ID: 1184810570

View in Genome Browser
Species Human (GRCh38)
Location 22:46828734-46828756
Sequence CAGTCCAAACAGAGACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184810570_1184810577 12 Left 1184810570 22:46828734-46828756 CCCTCCTGTCTCTGTTTGGACTG 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1184810577 22:46828769-46828791 CACTGTCACTCTAGCCACATGGG 0: 1
1: 0
2: 0
3: 8
4: 132
1184810570_1184810576 11 Left 1184810570 22:46828734-46828756 CCCTCCTGTCTCTGTTTGGACTG 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1184810576 22:46828768-46828790 CCACTGTCACTCTAGCCACATGG 0: 1
1: 0
2: 1
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184810570 Original CRISPR CAGTCCAAACAGAGACAGGA GGG (reversed) Intronic
900319847 1:2077350-2077372 CAGCCCCAACAGACACAGGGCGG - Intronic
900614471 1:3558678-3558700 CACACCGAACAGAGAAAGGAAGG - Intronic
900659251 1:3774635-3774657 GAGGCCCTACAGAGACAGGAGGG - Intronic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
902718718 1:18290347-18290369 AAGTCCCGACAGAGATAGGAGGG + Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903754279 1:25649977-25649999 CAGTACAACCACAGACAAGATGG - Intronic
904342508 1:29845973-29845995 CAGTCCACACGGTGACAGCAGGG + Intergenic
904516166 1:31057087-31057109 TAGTCGAAACAAAGACAGGCTGG - Intronic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
905383413 1:37581071-37581093 AAGTACATACAGAGAGAGGATGG + Intronic
906177031 1:43783435-43783457 CAGCCCAATCAGAGACAAGATGG - Intronic
906196631 1:43934039-43934061 CAGTCCAACAAGCGACAAGAGGG - Intronic
907250810 1:53137815-53137837 CAGTCCAAACTGGAGCAGGAAGG - Intronic
907717521 1:56940998-56941020 CATTCCAGACAGAAACAAGAGGG - Exonic
910278486 1:85472870-85472892 GACTCCAAAAAGAGACAGGAGGG - Intronic
911377064 1:97063737-97063759 GAGTTGCAACAGAGACAGGAGGG - Intergenic
912650770 1:111436771-111436793 TAGTCTAGAGAGAGACAGGATGG - Intergenic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
913440258 1:118889453-118889475 CAGGCCATACTGATACAGGAGGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915938269 1:160101488-160101510 CAGGCCAGACTGAGACACGAAGG + Intergenic
916078591 1:161218025-161218047 AATTCCATACAGAAACAGGATGG - Exonic
919428118 1:197459334-197459356 CAGTCCAAACAGAGTAAAGTAGG - Intronic
921777827 1:219123329-219123351 CAGTCCACTCCGAGAAAGGAAGG + Intergenic
923676400 1:236084257-236084279 CAATGCAAACAGATAAAGGAAGG + Intergenic
1063220855 10:3966395-3966417 CCTTCCAAACAGGGAGAGGAAGG - Intergenic
1063879747 10:10518944-10518966 CAGACCAAAAAGAATCAGGAAGG + Intergenic
1065152076 10:22832064-22832086 AAGTCCAAAGAGAGAAAGGGGGG - Intergenic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1065598557 10:27344630-27344652 GTGTCTAAACATAGACAGGAGGG + Intergenic
1065706191 10:28473669-28473691 GAGTCCAAAAAGAGTCAGCAAGG + Intergenic
1066517776 10:36183081-36183103 CAGTCCAATGAGAGAGAGGTGGG - Intergenic
1067037511 10:42931261-42931283 CATGAGAAACAGAGACAGGAAGG - Intergenic
1068912154 10:62389784-62389806 CAGAACAAAAAGAGACTGGAAGG + Intronic
1069040505 10:63691128-63691150 CAGTCGAAAGAAAGAAAGGAAGG - Intergenic
1069422231 10:68256989-68257011 GAGTCCAGGCAGAGATAGGACGG + Intergenic
1069479115 10:68764607-68764629 CAATCCAAAAAGAGACTGGATGG - Intronic
1070501240 10:77074515-77074537 TCGTCCTCACAGAGACAGGATGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073072250 10:100802119-100802141 AAGACCAAACAGAGCAAGGAAGG - Intronic
