164-43188186 GAAAGGCCAGGGATGCAGCTTGG + Intronic
990105339 5:52251410-52251432 GAAAAGCACAAATTTCAGCTTGG - Intergenic
990989549 5:61671970-61671992 AAAAATCCAAAAATTTAGCTGGG - Intronic
991086703 5:62654314-62654336 AAAAAGACAAAAAAGTAGCTAGG - Intergenic
992792265 5:80224163-80224185 GAAAAGTCAGAAATGAATCTGGG + Intronic
994525318 5:100900188-100900210 GAAAAGCTAAATATGAATCTGGG + Intronic
995874625 5:116777612-116777634 GAAAATCCAAAAAGTTAGCTGGG + Intergenic
997953550 5:138260766-138260788 GAAAAAAAAAAAATGCAACTGGG + Intronic
998255884 5:140587713-140587735 AAATAGCCAAAAGTGTAGCTAGG + Intronic
998438347 5:142133810-142133832 CAAAAGCCTAAAATCCAACTAGG + Intronic
998906180 5:146907698-146907720 GAAAAGACAAAAACTTAGCTGGG - Intronic
999674619 5:153986808-153986830 GAAAAGCCAAAAATGCTCCTGGG - Intergenic
1001549761 5:172594448-172594470 AAAAAGAAAAAAATCCAGCTAGG - Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1002825963 6:774617-774639 GAAAAAGGAAAAATGCAGGTGGG - Intergenic
1003214197 6:4094269-4094291 CAAAAGTCAAAAAAGTAGCTGGG + Intronic
1003345479 6:5261802-5261824 TAAATGCATAAAATGCAGCTTGG + Intronic
1003764767 6:9222631-9222653 CAAAAGTCTTAAATGCAGCTAGG + Intergenic
1004184960 6:13413762-13413784 GCAAAGCCAAACAAACAGCTTGG + Intronic
1005007525 6:21303730-21303752 AAAAATCCAAAAATGAAACTGGG + Intergenic
1005401566 6:25439480-25439502 GAAGAGCCACAAATGGAGTTGGG + Intronic
1005652987 6:27901978-27902000 AAAAAGAAAAAAATTCAGCTGGG + Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1006931797 6:37693047-37693069 GCAAAGCAAACAAAGCAGCTTGG + Intronic
1008016844 6:46530160-46530182 AGAATGCCAAAAATGCAACTTGG + Intergenic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1008956895 6:57225159-57225181 GAAAACCCCAAAAAGCAGTTAGG - Intergenic
1012369137 6:98481492-98481514 CAAAAGCCAAAATTGCAAATGGG + Intergenic
1012628501 6:101433324-101433346 GAAAAGCCCAGAATGCAGACTGG + Intronic
1012733742 6:102913005-102913027 GATTAGAAAAAAATGCAGCTTGG + Intergenic
1013248262 6:108308864-108308886 AAAAATACAAAAAAGCAGCTGGG - Intronic
1013424816 6:110001468-110001490 GAACATCCAAAAAGCCAGCTGGG + Intergenic
1013581155 6:111535959-111535981 AAAAAACCAAAAATTTAGCTGGG + Intergenic
1015750842 6:136556810-136556832 AAAAACTCAAAAATTCAGCTAGG - Intergenic
1016806183 6:148214681-148214703 GAAATACCAAATATACAGCTAGG - Intergenic
1017239010 6:152146908-152146930 CAGAAGCCAGAAATGCAGATTGG - Intronic
1017716338 6:157216404-157216426 GAAAAGCCATAAAGGAAGCCAGG - Intergenic
1018023346 6:159783992-159784014 CAAAAAACAAAAATGAAGCTTGG - Exonic
1019817717 7:3213278-3213300 GAGAAACCAAGTATGCAGCTCGG - Intergenic
1019987432 7:4667976-4667998 TAAAAAACAAAAATGAAGCTCGG + Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1021599773 7:22354102-22354124 AAAAAGCCTATAATGCACCTGGG + Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023640308 7:42250716-42250738 GAAGTGCCAAAAGGGCAGCTGGG + Intergenic
1023686980 7:42746029-42746051 GAAAAGTGAAAAACACAGCTGGG - Intergenic
