ID: 1184812359

View in Genome Browser
Species Human (GRCh38)
Location 22:46844762-46844784
Sequence CGGTCTGAGCACAGTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184812354_1184812359 12 Left 1184812354 22:46844727-46844749 CCCTCCTGCTCACTTGCAGGCAT 0: 1
1: 0
2: 2
3: 21
4: 248
Right 1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189
1184812352_1184812359 27 Left 1184812352 22:46844712-46844734 CCAGTTGTAATGAAGCCCTCCTG 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189
1184812356_1184812359 8 Left 1184812356 22:46844731-46844753 CCTGCTCACTTGCAGGCATCATA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189
1184812351_1184812359 28 Left 1184812351 22:46844711-46844733 CCCAGTTGTAATGAAGCCCTCCT 0: 1
1: 0
2: 3
3: 10
4: 112
Right 1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189
1184812355_1184812359 11 Left 1184812355 22:46844728-46844750 CCTCCTGCTCACTTGCAGGCATC 0: 1
1: 0
2: 4
3: 21
4: 187
Right 1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184812359 Original CRISPR CGGTCTGAGCACAGTGAGGC TGG Intronic
900129762 1:1082431-1082453 CCCTCTGAGAACAGTGAGGCTGG - Exonic
900156772 1:1206294-1206316 CGGTCTGAGCACGGGAAGGGGGG + Intronic
900591752 1:3463297-3463319 CGTCCTGAGCACAGAGAGCCCGG + Exonic
901170735 1:7255386-7255408 TGGTGGGTGCACAGTGAGGCTGG - Intronic
902505785 1:16938482-16938504 AGGTGTGAGCCCAGAGAGGCGGG + Exonic
902579766 1:17401118-17401140 TGGTCTGACCGCAGAGAGGCAGG + Intronic
902695097 1:18134804-18134826 CGGTCTGAGCAGGTTGAGTCGGG - Intronic
903290599 1:22311697-22311719 TGGTCGGAGCAGAGTGAGGGAGG + Intergenic
904378484 1:30096068-30096090 GGGTCTGGGCACAGCCAGGCGGG + Intergenic
904407571 1:30303106-30303128 CCCTCAGAGCACAGTGAGACAGG + Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
905972983 1:42155016-42155038 CGGTTTGGGCACTGTGAGTCAGG + Intronic
907242331 1:53087740-53087762 CGGTGTGAGCCCGGTGAGGGCGG - Exonic
915365548 1:155313493-155313515 CGTGCTGAGCACAGTCAGCCCGG + Intronic
915470103 1:156120833-156120855 CGGTCAGAGCTCTGGGAGGCTGG + Intronic
915930261 1:160056196-160056218 CGAGATGAGCACAGTGAGCCTGG - Intronic
919743604 1:200994991-200995013 AGGTCTGAGCACAGCAAGGCAGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
1063099329 10:2935818-2935840 GGGTGTGAGCGCAGTGAGCCAGG - Intergenic
1063685768 10:8235853-8235875 GGGGCTGAGCAGAGTGGGGCAGG + Intergenic
1068130948 10:52894424-52894446 AAGTGTGAACACAGTGAGGCTGG + Intergenic
1069939229 10:71943025-71943047 CAGTCTGAGGACAGTCAGGAGGG - Intergenic
1071300875 10:84255249-84255271 CGATCTGAGCAAAGGGAGGGTGG - Intronic
1073125341 10:101145837-101145859 CGGCCTGGGCACAGTGAGGCTGG - Intergenic
1075636978 10:124035975-124035997 CTGTCTGGGCACAGAGAGGTGGG - Intronic
1076223891 10:128757970-128757992 TGGACTGAGGACAGGGAGGCAGG + Intergenic
1076295093 10:129377994-129378016 CGGGCTGAGGACAGTTAGCCAGG - Intergenic
1077554898 11:3221185-3221207 CCCTCTGTGCCCAGTGAGGCTGG + Intergenic
1078088533 11:8249220-8249242 GGGTCTGTGCAGGGTGAGGCAGG - Intronic