1073873645 10:107896325-107896347 TAGTCCAAACACAGACAAAAGGG - Intergenic
1074006156 10:109426545-109426567 CAGGAAAAAAAGAGACAGGAGGG + Intergenic
1075464550 10:122641915-122641937 CAGGCCAAACAGAGAATGTATGG - Intronic
1077793238 11:5463789-5463811 CTGTCTAAAGAGATACAGGAGGG + Intronic
1078684499 11:13515818-13515840 TGGTGCAAACTGAGACAGGAGGG + Intergenic
1080674916 11:34416757-34416779 CAGTCCAATCAGAAACAGAGAGG - Intergenic
1081027567 11:38034926-38034948 GAGTGAAAACAGAGACAGAAAGG + Intergenic
1083323600 11:61862407-61862429 CAGTCCAGCCAGAGGCAGGGAGG + Intronic
1084103590 11:66966090-66966112 CAGCCCAAGCACAGGCAGGAAGG - Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1087151539 11:94864660-94864682 CAATGCAAACAGACACAGAATGG - Intronic
1087570322 11:99919066-99919088 CACACCAAACAAAGGCAGGAAGG - Intronic
1087666412 11:101053825-101053847 CTGCCCACACAGAGAAAGGAAGG - Intronic
1088687470 11:112297216-112297238 AACTGCAAACTGAGACAGGAGGG - Intergenic
1089611076 11:119669543-119669565 CAGTCCACAGAGGGAAAGGATGG - Intronic
1090387008 11:126363198-126363220 CGGCTCAAACAGGGACAGGAAGG - Intronic
1090936120 11:131344170-131344192 CAGTGCAAACAGAGAGAAAAGGG + Intergenic
1090954232 11:131500251-131500273 CTGTTCAAAGAGAGAAAGGAAGG - Intronic
1092297232 12:7210192-7210214 CAGGCCAAACATAGTTAGGAGGG - Exonic
1092956939 12:13560005-13560027 CATTCCACACAAAGACAGGCTGG - Exonic
1093295139 12:17380572-17380594 CAGTCCAACCTGGCACAGGAAGG - Intergenic
1097064377 12:56309997-56310019 CAGCAAGAACAGAGACAGGAAGG - Exonic
1097729127 12:63107592-63107614 CAGTCCAAAAAGATAAAGGCAGG - Intergenic
1097963548 12:65555860-65555882 AAGTTCTAACAGAGACAGCAAGG + Intergenic
1099890547 12:88584220-88584242 TGGTCCAAACAGAGGCAGAAAGG - Intergenic
1100079730 12:90833574-90833596 CAGTAAAAACACAGACATGAAGG + Intergenic
1100610286 12:96186223-96186245 GCCTCCAGACAGAGACAGGAGGG + Intergenic
1101470595 12:104993264-104993286 CAGTCACAACAGAGACAGTAAGG - Intronic
1102167074 12:110815084-110815106 CAGCCCTAAAGGAGACAGGAGGG - Intergenic
1102623891 12:114219051-114219073 CATCCCAAAGAGAGACAGGAAGG - Intergenic
1102765444 12:115428814-115428836 CATTCCTAATAGAGACAGCATGG - Intergenic
1102858857 12:116318272-116318294 CAGTCCCCACAGTCACAGGACGG - Intergenic
1102946878 12:116997624-116997646 CAGTCCAAGCAGAGGCAGCAGGG + Intronic
1104197522 12:126555172-126555194 CAGAGCAAACAAAGATAGGAAGG + Intergenic
1104795048 12:131511473-131511495 CTGTCTATTCAGAGACAGGACGG - Intergenic
1110653728 13:77972602-77972624 CAGTCTAAAGAGAGTCAAGAGGG + Intergenic
1111411336 13:87880812-87880834 CAGTCCAAACTAAGATAGGAGGG + Intergenic
1113579564 13:111419450-111419472 CAGTCCAACAAGAGAGAGAAGGG + Intergenic
1114517127 14:23307290-23307312 TACTCCAGACAGAGAAAGGAAGG - Intronic
1116722834 14:48522940-48522962 CAAACCAAACAGCCACAGGAGGG - Intergenic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1121323122 14:93004287-93004309 CAGGCAAAACAGAGACCGCAGGG - Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1125062029 15:35436718-35436740 CTGTCTTAACTGAGACAGGATGG - Intronic
1125733682 15:41908985-41909007 CAGTCCTCACAGAGCCAGGCTGG - Intronic
1128568731 15:68718254-68718276 CAGTCCTGAGAGAGAAAGGAGGG - Intronic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128901683 15:71428307-71428329 TAGTCTGAACAGAGACAGCATGG - Intronic