1023691676 7:42795628-42795650 CAAAAAACAAAAATGAAGCTTGG + Intergenic
1023753440 7:43393578-43393600 GAAAAGCCAAGAATTTAGGTGGG + Intronic
1024291389 7:47807182-47807204 GAAAAGCCAAATCTTCTGCTTGG + Intronic
1026423794 7:70269281-70269303 GAAGAGCCAGAACTGCAGCAAGG - Intronic
1026936358 7:74258502-74258524 GAAAAACCATAAATGGGGCTGGG - Intergenic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027279745 7:76599311-76599333 GAAATGCACAAAATACAGCTTGG - Intergenic
1027476889 7:78643240-78643262 GAAATGCCAAGAAAGTAGCTGGG + Intronic
1028313581 7:89370539-89370561 GAAAATCCAAAAATTTAGCCGGG + Intergenic
1028598391 7:92572556-92572578 GAAAATACAAAAAAGTAGCTGGG + Intronic
1029382991 7:100225482-100225504 GAAGAGCCCCAAATGCAGCCTGG - Intronic
1029513492 7:101011367-101011389 CAATAGCCAATGATGCAGCTGGG - Intronic
1030266344 7:107625970-107625992 TAAAAAAGAAAAATGCAGCTAGG + Intronic
1031173703 7:118322520-118322542 GAAAAACAAAAAATCTAGCTGGG - Intergenic
1031813495 7:126402630-126402652 CAAAAACAAAAAATGCAGATTGG + Intergenic
1032453735 7:132056201-132056223 AAACAGCCAAAAGTGGAGCTAGG + Intergenic
1034546521 7:151793343-151793365 GGAAAGGCAGAAATGCTGCTGGG - Intronic
1034596855 7:152204432-152204454 AAAAAGCCAAAAAATTAGCTAGG + Intronic
1035968341 8:4220108-4220130 GAAAATACAAAAAATCAGCTGGG - Intronic
1036034107 8:5000381-5000403 GAAAAGACAAAAAATTAGCTGGG + Intergenic
1036164117 8:6415843-6415865 CAAAAACAAAAAAGGCAGCTGGG + Intronic
1036792298 8:11729272-11729294 CAAAAAGAAAAAATGCAGCTGGG + Intronic
1036851463 8:12204464-12204486 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1036872828 8:12446738-12446760 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1037782959 8:21883517-21883539 GAAAATACAAAAAATCAGCTAGG + Intergenic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038877768 8:31570477-31570499 CAAAAGCCAAAATTGCAAATGGG + Intergenic
1040330677 8:46384231-46384253 GGAAAGCCATAAATGCTTCTGGG - Intergenic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041134841 8:54747107-54747129 GAAGAGAAAAAAATGCAACTTGG - Intergenic
1041981349 8:63864742-63864764 AAAAAGCCAAGAAGGTAGCTAGG - Intergenic
1042288681 8:67144270-67144292 TAAAAGACAATAATACAGCTTGG - Intronic
1042572027 8:70176394-70176416 GCAAAGCCAGAAATGAAGCAAGG - Intronic
1042869843 8:73388411-73388433 AAAAAGCAAAAAATGGAGCCAGG + Intergenic
1043402055 8:79893178-79893200 GAAATGCTAAAAATTCAGCACGG + Intergenic
1043512755 8:80965980-80966002 GAAGAGCAAACAAGGCAGCTCGG + Intergenic
1043985152 8:86685666-86685688 GAAAAGTCATATATGCAGATAGG + Intronic
1044538159 8:93381288-93381310 GCAAATCCAAAAATCCAGCAAGG + Intergenic
1044602940 8:94024116-94024138 AAAAAGAAAAAAATGTAGCTAGG - Intergenic
1044807921 8:96027763-96027785 AGAAATCCAAAAATTCAGCTGGG + Intergenic
1045628796 8:104090458-104090480 GAAAAGCCAAGTAAGCAGTTAGG + Intronic
1045971304 8:108082621-108082643 GAAAAGGCGAAACTGCATCTGGG + Exonic
1046746538 8:117882239-117882261 AAAAAGACAAAAAAGTAGCTGGG - Intronic