1078446602 11:11409492-11409514 CTGGCTGAGCACAGGAAGGCTGG - Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083295589 11:61713777-61713799 GGGACTCAGCACAGTGAGGCTGG - Intronic
1083931713 11:65849925-65849947 CGGTCTGGGCGAAGTGAGGGAGG - Exonic
1084563371 11:69916226-69916248 GGGTCTGGGCAGAGTGAGGCTGG + Intergenic
1089326936 11:117663760-117663782 CGGACTGAGTACAGGGGGGCTGG + Intronic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1090331039 11:125932482-125932504 CCGCCTGAGCCCAGGGAGGCAGG + Intergenic
1091227718 11:133967548-133967570 CGGTCTCAGCACAGTGAGGAGGG - Intergenic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092534618 12:9376489-9376511 CTGTCAGAGCCCAGTGAGGTGGG - Intergenic
1103976566 12:124706470-124706492 CGGTCTGTTCACATTGAGGGAGG + Intergenic
1104297647 12:127531950-127531972 TGATCTGAGCTCAGTGAAGCTGG - Intergenic
1104351451 12:128047693-128047715 AGTTCTAAGCACAGTGAGGATGG - Intergenic
1104792206 12:131490653-131490675 TGTTCTGAGGACAGTGATGCAGG - Intergenic
1108243569 13:48492549-48492571 CAGTTTTAGCGCAGTGAGGCGGG - Intronic
1112298159 13:98207478-98207500 GGGTCTGAGCACCTTTAGGCTGG + Intronic
1113586735 13:111471035-111471057 CGGTTTGGGGACAGTGAGGGAGG - Intergenic
1114062959 14:19037373-19037395 AGTCCAGAGCACAGTGAGGCTGG + Intergenic
1114099301 14:19362624-19362646 AGTCCAGAGCACAGTGAGGCTGG - Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114643183 14:24238281-24238303 CTGGCTGGGCACAGTGAGTCAGG + Exonic
1117513261 14:56473715-56473737 CGGCCTCAGCACAGGGAGTCAGG - Intergenic
1119659755 14:76441868-76441890 CATTCTGGGGACAGTGAGGCAGG - Intronic
1121008906 14:90508487-90508509 AGGTCTCAGAACAGTGAGGTAGG - Intergenic
1122299232 14:100722663-100722685 GTGGCTGAGCACACTGAGGCTGG - Intergenic
1122314277 14:100816491-100816513 GGCTCTGAGCTCAGTGAGGCAGG + Intergenic
1122717959 14:103706713-103706735 CTGGCTGAGCACAGCGATGCCGG - Intronic
1123059519 14:105588157-105588179 CCGTCTGGGCACTGTGTGGCCGG + Intergenic
1123109104 14:105857095-105857117 TGGTCTGAGCTCAGCTAGGCTGG - Intergenic
1202849536 14_GL000225v1_random:8335-8357 CGGTATGGGCAGAGAGAGGCCGG - Intergenic
1127268029 15:57376674-57376696 CGGACTGAGCACAGTGCACCTGG - Intronic
1129465616 15:75722723-75722745 TGGCCTGAGGCCAGTGAGGCTGG + Intergenic
1129894435 15:79092868-79092890 TGTCCTGAGCACAGTGAGGCAGG + Intergenic
1131975628 15:97943177-97943199 AGGCCTGAGAACAGAGAGGCAGG + Intergenic
1132543474 16:522297-522319 GGGCCTGGGCACAGAGAGGCAGG - Exonic
1134859875 16:17551650-17551672 CAGCCTGAGCACTGTGATGCTGG + Intergenic
1138106467 16:54289557-54289579 ACGTGTGAGCACCGTGAGGCTGG - Intergenic
1138627689 16:58265642-58265664 AAGTCTGCGCACAGTGTGGCTGG - Intronic
1139357682 16:66377123-66377145 GGGTCTGGGTCCAGTGAGGCTGG + Intronic
1141829547 16:86502251-86502273 GGGACTCAGCACAGTGAGGGAGG - Intergenic
1142595879 17:1029750-1029772 TGGCCTGCGCACAGTGAGGTGGG + Intronic
1142622892 17:1176166-1176188 CTGTCTGAACCCACTGAGGCTGG - Intronic
1147980143 17:44269069-44269091 CGCTCTGGGCACAGAGAGGAGGG + Intergenic
1147993999 17:44351483-44351505 TGGGCTGAGCACAGTGTGGCAGG + Intronic
1148643641 17:49206518-49206540 CACTCTGAGGACAGTGTGGCTGG - Exonic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1150340530 17:64363046-64363068 CGGTCTGAGCAGACTCAGGCAGG - Intronic
1150342949 17:64383542-64383564 GGTTCAGAGAACAGTGAGGCTGG + Intronic
1150843790 17:68634479-68634501 CGATCTGAGCTCAGTCATGCTGG + Intergenic
1151851357 17:76692028-76692050 CCTCCTGAGCACAGAGAGGCTGG + Intronic
1152527175 17:80895057-80895079 CTGTCTGGGGACAGTGAGGCCGG + Intronic
1152790333 17:82275183-82275205 CGGGCTGGGCAAGGTGAGGCAGG + Intergenic
1154110669 18:11566014-11566036 CGGTCTGACCACAGTGTGTATGG - Intergenic
1154451121 18:14475275-14475297 AGTCCAGAGCACAGTGAGGCTGG - Intergenic
1156625197 18:38900179-38900201 AGTTCTCAGCACAGTGTGGCTGG + Intergenic
1157175703 18:45450015-45450037 CAGTCTGACCATAGTGAGACAGG - Intronic
1157186605 18:45546075-45546097 TGGGCTGAGACCAGTGAGGCAGG - Intronic
1157911367 18:51620169-51620191 TGGTCAGAGCACAGGGAAGCTGG + Intergenic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1161954116 19:7483350-7483372 CGGAATGAGCACATTGGGGCGGG - Intronic
1162175029 19:8824022-8824044 GGGTGTGAGCACCGGGAGGCTGG - Intronic
1162484776 19:10952886-10952908 CAGTCTGAGAAGAGTGAGTCTGG - Intergenic
1163032933 19:14556149-14556171 TGGCCTGAGCAGAGTGAGTCAGG - Intronic
1164834547 19:31349264-31349286 CGGGCTGAGGACAGGGAGGGAGG + Exonic
1166752346 19:45170313-45170335 CGCTGTGAGCATAGTGAAGCCGG - Intronic
1167659652 19:50789158-50789180 CTGACTGTGCGCAGTGAGGCAGG + Intergenic
1167794007 19:51697366-51697388 AGGTCTGAGCAGAGTGGGGTGGG + Intergenic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
925813766 2:7727223-7727245 TGGGGTGAGCACAGTGGGGCAGG + Intergenic
925899536 2:8498731-8498753 CTGTGTGAGAACAGTGAGGTGGG + Intergenic
928152470 2:28844566-28844588 CGTTCTGAGCACACTAAGGTAGG + Intronic
931652415 2:64480426-64480448 AGGTATAAGCTCAGTGAGGCTGG + Intergenic
933677081 2:85066489-85066511 AGCTCTGAGCACACTGAGCCAGG + Intergenic
935970566 2:108527279-108527301 CAGTCTGAGGAGAGTCAGGCGGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936250515 2:110864900-110864922 GTGCCTGATCACAGTGAGGCTGG - Intronic
936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG + Intergenic
937256620 2:120560521-120560543 CGGACTGAGCAGGGTGGGGCAGG + Intergenic
937355299 2:121194704-121194726 TGGTCTGGGGACAGTGTGGCGGG + Intergenic
938646099 2:133331869-133331891 CGGTTTGAGGACAGTGACCCAGG + Intronic
938691358 2:133792504-133792526 CGGTTTGAAAACAGTCAGGCAGG - Intergenic
944156845 2:196616575-196616597 AGGTGTGAACACAGTGAGGCAGG - Intergenic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
948641301 2:239377583-239377605 TGGTCTGGGCGAAGTGAGGCAGG - Intronic
948677816 2:239609402-239609424 CAGTCTGATCACTGTGAGCCAGG + Intergenic
948911659 2:241008062-241008084 CGGGCTGTGCTCAGTGAGTCAGG - Intronic
1169182533 20:3582240-3582262 CCGTCTGAGCCCAGTGATGCTGG + Exonic
1169219916 20:3816172-3816194 TGTGCTGAGAACAGTGAGGCAGG - Intergenic
1169552940 20:6719777-6719799 CGCACTCAGCACAGTGAGGACGG + Intergenic
1169798378 20:9490564-9490586 AGGTCTGGGCACAGTGTGGCTGG + Intergenic
1170504817 20:17014287-17014309 AGGGCTTAGCATAGTGAGGCAGG + Intergenic
1171071144 20:22069799-22069821 GGGCCTGAGCACAGCCAGGCTGG - Intergenic
1172585693 20:36082744-36082766 CAGCATGAGCACAGTGAGACAGG - Intergenic
1172892964 20:38279989-38280011 AGGCCTGAGCAAGGTGAGGCTGG + Intronic
1173846848 20:46193699-46193721 CATTCTGAGAACAGAGAGGCTGG - Intronic
1173875801 20:46370652-46370674 CTGTATGAGCTCAGTGAGGGTGG + Intronic
1175921635 20:62453043-62453065 GGGTGTGAGCACAGCCAGGCGGG - Intergenic
1176172625 20:63702905-63702927 AGGTCTGAGCTCAGTGACTCTGG - Intronic
1176445114 21:6815298-6815320 AGTCCAGAGCACAGTGAGGCTGG + Intergenic
1176823281 21:13680331-13680353 AGTCCAGAGCACAGTGAGGCTGG + Intergenic
1180481452 22:15760000-15760022 AGTCCAGAGCACAGTGAGGCTGG + Intergenic
1182000771 22:26917873-26917895 CTGGCTGAGCACAGTGGGGATGG + Intergenic
1183727070 22:39596106-39596128 AGGTCAGAGCAGAGTGAGCCAGG + Intronic
1184354791 22:43971978-43972000 AGGGCTGAGCACAGTGACTCAGG - Intronic
1184648647 22:45909578-45909600 CGACCTGAGCACAGCCAGGCTGG + Intergenic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
1184973598 22:48045427-48045449 GGTTCTGAGCACAGTGAGGTTGG + Intergenic
1185180061 22:49354732-49354754 GGGTCTGAGCACACCCAGGCTGG + Intergenic
1185214875 22:49593019-49593041 CAGCCTGAGAACAGTCAGGCTGG - Intronic
1185276723 22:49953102-49953124 GGGGCTGGGCACAGTGGGGCTGG + Intergenic
953153950 3:40351944-40351966 GGGTCTGGGTAAAGTGAGGCTGG + Intergenic
954797799 3:53170351-53170373 CGGTTTCTGCACAGTGAGCCTGG + Intronic
955093664 3:55776007-55776029 CTGTCTCAGCTCAGTGAGACTGG - Intronic
955565259 3:60237580-60237602 ATGTTTGACCACAGTGAGGCAGG + Intronic
966165334 3:177010443-177010465 TTGTCTGAGAACAGTGAGGCAGG + Intergenic
968569780 4:1333586-1333608 AGGTCTGAGCACAGGGTGCCTGG - Intronic
968840952 4:3005448-3005470 CAGTCCGAGCATAGTGGGGCTGG + Intronic
974499657 4:62684001-62684023 CCTTCTGAGCTCAGTGGGGCAGG + Intergenic
982346600 4:154367130-154367152 AGGGCTGAGCTCAGAGAGGCAGG + Intronic
982402608 4:154984848-154984870 GGTGCTGAGCAAAGTGAGGCAGG + Intergenic
986099134 5:4589637-4589659 CGGTCTGAGCACGGTATGCCTGG - Intergenic
986298730 5:6461693-6461715 TGGTCTGAGCACTGTAGGGCAGG - Intronic
987009058 5:13741289-13741311 TGCTCTGAGCACAGTGAATCAGG + Intronic
989170552 5:38467708-38467730 CTGTCGGAGCTCAGAGAGGCTGG - Intergenic
999098180 5:148999889-148999911 CACTCTGAGTGCAGTGAGGCTGG - Intronic
1001576287 5:172766227-172766249 GGGTCTGAACACAGTGACTCCGG + Intergenic
1002293141 5:178213179-178213201 GGCTCTGAGGACAGTGTGGCTGG - Intronic
1002562563 5:180092226-180092248 CAGTCTGAGCACACCGAGTCAGG - Intergenic
1003519749 6:6848078-6848100 TGGTCTCAGCATTGTGAGGCAGG - Intergenic
1003985178 6:11428048-11428070 CGGACTGAGCACAGGGACCCGGG - Intergenic
1005229538 6:23684446-23684468 CCTTCTGAGCACACTGGGGCAGG + Intergenic
1006154620 6:32007539-32007561 AGCTCTGAGCACTGTGCGGCTGG + Intergenic
1006160932 6:32040274-32040296 AGCTCTGAGCACTGTGCGGCTGG + Intronic
1007680360 6:43629250-43629272 CGGCCTGAGCAGAGTGGGGTGGG + Intergenic
1008680552 6:53867310-53867332 CCCTCTGAGTGCAGTGAGGCTGG + Intronic
1012164470 6:95931056-95931078 ACATCTGAGCACAGTGTGGCTGG + Intergenic
1013270616 6:108542470-108542492 CGGACTTATCACAGTGAGGCAGG - Intergenic
1014474606 6:121857137-121857159 CAGGCTGTGCACTGTGAGGCTGG - Intergenic
1015601560 6:134915859-134915881 AGTTCTGAGCACAGTATGGCAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1023537132 7:41225456-41225478 TGGCCAGGGCACAGTGAGGCAGG + Intergenic
1024832961 7:53483159-53483181 CATTCAGAGCACAGTGAGTCAGG + Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1033043774 7:137942111-137942133 GGATGTGAGCACAGTGTGGCTGG - Intronic
1034532763 7:151707037-151707059 AGGGCTGAGCTCAGTAAGGCTGG - Intronic
1035106012 7:156441930-156441952 CGGTCTGGGCCCTGGGAGGCTGG - Intergenic
1037703608 8:21296877-21296899 CGCTCTGGCCACAGGGAGGCAGG + Intergenic
1037915723 8:22772102-22772124 GGGTCTTATCACAGTGATGCAGG - Intronic
1039981926 8:42415372-42415394 GTGTCAGATCACAGTGAGGCCGG + Intergenic
1042078593 8:65024005-65024027 CGCTCTGAGCACTGTGATGCTGG - Intergenic
1043831376 8:84993231-84993253 TGTTCTGAGCACATTAAGGCAGG + Intergenic
1044612898 8:94112105-94112127 CACTCTGAGCTCATTGAGGCAGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1049427650 8:142544528-142544550 CCGTCTGAGCGCCCTGAGGCCGG - Exonic
1050580017 9:7044314-7044336 GTGTCTAAACACAGTGAGGCTGG + Intronic
1053391665 9:37740589-37740611 AGAACTGAGCACAGTCAGGCTGG + Exonic
1053532884 9:38899304-38899326 GGGGCAGGGCACAGTGAGGCTGG - Intergenic
1054205110 9:62123733-62123755 GGGGCAGGGCACAGTGAGGCTGG - Intergenic
1054633249 9:67464637-67464659 GGGGCAGGGCACAGTGAGGCTGG + Intergenic
1057151333 9:92798602-92798624 GGGGCAGAGCACAGTGAGGCTGG + Intergenic
1057288227 9:93777984-93778006 CCGTGTGCTCACAGTGAGGCGGG + Intergenic
1062025687 9:134339138-134339160 CGGACAGGGCACAGGGAGGCAGG - Intronic
1062034409 9:134376491-134376513 CTGCCTGAGCAGAGTGTGGCGGG - Intronic
1062468833 9:136693279-136693301 CGGGCTGAGCACAGGGGGTCGGG - Intergenic
1203524081 Un_GL000213v1:69227-69249 AGTCCAGAGCACAGTGAGGCTGG - Intergenic
1185633156 X:1531456-1531478 CGGGCTGGGCACAGTCAGGCTGG - Intronic
1189479474 X:41381685-41381707 AGCTCTGAGCAAAGTGAGGAAGG - Intergenic
1190477603 X:50843275-50843297 CTGTCTGAGCACACTCATGCAGG + Intergenic
1191642052 X:63436692-63436714 AGGTCTCAGCACAGAGAGGGAGG - Intergenic
1191715800 X:64192709-64192731 GGGGCTGAGCAAAGTGAGCCAGG - Exonic
1193043945 X:77032888-77032910 CGTGCTGAGCCCAGAGAGGCTGG - Intergenic
1196858122 X:120002212-120002234 TGGTGTGATCATAGTGAGGCAGG - Intergenic
1200310418 X:155071602-155071624 CGCTCTGAGCACAGAGAAGGAGG + Exonic
1200763281 Y:7059162-7059184 CGGTCTGAGGAGAGTCAGGAGGG + Intronic
1200769227 Y:7108264-7108286 CGGTCTGAGGAGAGTCAGGAGGG - Intergenic
1200878246 Y:8182717-8182739 AAGTCTGAGCACAGTGAAACTGG - Intergenic
1202048346 Y:20756319-20756341 AGGTCTGAGAAGAGTGCGGCTGG + Intronic