1129166845 15:73783329-73783351 CAGTCCAGACAGAGTGAGGCTGG - Intergenic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129681664 15:77661759-77661781 CTGAGCAAACAGAGACAGCATGG + Intronic
1129855449 15:78821438-78821460 CAGTCCAGACAGAAACAGGAAGG + Intronic
1131515503 15:93073753-93073775 CAGGCCAAACCCAGTCAGGATGG - Exonic
1131789616 15:95949686-95949708 GAGTCCAAACAGAGACGAAATGG - Intergenic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1135747205 16:25027386-25027408 CAGTCCATATAAGGACAGGAAGG - Intergenic
1137258863 16:46805075-46805097 CAGTCTAAAAAGAGAAATGATGG - Intronic
1140858869 16:79001914-79001936 CAGTCCATAGTGAGACTGGAGGG + Intronic
1140925755 16:79581736-79581758 CAGTCCAAAAAGAGAGGTGAAGG - Intergenic
1142777983 17:2156630-2156652 AAAACAAAACAGAGACAGGAGGG - Intronic
1143421073 17:6792734-6792756 CCGCCTAAACTGAGACAGGAAGG - Intronic
1143712311 17:8743440-8743462 AATTACAAACAGAGACAGGTGGG + Intronic
1144754072 17:17668914-17668936 GAGTGCAGACAGAGACAGGCAGG + Intergenic
1144949133 17:18984700-18984722 CAGGCCAACCAGAGACAGGCTGG - Intronic
1148133001 17:45273663-45273685 CAGGCCAAACCGAGCCAGGGTGG - Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149379334 17:56077538-56077560 CAGTCCAAAAAGTGCCAGGAGGG - Intergenic
1150714085 17:67556760-67556782 CAATCCTAACTGAGGCAGGAAGG - Intronic
1152510278 17:80782152-80782174 CTCTGCAAACAGGGACAGGAGGG - Intronic
1153193613 18:2569785-2569807 CAGTGCAAAAAGAGACTTGACGG - Intronic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1154048421 18:10929900-10929922 CAGTTCAGACAATGACAGGAAGG + Intronic
1157083745 18:44555796-44555818 CACTCCCCACAGAGATAGGAAGG - Intergenic
1157564823 18:48672804-48672826 GAGTCCGAACAGGGACAGAAGGG - Intronic
1158531177 18:58263094-58263116 GAGTCAAATCAGAGATAGGAGGG - Intronic
1160080019 18:75717499-75717521 CACTCCAAACATCCACAGGATGG + Intergenic
1160774466 19:848664-848686 CAGTCCAGGCAGAGACCTGAGGG + Intergenic
1162540114 19:11290414-11290436 GAGTCCCAACAGAGACGGTATGG + Intergenic
1163492190 19:17623487-17623509 GAGTCCAGACACAGAGAGGACGG + Intronic
1164022252 19:21318293-21318315 GAGTCCAGATAGAGATAGGATGG + Intronic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
925204709 2:1996251-1996273 CAGTCCACACTGAGGCAGGGCGG - Intronic
925204733 2:1996389-1996411 CAGTCCACACTGAGGCAAGACGG - Intronic
926308346 2:11656782-11656804 CAGTCCAAACGCAGATAAGACGG - Intergenic
927517847 2:23682464-23682486 AAATCCACACAGAGGCAGGATGG - Intronic
929959182 2:46483635-46483657 CAGACCATAAAGAGAAAGGAAGG + Intronic
930381171 2:50631727-50631749 CAGTCCAGCCAGACACAGAATGG - Intronic
930975663 2:57457338-57457360 CAGTCCACATAGATACATGAAGG + Intergenic
932284057 2:70518028-70518050 CACTCCAAACAAAGGAAGGATGG + Intronic
937921299 2:127133467-127133489 CAGTCCCATCAGAAAGAGGAGGG + Intergenic
938287990 2:130134634-130134656 CACTACAAATAAAGACAGGAAGG - Intergenic
938468535 2:131538265-131538287 CACTACAAATAAAGACAGGAAGG + Intergenic
938931879 2:136093838-136093860 CATTCCAATTAGAGAAAGGAGGG + Intergenic
939347576 2:140986908-140986930 CAATGCAAACAGCTACAGGATGG + Intronic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
941999731 2:171633865-171633887 CATTCCAAAAGGAGACAGGAGGG - Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944869696 2:203897461-203897483 AAGTCCAATCAGAGGCAGGAAGG - Intergenic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