1048449430 8:134520446-134520468 AAAAAAACAAAAAAGCAGCTAGG + Intronic
1051525465 9:18038266-18038288 CAACAGCCAAAAATGCCACTTGG - Intergenic
1051657400 9:19396251-19396273 AAAAAAAAAAAAATGCAGCTTGG - Intergenic
1051737636 9:20217982-20218004 TTAAAGCCAGAAATGAAGCTGGG - Intergenic
1052133374 9:24879403-24879425 GAAAAGAGAAAAATGAAGCAGGG - Intergenic
1052151461 9:25122320-25122342 GATTAGCCAACAATTCAGCTGGG + Intergenic
1052657292 9:31378879-31378901 AAAAATCCAAAAAAGTAGCTGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058236510 9:102497463-102497485 GAAAAAATAAAAATTCAGCTGGG + Intergenic
1058325045 9:103685071-103685093 TAAAAGCAAATATTGCAGCTCGG + Intergenic
1058427776 9:104890418-104890440 GAAAATACAAAAAAGTAGCTGGG + Intronic
1058594634 9:106602202-106602224 GCAAAGCCAAAAATGGGGTTAGG + Intergenic
1059070924 9:111135120-111135142 TAAGAACAAAAAATGCAGCTGGG - Intergenic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059420742 9:114190429-114190451 CAAAAGCAAAAAATTTAGCTGGG - Intronic
1060095391 9:120784622-120784644 GAAAAAAAAAAAATGCGGCTGGG + Intronic
1060902623 9:127273882-127273904 GATAAGCCACAAATGGAGTTCGG - Intronic
1061729386 9:132601718-132601740 GTACAGACCAAAATGCAGCTGGG + Intronic
1061976827 9:134072656-134072678 GAAAAATCAAAAATGTAGCTGGG + Intergenic
1062152485 9:135028883-135028905 AAAAACACAAAAATTCAGCTGGG + Intergenic
1185626368 X:1485296-1485318 TAAAATTCAAAAATGTAGCTGGG - Intronic
1185722111 X:2390431-2390453 TAAAAAAAAAAAATGCAGCTGGG - Intronic
1185923043 X:4115118-4115140 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1188216677 X:27487440-27487462 AAAAAGACAAAAATGTAGCAGGG - Intergenic
1188461829 X:30436120-30436142 GAAAAGGCCACAATCCAGCTTGG - Intergenic
1189595192 X:42557198-42557220 AAATAACCAAAATTGCAGCTGGG + Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190278877 X:48916857-48916879 AAAAAGTCATAAATGCAGCCGGG + Intronic
1190314233 X:49139480-49139502 GATAAGCCCAAAATGCATATTGG - Intergenic
1190628643 X:52363388-52363410 GATAAGCAATGAATGCAGCTAGG - Intergenic
1190757511 X:53413662-53413684 GAAAAGGACAAAATGAAGCTTGG + Intronic
1191607207 X:63075887-63075909 GTAAAGTTAAAAATTCAGCTGGG + Intergenic
1193447880 X:81627270-81627292 GAAATGCCAAACAGGCAGCTGGG - Intergenic
1194992846 X:100563584-100563606 GAAATGCTATAAATGCAGCCAGG - Intergenic
1195765436 X:108291692-108291714 AAAATGCCAAAAATGCAGAGAGG + Intronic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1197320641 X:125025425-125025447 GAAGAGCAAAAAATATAGCTCGG + Intergenic
1198239541 X:134769941-134769963 CAAAAACTAAAAATGAAGCTTGG + Intronic
1198890860 X:141394790-141394812 GAAAACCACCAAATGCAGCTGGG - Intergenic
1199543336 X:148981705-148981727 GAAAAACTGAAAAAGCAGCTTGG - Intronic
1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG + Intronic
1201313212 Y:12616389-12616411 GAACAGCCAAGGATGCTGCTGGG - Intergenic
1201566390 Y:15369168-15369190 AAAAAGGCAAAAAAGCAGCCAGG + Intergenic