946050024 2:216854817-216854839 CAGTCCAGACAGAGAAATGAGGG + Intergenic
947533839 2:230928765-230928787 AAGCCCCAACAGAGAGAGGAAGG + Intronic
947971947 2:234332125-234332147 CAGTCCGAACAGAGAGACGCAGG - Intergenic
948149696 2:235735382-235735404 CAGTCTACACAGAGACAAGTCGG - Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1169395638 20:5226535-5226557 CAGTCCAGACACAGCCAGGCAGG - Intergenic
1171450991 20:25236225-25236247 CAGCCAAAACAGAGACTGCATGG - Intergenic
1172828005 20:37806797-37806819 CTGTCCAATCAGAGTTAGGAGGG + Intronic
1173167151 20:40693245-40693267 GAACCCAAAAAGAGACAGGAGGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1179077773 21:38140095-38140117 GATCCCAAAAAGAGACAGGAAGG + Intronic
1180167622 21:46038163-46038185 CAGTCCACACAGAGACACACGGG + Intergenic
1181120114 22:20661652-20661674 CACTACAAATAAAGACAGGAAGG - Intergenic
1182059761 22:27388524-27388546 CTCTCTGAACAGAGACAGGAAGG + Intergenic
1182143952 22:27985244-27985266 CTTACCAAACAGAGACAGCAGGG + Exonic
1182752082 22:32649786-32649808 CAGTCTAAATAGGGACAGGGCGG + Intronic
1183160504 22:36110143-36110165 CAGTCCAGGCAAAGACAGGAAGG + Intergenic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1185039167 22:48495646-48495668 CAGCCCAGACAGAGAGAGGACGG - Intronic
950714598 3:14838772-14838794 CAGTCCAAACAGGGAGAAAATGG + Intronic
951448880 3:22814081-22814103 CAGTGGCAACAGAAACAGGATGG - Intergenic
952828908 3:37546738-37546760 CAGTCCAGACAGAGGCAAGCAGG - Intronic
953056333 3:39390393-39390415 CAGACAAAATGGAGACAGGAAGG - Intronic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
954264810 3:49463805-49463827 GAGTGCTGACAGAGACAGGAAGG + Intergenic
954410983 3:50370977-50370999 CAGTCCAACCAGAGACGGGTCGG + Intronic
955776208 3:62436503-62436525 CATTGAAAACAGAGACAGGCAGG - Intronic
956251420 3:67238089-67238111 TAGTCCCAACAGAGACCGTATGG - Intergenic
958946874 3:100372347-100372369 CAATCCAAATGAAGACAGGAGGG + Intronic
959123793 3:102265611-102265633 CAGTCCAAGCTAAGACAGGAGGG + Intronic
960876695 3:122303063-122303085 CAGTTCAAGTAGAGAAAGGAAGG - Intergenic
961007794 3:123416424-123416446 TAGTCAAATCAGAGACAGGGAGG - Intronic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969273722 4:6120517-6120539 CAGCCCAGGCAGAGACAGGGAGG + Intronic
969556187 4:7912055-7912077 AAGTCCACACAGACCCAGGATGG + Intronic
970228062 4:13880311-13880333 CAGTCCAGACATATTCAGGAGGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970543903 4:17107257-17107279 AACTCCAATCAGAGAGAGGAAGG + Intergenic
970644647 4:18106513-18106535 CAGTCCACACAGACAGAAGATGG - Intergenic
970820446 4:20205631-20205653 CAGTTAAAACAGAGAAAAGAGGG + Intergenic
970987163 4:22171982-22172004 CAGTGCCAACAGGGACAGGATGG + Intergenic
972150689 4:36086161-36086183 CAGTCCCAACCGAGGCAGCAGGG + Intronic
973742642 4:53933234-53933256 CAGTCCAATCAGCGTGAGGAAGG + Intronic
973902119 4:55486354-55486376 CAGTCCCAATAGAAACAGGTTGG - Intronic
975593269 4:76021425-76021447 AATTCCAAACACATACAGGAAGG - Exonic
976469003 4:85405198-85405220 CCTTCCAAACATAGACAGGCTGG - Intergenic
979084210 4:116385826-116385848 CAGACGAAACAGGGCCAGGAAGG - Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980895528 4:138856166-138856188 CAGACAAAATAGAGACAGGGAGG - Intergenic
983376883 4:166941123-166941145 CAGTTAAAACAGATTCAGGAGGG + Intronic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
985549443 5:525529-525551 CCGTCCAAACAGAGGGAGCAGGG - Intergenic
985549932 5:528030-528052 CAGGCCCAACACGGACAGGACGG - Intergenic
985656540 5:1134590-1134612 CAGTCCATACGGAAACAGAACGG + Intergenic
986723791 5:10579286-10579308 GAGTTCTAACATAGACAGGAAGG + Intronic
986782124 5:11075902-11075924 GAATCCAAATAGAGAGAGGAAGG - Intronic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
987849051 5:23325242-23325264 CAGAGAAAAAAGAGACAGGAGGG + Intergenic
987890005 5:23864434-23864456 CAGTCCATCCAGAGAAAGGGAGG - Intergenic
987950095 5:24663439-24663461 CAGACAAAATAGAGACAGTAGGG - Intergenic
988238017 5:28572093-28572115 CAGTCTAAACAGAGACACATTGG - Intergenic
990401000 5:55437140-55437162 CAGCCCAAACTAAGACAGGAAGG + Intronic
991365780 5:65866561-65866583 CAGCCAAAACAGAAACAGGAGGG + Intronic
991519644 5:67481485-67481507 CTGTTCACACAGAGACATGATGG - Intergenic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
991966240 5:72094299-72094321 CAGCCCAAACAGAAACAGCATGG - Intergenic
993733944 5:91453394-91453416 CAGGCCACACAGAGACAGGGAGG - Intergenic
994528825 5:100940117-100940139 CAGTCCAAATGCTGACAGGATGG - Intergenic
996469818 5:123846819-123846841 CAAACCACACAGAGACAGAAAGG + Intergenic
998873298 5:146574656-146574678 CAGTCACAACAGAGACTGTATGG + Intergenic
999019972 5:148154376-148154398 CACTGCAAACAGATACAGCAAGG - Intergenic
999262126 5:150244766-150244788 CAGCCCACACATAGGCAGGACGG + Intronic
1001259626 5:170216913-170216935 AAGTCATAACAGAGAAAGGAGGG + Intergenic
1001259712 5:170217666-170217688 CTCTCTAAACAGAGAAAGGATGG + Intergenic
1001298151 5:170513803-170513825 GAGTCTAAACAGACACAGGTAGG + Intronic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1003724365 6:8743507-8743529 CAGTTCACACAGAGACAGCAAGG - Intergenic
1004348835 6:14873316-14873338 GCTTCCAAACAGACACAGGAAGG - Intergenic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1010705941 6:79110991-79111013 CAGCCCAGACAGAGAAAGAAAGG + Intergenic
1011057431 6:83220395-83220417 CAGACCACACAGGGCCAGGAGGG + Intronic
1011712678 6:90070474-90070496 CAGGCCAAGCAGACACAGCATGG + Intronic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1014225778 6:118845112-118845134 CATTTGAAACGGAGACAGGAAGG + Intronic
1015322943 6:131896550-131896572 AGGTCCAAACAGAAACAAGATGG + Intergenic
1016292825 6:142542468-142542490 CAGTCCAAACCTAGAAGGGATGG + Intergenic
1019271236 7:150224-150246 CAGTCCAGACACAGGCAGGGCGG + Intergenic
1019448490 7:1083768-1083790 GACACCAAACAGGGACAGGACGG + Intronic
1019879849 7:3849075-3849097 AACTCTAAACAGAGAAAGGACGG - Intronic
1020767694 7:12345626-12345648 CCATCCAAACAGAGACAGGAGGG - Intronic
1021554140 7:21902829-21902851 CAATGCAAACAGATACAGAATGG + Intronic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1023851016 7:44150408-44150430 CAGTCCCTACAGAGACAGAGAGG - Intronic
1024124943 7:46284193-46284215 CAGTCCAAACAGGAAAAGGGGGG + Intergenic
1026949364 7:74337296-74337318 CTGTCCCAAGAGAGACAGAAGGG + Intronic
1027185343 7:75967750-75967772 CGGTCCATACAGAGGGAGGAGGG + Intronic
1027254616 7:76423274-76423296 CTCTCCAAAAAGAGCCAGGAGGG + Intronic
1028850794 7:95535121-95535143 CAGATAAAACAGAGACAGAAAGG - Intronic
1029098240 7:98106293-98106315 CAGTCCACACAGGGCCAGGGCGG + Intergenic
1029804008 7:102977470-102977492 CAGTCCAAACCTGGAAAGGATGG + Intronic
1029871411 7:103697020-103697042 CAGCCCAAACTGAGGCTGGAAGG - Intronic
1031391443 7:121219726-121219748 CATTCCAAACATAAACAGCAAGG + Intronic
1032153840 7:129452476-129452498 CAGACCCAAGAGATACAGGAGGG - Intronic
1032565318 7:132935926-132935948 CACACAAAACAGAGAGAGGATGG + Intronic
1033594559 7:142848242-142848264 CAACCCAAGGAGAGACAGGAAGG - Intergenic
1034216429 7:149410380-149410402 CAGCCCAATCAGACACAGGCAGG - Intergenic
1034784358 7:153911570-153911592 CATTGCAAACTGAGAGAGGAAGG - Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035745580 8:1960130-1960152 CAGCCCGAACGGAGACAGGAAGG + Intergenic
1037299640 8:17437847-17437869 CTGTCCAAAGAGAGACAGACAGG + Intergenic
1040993413 8:53376263-53376285 CAGTCTAAGGAGAGTCAGGAGGG + Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1042158626 8:65869723-65869745 CAGTCCAAACCTGGAAAGGATGG + Intergenic
1042379660 8:68098255-68098277 CAATTCAAACAGAGACATAAAGG - Intronic
1042573335 8:70191389-70191411 CAGTCAAAAGACAGACAGGGTGG + Intronic
1044624057 8:94218767-94218789 GAGCCCAAACAGACAGAGGAGGG - Intergenic
1045781244 8:105865571-105865593 TAGTAGAAATAGAGACAGGATGG - Intergenic
1046632951 8:116639962-116639984 CAGTCCAAGAAGAGACGGCAAGG + Intergenic
1046690305 8:117276589-117276611 CAGACCAAACAGCCACAGGATGG + Intergenic
1046818255 8:118608834-118608856 CAGCCTAAACAAAGACAGGAGGG + Intronic
1048043974 8:130756100-130756122 CAGGCCCAACAAGGACAGGATGG - Intergenic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1049561626 8:143314889-143314911 CAGGCCATACAGAGATATGAGGG + Intronic
1049792745 8:144479439-144479461 CAGGCCAATCAGAGACACGAGGG - Intronic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1052966575 9:34345011-34345033 AAGTCACAACAGAGAGAGGAGGG + Intergenic
1055116608 9:72612010-72612032 AAATCCAAACAGAAGCAGGAGGG - Intronic
1056032075 9:82563297-82563319 CAGTCCATACAGGGACAAAAGGG - Intergenic
1056691012 9:88808790-88808812 CAGTCCATACAGGGCCAGCAAGG - Intergenic
1057418523 9:94887830-94887852 CAGTCCATACAGAGAAACTAGGG + Intronic
1058388282 9:104464020-104464042 CAGATCAAAGAGATACAGGAAGG + Intergenic
1059311427 9:113391198-113391220 CAATACAAACAGAAAAAGGAAGG - Intronic
1059337910 9:113580724-113580746 CAAACCAAACAAAGCCAGGAGGG - Intronic
1059789013 9:117619670-117619692 CAGATCAAACAGAAACAGGCAGG + Intergenic
1061783110 9:133007394-133007416 CAGTCCACACAGTGTCAGGTAGG - Intergenic
1061867012 9:133497433-133497455 CAGTCCACACTGAGACAGGGTGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1189039129 X:37524066-37524088 CAGTCAAAAAAAAGAAAGGAAGG - Intronic
1189342348 X:40213698-40213720 CCGTACTAACACAGACAGGAAGG + Intergenic
1192503883 X:71669422-71669444 CAGTCCACCCCAAGACAGGAGGG - Intergenic
1192864662 X:75117905-75117927 CAGTTCACACAGAGAGAGAAAGG - Intronic
1194307722 X:92269231-92269253 CACTCCAAACAGAGAAACCAAGG - Intronic
1195277924 X:103300317-103300339 CAGTTAAAACAAAGACAGGGTGG - Intergenic
1196820048 X:119694295-119694317 CAGTCCCAAGAGAGAGGGGAGGG - Intergenic
1197572435 X:128165779-128165801 GAGTACAAACAGAGACACCATGG + Intergenic
1197848128 X:130826274-130826296 CAGTCCAAACAGACAGAGTTGGG + Intronic
1199524050 X:148771577-148771599 CAATCACAACAGAGACAAGATGG - Intronic
1199939826 X:152613954-152613976 AGGTCCAAACTGAGAGAGGAAGG + Intergenic
1200068005 X:153514232-153514254 CTGTCCCAACAGTGGCAGGAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic