ID: 1184813653

View in Genome Browser
Species Human (GRCh38)
Location 22:46854266-46854288
Sequence CCTCATTTGTAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1954
Summary {0: 3, 1: 28, 2: 157, 3: 536, 4: 1230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184813647_1184813653 -9 Left 1184813647 22:46854252-46854274 CCTGAGTTTCCTTTCCTCATTTG 0: 1
1: 0
2: 1
3: 47
4: 437
Right 1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG 0: 3
1: 28
2: 157
3: 536
4: 1230
1184813645_1184813653 -7 Left 1184813645 22:46854250-46854272 CCCCTGAGTTTCCTTTCCTCATT 0: 1
1: 1
2: 3
3: 67
4: 588
Right 1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG 0: 3
1: 28
2: 157
3: 536
4: 1230
1184813646_1184813653 -8 Left 1184813646 22:46854251-46854273 CCCTGAGTTTCCTTTCCTCATTT 0: 1
1: 0
2: 5
3: 86
4: 649
Right 1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG 0: 3
1: 28
2: 157
3: 536
4: 1230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184813653 Original CRISPR CCTCATTTGTAAAATGGGGA TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901351772 1:8603627-8603649 CCTAATTTGTGTATTGGGGAAGG + Intronic
901370060 1:8789521-8789543 CCAAATTTGTAATGTGGGGATGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901686646 1:10947114-10947136 CCTGATGGGTCAAATGGGGATGG - Intronic
901761705 1:11476233-11476255 TCTCATCTATAAAGTGGGGATGG - Intergenic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
901939327 1:12649982-12650004 CCTGATTTATAAAATGGAGCTGG + Intronic
902233524 1:15043397-15043419 CCCCTTATGTAAAATGGGGCAGG - Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902634845 1:17728551-17728573 CCTCCCTTGTAAAATGCAGAGGG - Intergenic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902744707 1:18465911-18465933 CCCCATCTGTAAAATGGGTGGGG - Intergenic
902814970 1:18911186-18911208 CCTAATCTGTCAAATGGGGGTGG - Intronic
902936906 1:19771027-19771049 CCTCAACTATGAAATGGGGATGG + Intronic
902965750 1:20000469-20000491 CCTCATTTGTTAATTGCCGAGGG - Intergenic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903168975 1:21540509-21540531 CCTCACCTGTAAAATGGAGCTGG + Intronic
903174535 1:21573082-21573104 CCTCATCTGTGAAACGGGCATGG + Intronic
903177501 1:21589817-21589839 CCCCATCTGTACAATGGGCAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903292210 1:22321447-22321469 CCCCTTTTGTGAAAGGGGGATGG - Intergenic
903306708 1:22418000-22418022 CCTCATCTGTAAAGTGGGAGTGG + Intergenic
903320225 1:22538721-22538743 CATCTTCTGTGAAATGGGGAGGG + Intergenic
903353386 1:22731473-22731495 CCTTATCTGTCAAATGGAGAGGG + Intronic
903366965 1:22811097-22811119 CTTCATTTGTAAAATGAGAGGGG + Intronic
903452696 1:23465404-23465426 CTTCATCTTTAAAATGGGAATGG - Intronic
903475137 1:23614316-23614338 CCTTATCTGTAAAATGGGCGTGG - Intronic
903478661 1:23637738-23637760 CCTCATTGGTAAGATGAGGCTGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903504576 1:23824441-23824463 GCTCATGTGTAAAATGAAGATGG - Intronic
903542882 1:24106863-24106885 TCTCATCTGTAAAATTGGGCTGG - Intronic
903619601 1:24688349-24688371 CCTCTTCTGTTAAATGGGCATGG + Intergenic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903762728 1:25710265-25710287 CCACATCTGTAAGATGGGGTTGG + Intronic
903763162 1:25713328-25713350 CCTCATCTATAAAGTGGGTATGG - Intronic
903774323 1:25782994-25783016 CCTCGTGTGTAAAATGGGATAGG + Intronic
903777683 1:25803594-25803616 TCTCATTTGTCAAATGGAGTTGG - Intronic
903777888 1:25804923-25804945 TCTCATTTGTCAAATGGAGTTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903851214 1:26307209-26307231 CCTCATCTGTAAAATTGTGTTGG + Intronic
903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG + Intronic
903885100 1:26536510-26536532 CCCCATCTGTAACATGGGGTGGG - Intronic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904007334 1:27370310-27370332 CCTCCTCTATAAAATGGGCAGGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904040603 1:27582304-27582326 CCTTATCTATAAAATTGGGATGG + Intronic
904047524 1:27617390-27617412 CCCCATGTGTAAAATGGGGCTGG + Intronic
904054901 1:27663537-27663559 CCCAGATTGTAAAATGGGGAAGG - Intergenic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904388471 1:30163152-30163174 CCTCCTTTGGAAAACGGGGATGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904449942 1:30604744-30604766 CTTCATCTGTCAAATAGGGATGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904533581 1:31184376-31184398 CCACATTTGTTAAATGGAGAAGG + Intronic
904536256 1:31201664-31201686 CCTCATTTATAAAAAGGGGTAGG - Intronic
904611084 1:31726742-31726764 TCACATCTGTGAAATGGGGATGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904664454 1:32109059-32109081 CCACATCTGTAAAATGGCAATGG - Intronic
904763723 1:32824928-32824950 CCTCATTTACAAAATGGGAAAGG - Intronic
904819254 1:33230185-33230207 CCTCACTTGTAAACTGGGAATGG + Intergenic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904899407 1:33844700-33844722 CCTCAACTGTAAAATGGGACGGG + Intronic
904917223 1:33978912-33978934 CCTCTTCTGTAAAATAGAGATGG - Intronic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
904918366 1:33986432-33986454 CTTCAGCTGTAAAATGGGCATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905099014 1:35501976-35501998 CCTCATTTATAAAACAGGAACGG + Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905210844 1:36373148-36373170 CCTCATCTGTAAAACAGAGATGG + Intronic
905244741 1:36604771-36604793 CCTTTCTTGTAAAATGGGGGTGG + Intergenic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905346952 1:37317879-37317901 CCTCATCTGTAAAGAGGTGATGG + Intergenic
905370625 1:37480828-37480850 CCTCATCTGAAACATGGGGTCGG + Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905605400 1:39294204-39294226 CTTCGTTTGTAAAAATGGGAAGG + Intronic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
905852368 1:41283558-41283580 CCTTATCTGTAAAGTGGGGTGGG + Intergenic
905861767 1:41356882-41356904 CCTCATCTGGGAAATGGGAATGG - Intergenic
905905972 1:41618739-41618761 CCTCATCTGGAAAATGGGCCAGG - Intronic
906475026 1:46163815-46163837 CCTCAGCTGTAAAATAGAGACGG + Intronic
906591361 1:47027261-47027283 CCTGATCTGATAAATGGGGAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906738687 1:48159056-48159078 CCTTTTTGGTAAAATGGGAATGG - Intergenic
906799099 1:48720546-48720568 CCTCATTTGTGAAATGCAAATGG + Intronic
906834075 1:49064045-49064067 TCTGATTTGTAAAATGGGAATGG + Intronic
906882641 1:49608933-49608955 TCTCATTTGTAAAATGGCTGTGG - Intronic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907046435 1:51302860-51302882 TCTCATCTGTGAAATGGGGGTGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907289797 1:53406484-53406506 CCCCATGTGTAAAATGGAGATGG - Intergenic
907305110 1:53508987-53509009 CCCCCTCTGTAAAGTGGGGATGG + Intronic
907318635 1:53588879-53588901 CTTCTTCTGTAAAATGGGCATGG + Intronic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907392799 1:54169212-54169234 GCTCATCTATAAAATGGGAATGG - Intronic
907395129 1:54184419-54184441 CCTCATCTGAAAATTGGGAATGG - Intronic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907798077 1:57737457-57737479 CCTCATCTGTTAAATGGTGGTGG + Intronic
908027295 1:59966430-59966452 CCTCATCTGTAAACTGGAAATGG - Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908423570 1:63983209-63983231 CCATATCTGTAAAATGCGGAGGG - Intronic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908703674 1:66928114-66928136 CCACATTTATAAAAAGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909115574 1:71531041-71531063 TTCCATTTGTAAAATGGGGTGGG - Intronic
909363535 1:74793361-74793383 CCTCATTTGTAAATAGGAAATGG - Intergenic
909391852 1:75129136-75129158 TCTCATTTGTAAAATGAAGATGG - Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910305736 1:85761195-85761217 TCTTATTTATAAAATGGAGATGG - Intronic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910724506 1:90324366-90324388 CCTCACATATAAAATGGTGATGG - Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910749385 1:90612178-90612200 CCTCATCTGTGAAATGGGCTAGG - Intergenic
910803006 1:91164202-91164224 CCCCCTTTGTAAAATGGGGTTGG - Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911012768 1:93298979-93299001 CCTCATTTATAAAATGAAAAAGG + Intergenic
911054708 1:93699973-93699995 CCTTACCTGTAAAATGGGGTGGG - Intronic
911145897 1:94552310-94552332 TCTCAAGGGTAAAATGGGGAAGG - Intergenic
911224036 1:95284747-95284769 CCTCATAAGTAAAATGGTTATGG - Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
912324417 1:108744473-108744495 TCTCATATGTAAAATGGCAATGG + Intergenic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912466584 1:109878876-109878898 TCTCTTCTGTAAAATGGGAAGGG - Intergenic
912556555 1:110520423-110520445 CCTCAGTTGTGGAATGAGGAAGG + Intergenic
912692359 1:111813807-111813829 CCTCATCTATATAATGGGAAAGG - Intronic
912725244 1:112053485-112053507 CCTCATCTATAAAATGTGGTAGG + Intergenic
913278725 1:117164624-117164646 CCTCATTGGTAAAATAGGCAGGG - Intronic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913385714 1:118256141-118256163 CTTCATTTGTAACATGGAGTGGG + Intergenic
913451537 1:118996103-118996125 TCTCATGTGTAAAATGGGGCCGG - Intergenic
914447151 1:147759744-147759766 CTTCATTTATCGAATGGGGATGG + Intronic
914858756 1:151370153-151370175 CATCCTCTGTAAAATGGAGATGG + Intronic
915471549 1:156128732-156128754 CCTCATCTATAAAAGGGAGAGGG + Intronic
916356953 1:163921907-163921929 CCTCATTTCTTAAATGTGGGAGG - Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916418471 1:164614239-164614261 CCTCATTTGTAAAATCAGAGAGG - Intronic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
916662279 1:166933979-166934001 CCTCCATTGTGAAGTGGGGAAGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917217762 1:172695884-172695906 CTTCATTTGTAAAATAAGGTTGG - Intergenic
917231992 1:172847216-172847238 CCTCATTTGTTAAAGGGAGATGG - Intergenic
917268899 1:173251649-173251671 CCTTATATGTACAATAGGGATGG + Intergenic
917634936 1:176926191-176926213 CGTTATCTATAAAATGGGGAGGG + Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918118376 1:181516441-181516463 CTTCATCTGTAAAATGGGACTGG - Intronic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
919656961 1:200206523-200206545 ACTCATATGTATGATGGGGAAGG - Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920534239 1:206727314-206727336 CTTCCTTTGTAAAGTGGGGATGG - Intronic
920766552 1:208839178-208839200 CATCATTAGGAAGATGGGGAAGG + Intergenic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921125930 1:212178126-212178148 CCTTAGTTATAAAATGGGGACGG - Intergenic
921300178 1:213744579-213744601 CTTTATCTGTAAAATGGGGCTGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921555431 1:216592942-216592964 TCTCATTTTAAAAATGAGGAAGG + Intronic
921790929 1:219289753-219289775 CTTAATTTATAAAATGAGGATGG - Intergenic
921812434 1:219530083-219530105 TCTCACTTTTAAAATGAGGAGGG - Intergenic
922000316 1:221470894-221470916 CCTCCTTTTGAAAATGGGAATGG - Intergenic
922027734 1:221767367-221767389 CCTCATGTGAAAAATGGAAATGG - Intergenic
922350772 1:224733211-224733233 TCTCATCGGTGAAATGGGGATGG - Intronic
922628446 1:227078026-227078048 ACTTATTTGTAAGATGGAGAAGG - Intronic
923057178 1:230435752-230435774 CGACATTTGTAGAATGGAGAAGG + Intergenic
923220648 1:231889578-231889600 CCTCAACTGTAAAACTGGGAAGG - Intronic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923721907 1:236474034-236474056 CCTCATCTATAAAATGGAGGTGG - Intronic
923779848 1:237012379-237012401 TCTCATTTGTAAAACGGAAAGGG - Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062843959 10:690334-690356 CCCCATCTGTGAAAAGGGGATGG + Intergenic
1063078936 10:2746501-2746523 CCTCAATTGTAAAATGTGGGTGG - Intergenic
1063371796 10:5527019-5527041 CCTCGTTTGTAAGATGAGGAAGG - Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065263655 10:23952665-23952687 CCTAACCTGTAAAATGGGAATGG + Intronic
1065722568 10:28640973-28640995 TCTCATTTGTAAAATGCAGATGG + Intergenic
1066239566 10:33520238-33520260 CCTCATTTTAAAGATGAGGATGG + Intergenic
1067229116 10:44394764-44394786 CCTCACTGGCGAAATGGGGATGG - Intergenic
1067451467 10:46384597-46384619 CCTCATTTGTACAACGGGGGTGG - Intronic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1067756436 10:49009170-49009192 CCTCATTTGAAAAGTGGCTAGGG - Intergenic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069176659 10:65297873-65297895 CCTATTTTTTAAAAGGGGGAAGG + Intergenic
1069338560 10:67383387-67383409 CCTCAGCTGTAAGATGGGTATGG - Intronic
1069548973 10:69349284-69349306 CCTCATGGGTAAAATGGCCATGG + Intronic
1069613747 10:69792932-69792954 GGTCATTTCTGAAATGGGGAGGG - Intergenic
1069694215 10:70374930-70374952 CTTCATCTATAAAATGGGAATGG - Intronic
1069849905 10:71397737-71397759 CCCCATTTGGACAGTGGGGATGG + Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070095710 10:73336486-73336508 AATAATTTGTAAAATGAGGATGG - Intronic
1070361693 10:75696651-75696673 CCTCATCTGTAAAAGTGAGAGGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070417020 10:76200268-76200290 CCTCATTTTTAAAATATGGCAGG + Intronic
1070471245 10:76781788-76781810 CCTCACTGGTAAAATGGGCATGG + Intergenic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070684426 10:78470450-78470472 CCTCATCTGTGAAATGGGTGGGG - Intergenic
1070684691 10:78471993-78472015 CTTCATTTTTAAAATAGGGAGGG - Intergenic
1070726567 10:78795516-78795538 TATCATCTGTAAGATGGGGATGG + Intergenic
1070742217 10:78910656-78910678 CCTCCTCTGTGAGATGGGGATGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070773824 10:79098446-79098468 CCTCACCTGTAAAATGGAGGTGG + Intronic
1070794983 10:79211217-79211239 CCTTGTTTGTAAAATGGGAGTGG - Intronic
1071040074 10:81296887-81296909 CCTCATTTAAAAAATGGGAAAGG - Intergenic
1071262276 10:83931481-83931503 CCTCATTTGTAAACTGGGAGTGG - Intergenic
1071275133 10:84047253-84047275 CCTGTTCTGTAAAATGGAGATGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071693848 10:87851523-87851545 CTTCATTTGTAAAATGAGATTGG + Intergenic
1071782478 10:88861736-88861758 TCTCATCTGTTAAAAGGGGATGG - Intergenic
1071932499 10:90488253-90488275 CCTCTTATGTAAAGTGGGGAAGG - Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072202525 10:93173778-93173800 TCTCATCTATAAAATGGAGATGG + Intergenic
1072610313 10:97013627-97013649 CCTCATTTGTCCAATGGGTTTGG - Intronic
1072618965 10:97067478-97067500 TCTCCTTTGTATAATGGGGATGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072729022 10:97832316-97832338 TCTCTTTGGTAAAATGGAGAAGG + Intergenic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072772178 10:98151359-98151381 CCTCATTTGTAAAATGGAGGTGG + Intronic
1072982314 10:100109493-100109515 CCTCGCTTGTAAATTGGGGTAGG + Intergenic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073426850 10:103460146-103460168 CCATCTCTGTAAAATGGGGATGG - Intergenic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1073666841 10:105543316-105543338 CCTCATTTCTAAAATACAGATGG - Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074372991 10:112915419-112915441 CCTCATTTGTAATATGTGCAAGG + Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074662951 10:115682990-115683012 CATCTTCTGTAAAAGGGGGATGG + Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075247805 10:120839582-120839604 CTTCATTTACAAAATGGGGTTGG + Intergenic
1075275114 10:121086215-121086237 TCTCATTTGTAAAATGAAGTTGG - Intergenic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG + Intergenic
1075659051 10:124180761-124180783 CCCCATCTGTAAATTGGGGTGGG - Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1075870336 10:125768234-125768256 CCTTATTTGTAAGATGGGCGTGG - Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076516753 10:131049965-131049987 CCCCATTTGTTAGGTGGGGAAGG - Intergenic
1077240023 11:1505779-1505801 CCTTATCAGTAAAATGGGCAGGG - Intergenic
1077540077 11:3142518-3142540 CCTCATCTGTAAAAAGGGAGGGG - Intronic
1077580361 11:3413555-3413577 CCTCATCTATAAAATGGAGGTGG - Intergenic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078341307 11:10499563-10499585 GCTCAATTGTAAAATGGGGCTGG + Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078422839 11:11226281-11226303 CCTCAGCTGTAAAATGGGTTTGG + Intergenic
1078434591 11:11314016-11314038 CCTGATCAGTAAAATGGGGGCGG - Intronic
1078467881 11:11563591-11563613 CCTCACTTGTGACATGAGGATGG - Intronic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078600459 11:12725905-12725927 CCTCATTTGTAAAATCTCCATGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1078974550 11:16457538-16457560 CTTCATCTGTTAAATGGGTATGG - Intronic
1078985930 11:16597417-16597439 TCTAATTTTAAAAATGGGGATGG - Intronic
1079016026 11:16869445-16869467 CTTCATCTCTAAAATGGTGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079243160 11:18735005-18735027 CCTTATCTGTAATCTGGGGATGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079576589 11:22011108-22011130 CCTCATTTATAAAATGAGAATGG + Intergenic
1079637452 11:22761750-22761772 CCCCATCTGTAAAATGGAAATGG - Intronic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080088980 11:28321126-28321148 TCTCAGTTGTAAAATGGAGTAGG - Intronic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080434278 11:32225448-32225470 CCTCATCTGTAACATGGAAATGG - Intergenic
1080685084 11:34508749-34508771 CCTCAACTGTAAAATGGTGGAGG - Intronic
1080692353 11:34568810-34568832 CCTCCCCTGTAAAATGGGCAGGG + Intergenic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1080911225 11:36601083-36601105 CTCCATTTATAAAATGGGGATGG - Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081361833 11:42189739-42189761 CCTCAGTTGGAAAATGTGGTAGG + Intergenic
1081416070 11:42817782-42817804 CTTAATTTTTAAAATGGGGGTGG - Intergenic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081660806 11:44887249-44887271 CCACATCTGTAAGATGGGGGTGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081679657 11:44992709-44992731 TCTCATCTGTAAAATAGGGTTGG + Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1081910140 11:46695213-46695235 CCTCTTTCCAAAAATGGGGAGGG - Intronic
1081960643 11:47134110-47134132 CCTCATCTGTGAAATGGGACTGG + Intronic
1081994223 11:47353123-47353145 CCTCATCTGTAAAGCGGGGTGGG + Intergenic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082205080 11:49423449-49423471 GCTCATTTATAGAAAGGGGATGG + Intergenic
1082740671 11:56907631-56907653 CCTCATCTGTAAAATGGATGAGG - Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083622857 11:64057536-64057558 TCTCATCTGTAAAATGGGCGTGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1084237287 11:67796383-67796405 CCTCATCTATAAAATGGAGGTGG - Intergenic
1084551278 11:69843633-69843655 CCCCATTTTAAAAATGAGGAGGG + Intergenic
1084966642 11:72748078-72748100 CCTCATGTGGAAAATGGGAATGG + Intronic
1085034595 11:73292498-73292520 TCTCAGTTGTCAAATGGGTAGGG - Intronic
1085303251 11:75471135-75471157 CCTCATTTGGAACTTGGTGAAGG - Intronic
1085382092 11:76129097-76129119 CCTCATTTCTAAGATGGGAGAGG - Intronic
1085391811 11:76185966-76185988 CCCCATTTGTAAAATGGGAGTGG - Intergenic
1085395444 11:76204930-76204952 CCTTATCTGTAAAATGGTGGCGG + Intronic
1085425878 11:76404251-76404273 TCTTATTTATAAAATGGAGATGG - Exonic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085569431 11:77546461-77546483 CCTCCTTTGTAAAGTGGAGATGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085640160 11:78188441-78188463 TCCCATCTGTGAAATGGGGATGG - Intronic
1085740056 11:79070720-79070742 TCTCATCTGTCAGATGGGGATGG - Intronic
1085798818 11:79568283-79568305 CCTAATCTGAAAAATGGAGATGG + Intergenic
1085868599 11:80324222-80324244 CCTCTTTTGTAAACTGGGATTGG - Intergenic
1085876924 11:80418754-80418776 CCTTGTCTGTAAAATGGGAAGGG + Intergenic
1085911680 11:80834365-80834387 CTTCATTTCACAAATGGGGAAGG + Intergenic
1085947367 11:81287525-81287547 CCTCATTTGGAAAATGAGATTGG + Intergenic
1086044983 11:82522156-82522178 CCACATATGTAAAATGTAGATGG - Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086116045 11:83251472-83251494 CTTCATTTATAAAATGAAGATGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086325706 11:85696669-85696691 CTTCATCTATAAAATGGGAATGG + Intronic
1086338306 11:85822104-85822126 CCTCACTTGTAAAATGGGAGTGG - Intergenic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1087151746 11:94866277-94866299 ACTCATCTGTGAAGTGGGGAGGG + Intronic
1087624022 11:100575005-100575027 TCTAATTTATAAAATGGGGATGG - Intergenic
1087785689 11:102351844-102351866 CGTTGTTTGTAAAATGAGGAGGG + Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088063834 11:105690964-105690986 CCTCATCTTTAAAATAGGAAGGG + Intronic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088551397 11:111016634-111016656 ACTCAATTGAAAAATGAGGAAGG + Intergenic
1088782950 11:113153881-113153903 TCTCATTTATTAAATGGGGATGG + Intronic
1088890319 11:114038882-114038904 TCTCATCTGTAAAATGGAGCTGG - Intergenic
1088982915 11:114879937-114879959 CCTCATCTATAAAATGGGACTGG + Intergenic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089042780 11:115469373-115469395 TTCCATTTATAAAATGGGGAAGG - Intronic
1089188758 11:116638861-116638883 CCTCCTTTGTATCAAGGGGATGG - Intergenic
1089192464 11:116662948-116662970 CCTGATGAGTAAGATGGGGATGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089343396 11:117774854-117774876 CCTCTTCTGTAAAGTGGAGAGGG + Intronic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089574908 11:119435197-119435219 CCTGGTTTGTGAAAGGGGGATGG - Intergenic
1089601106 11:119615857-119615879 CCTCCTTGGTAAAATGAGTAAGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090163261 11:124517806-124517828 CCTCATGTGTCGAATGGTGATGG - Intergenic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1090429795 11:126636143-126636165 CTTCATTTGTAAAAATGGGAAGG + Intronic
1090588014 11:128235126-128235148 CCTCATGTGGAAAGTAGGGATGG - Intergenic
1090621689 11:128566415-128566437 CTTCATCTGTAAAATAGGCATGG - Intronic
1090860803 11:130650770-130650792 CCTCATTGGTAAAATGGTGGTGG - Intergenic
1090983501 11:131745336-131745358 CCTCATCTTTTAACTGGGGAGGG + Intronic
1091003832 11:131933947-131933969 CCTCATTTTTAAAATTGGGATGG - Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091390589 12:123850-123872 CCTCATTTATAAAAATGGGGAGG + Intronic
1091578120 12:1758440-1758462 CCTCACTGGTAAATTGAGGAAGG - Intronic
1091585351 12:1812849-1812871 CCTCATCTGTGAAACGGGAACGG + Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091782648 12:3223667-3223689 CCTCACCTATAAAATGGGAAGGG + Intronic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092407954 12:8233976-8233998 CCTCATCTATAAAATGGAGGTGG - Intergenic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1092980350 12:13788524-13788546 CCTCATTTTTAAAACGAGGTTGG - Intronic
1092984594 12:13833731-13833753 CTGCATCTGTAAAATGGGGTAGG - Intronic
1093788648 12:23221130-23221152 CCTTATTTATAAGATGGGAAGGG - Intergenic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094267032 12:28571132-28571154 CCTCCTGGGTAAGATGGGGAGGG + Intronic
1094806114 12:34094360-34094382 CCTCATATGTACAATAGTGAAGG - Intergenic
1095481358 12:42639278-42639300 CCCTATTTGTAAAATGAGGAGGG - Intergenic
1095656509 12:44675735-44675757 CATCCTATGTAAAATGGGAAAGG + Intronic
1096008657 12:48193951-48193973 CTTCAATTTTAAAATGGGAATGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097167229 12:57092354-57092376 CCTCATTTGTCCAATGGTGAAGG + Intronic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098491107 12:71079927-71079949 CTTCATTTGTAAAATAGAGATGG + Intronic
1098599688 12:72316298-72316320 GCTCATTTTTAAAATGAGAAGGG - Intronic
1098604776 12:72376911-72376933 CCTTATCTGTAAAATGGGATTGG + Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1099273671 12:80547874-80547896 CTTCATCTGTAACATGGGAATGG - Intronic
1099837578 12:87926745-87926767 TCTCAATTATAAAATGAGGATGG - Intergenic
1100081233 12:90854187-90854209 CCTTATTTGGTAAATGGTGATGG - Intergenic
1100215559 12:92444643-92444665 CCTCATTTGTAAAGCAGAGATGG - Intergenic
1100299685 12:93295592-93295614 TATCACTGGTAAAATGGGGAGGG + Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100367683 12:93936630-93936652 TCTCATCTGTAAGATGGAGATGG - Intergenic
1100394557 12:94173562-94173584 TTTCATTTATAAAGTGGGGATGG - Intronic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100882031 12:99029875-99029897 CCTCTGCTGTAAAATGGGAATGG + Intronic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101034179 12:100688636-100688658 CATCCTTTGTAAAGTGCGGATGG + Intergenic
1101067283 12:101035566-101035588 CCTCATCCATAAAATGGGAAGGG - Intronic
1101169766 12:102078632-102078654 TCTCATTTCTAAAATGGAGATGG + Intronic
1101223451 12:102664424-102664446 CCTCATTTGTTAATTGCCGAGGG + Intergenic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101415863 12:104507507-104507529 CCCCATTTGTAAAATGGTAATGG + Intronic
1101422754 12:104562958-104562980 CCCCATCTGTGAAATGGGTATGG + Intronic
1101438491 12:104684433-104684455 TATCATCTGTAAAAAGGGGATGG + Intronic
1101659724 12:106754887-106754909 CTCCATCTGTAAAATGGGGTGGG + Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1101841579 12:108331249-108331271 TCCCATCTGTGAAATGGGGATGG - Intronic
1101842354 12:108337355-108337377 CACCATCTGTAAAATGGGGTGGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101912261 12:108869058-108869080 CCTCCTAAGTAAAATGGGAAGGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102199294 12:111046415-111046437 GTTCATCTGTAAAATGGGAATGG - Intronic
1102423233 12:112820654-112820676 CCTCATTGATAAAATGAGTATGG - Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102560225 12:113756789-113756811 TCCCATCTGTAAAATGGGGCTGG - Intergenic
1102714606 12:114959445-114959467 CTTCATTTATAAAATGGGGGAGG - Intergenic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1102774564 12:115507326-115507348 CCTCATCTGTAAAATAGGATAGG - Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1102912558 12:116728734-116728756 CTTCCTCTGTAAAATGGAGATGG - Intronic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103079358 12:118011089-118011111 TCACATCTGTAAAATGGGCAGGG - Intergenic
1103140535 12:118544280-118544302 TCTCATCTGTAATATGGGGCTGG - Intergenic
1103159029 12:118712169-118712191 CCTCACCTGTAAAATAGAGATGG + Intergenic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104497948 12:129258180-129258202 CCTCATTTGTAAAGCTGGGCTGG + Intronic
1104652034 12:130542069-130542091 CCTTATTGGGAAAATGTGGATGG + Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1105545150 13:21345810-21345832 TCTTATTTGTAAGCTGGGGATGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1105670573 13:22610432-22610454 CTTGATTTCTGAAATGGGGATGG - Intergenic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106074426 13:26445450-26445472 CCTCATTTATAAAATGGAGATGG + Intergenic
1106192934 13:27469772-27469794 CTTTATTTGTAAAATGGTAATGG + Intergenic
1106206497 13:27601169-27601191 CCTCATCTATAAAATGGTAATGG - Intronic
1106327922 13:28711902-28711924 TCTCATCTGTAAAATGGGCGTGG - Intronic
1106415891 13:29545453-29545475 CTACGTGTGTAAAATGGGGATGG + Intronic
1107267719 13:38577338-38577360 TCTCCTTTGTAAAATAGGAAGGG + Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107422667 13:40263379-40263401 CCTCATTTGAAAAATGGAAATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107902070 13:45026902-45026924 CCTCCTTTGTTAAATGAGAAAGG + Intronic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108611731 13:52090466-52090488 CCTCAGCTGTAAAGTGGGCATGG + Intronic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1110105027 13:71662463-71662485 ACTCATCTGTAAAATGGAAATGG + Intronic
1110229928 13:73157442-73157464 CCTCATTTGTGAAATGAGACGGG - Intergenic
1110434604 13:75465098-75465120 CCTCATTTATAATATGGGGATGG - Intronic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1110771446 13:79352715-79352737 ACTCATCGGTAAAATGGTGATGG - Intronic
1111323927 13:86666475-86666497 CCTCACTTCTAAAATAAGGATGG - Intergenic
1111587067 13:90294389-90294411 TCTCATTTGTAAACTGATGAGGG - Intergenic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112124530 13:96449851-96449873 CATCATTTTTATAATGGAGAAGG - Intronic
1112262757 13:97892419-97892441 TCTCATCTGTAAAATGGATATGG - Intergenic
1112579952 13:100669909-100669931 CCTCAACACTAAAATGGGGATGG + Intronic
1112740790 13:102471117-102471139 CCTCTTTTCAAAAATGGGCAGGG + Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113556278 13:111238315-111238337 TCTCATTTGTAAAATGAGATTGG + Intronic
1113963829 13:114140508-114140530 CTTCGTCTGTAAAATGGGGCTGG + Intergenic
1114068864 14:19092522-19092544 CCTTATTTCTAAAATAGGGAAGG - Intergenic
1114093397 14:19307483-19307505 CCTTATTTCTAAAATAGGGAAGG + Intergenic
1114262668 14:21049606-21049628 GCTCATTTGCAACATGAGGAAGG - Intronic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115443381 14:33461871-33461893 CATCACTTGTGAAATGGGAATGG + Intronic
1115497757 14:34023875-34023897 CCTCATCTGTGAAATAGGGTAGG - Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1115652787 14:35415129-35415151 CATCCTTTGTAAAATGGGAATGG - Intergenic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116541536 14:46107726-46107748 CCTCATTTTCAAGCTGGGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116835630 14:49767388-49767410 CCTCACCTGTAAAATAGGGTGGG - Intergenic
1116913371 14:50495240-50495262 CCTGATTTTAAAAATGGGAAAGG + Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1117878297 14:60279737-60279759 CTTCATTAGTAAATAGGGGAAGG - Intronic
1117947876 14:61049467-61049489 CTACATCTTTAAAATGGGGATGG - Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118314148 14:64715514-64715536 CCTGACCTGTAAAATAGGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118743703 14:68759068-68759090 CTTCATGTGTAAAATGCAGAGGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119684524 14:76620792-76620814 CCCCATCTTTGAAATGGGGAGGG + Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1119895321 14:78214976-78214998 CTTCGTCTGTAAAATGGGGGTGG + Intergenic
1119896976 14:78228629-78228651 TCTCATTTGTAAAATGCGAGAGG - Intergenic
1119930994 14:78546834-78546856 CCTCAAGTGTAAAATGGATATGG - Intronic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1120095526 14:80383759-80383781 CCTCATCTGTAACCTGGTGATGG - Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120319349 14:82939712-82939734 TCTCATCACTAAAATGGGGATGG + Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1120841602 14:89090326-89090348 GCTCATCTGTAAAATGGAGTTGG - Intergenic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120943649 14:89973621-89973643 CCACATTTGCAAAATGGGAGAGG - Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121126823 14:91413329-91413351 CCTGATCTGTAATAAGGGGATGG - Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121259685 14:92557242-92557264 CCTCATCTATACAATGGGCAAGG - Intronic
1121265146 14:92597046-92597068 CCTCATCTAGAAAATGCGGATGG + Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121450466 14:94004051-94004073 TCTCATTTGTAAAATGAGTGTGG - Intergenic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121562671 14:94886592-94886614 CCTCATCTGTGAAATGGAGGTGG + Intergenic
1121587983 14:95076993-95077015 CCTCATCTATAAAATGGAGTTGG - Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121904246 14:97725016-97725038 CCCTATTTATAAAATGTGGATGG + Intergenic
1121914253 14:97821421-97821443 CCTCCTTTGACATATGGGGAGGG - Intergenic
1121916198 14:97838649-97838671 TTTCATTTGTAAAATGATGAAGG + Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1121984666 14:98493138-98493160 CCTCATCTGTAAAGCAGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122104969 14:99446144-99446166 CCTCACTTATAAAATGGGGACGG + Intronic
1122146395 14:99691397-99691419 CCTCATCTGTAAACTGGGTGGGG + Intronic
1122151930 14:99730330-99730352 CCCCATCTGTGAAATGGGGGTGG - Intergenic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1122313845 14:100814081-100814103 CCTCATCTGTAAAGCGGGCATGG + Intergenic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1124123746 15:26915857-26915879 CCTCATTTGTAAAATAGATGAGG + Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124547851 15:30648528-30648550 CCTCATCTGTAAAATTTCGATGG + Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125106374 15:35976586-35976608 ATTCTTTTATAAAATGGGGAGGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126002114 15:44220503-44220525 CTTCATTAGTAAAATGTGGGAGG + Intergenic
1126414890 15:48407150-48407172 CTTCATTTATGAAATGGGGATGG + Intergenic
1126567155 15:50112675-50112697 CCACATCTGTAAAGTGGAGATGG + Intronic
1126734715 15:51719145-51719167 CCTGTTTGGTCAAATGGGGATGG + Intronic
1126778609 15:52119660-52119682 CCCCATTTGTAACATGGGATGGG - Exonic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127638546 15:60893828-60893850 CCTCATTTATAAAATAGAGGAGG - Intronic
1127675427 15:61233550-61233572 CCTCACCTATAAAATGGGCATGG - Intergenic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1127988344 15:64092999-64093021 CCTCATTTGTACAATAAAGATGG + Intronic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128346007 15:66852779-66852801 CCCCTTCTGTGAAATGGGGACGG - Intergenic
1128364347 15:66986797-66986819 CCTCATCTGTAAAATAGTGTTGG - Intergenic
1128429574 15:67578095-67578117 ACTCATTTGTAAAATCAAGACGG - Intronic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128691966 15:69731455-69731477 CATCAACTGTAAATTGGGGAGGG + Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128732669 15:70031655-70031677 CCTCTTCTGTAAAATGGAGCTGG + Intergenic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128787419 15:70408247-70408269 CCTCATTAATAAAATGCAGATGG + Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128904695 15:71456522-71456544 TCCCATCTGTGAAATGGGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129356170 15:74993594-74993616 CCACATATGTAAAATAAGGATGG - Intronic
1129847592 15:78775077-78775099 CCTCATGTATAAAGTGGGGTTGG + Intronic
1129937701 15:79464441-79464463 CCTCATTTGTAAACTGAAGATGG - Intronic
1129961200 15:79686729-79686751 TCTCATTTGTAAAATGGTGCTGG - Intergenic
1130097520 15:80867078-80867100 GCAAATCTGTAAAATGGGGAGGG + Intronic
1130126693 15:81099724-81099746 CCTCATCTATAAAAAAGGGATGG - Intronic
1130151748 15:81316518-81316540 CCTCATTTTTAAAATAAGAATGG - Intronic
1130254311 15:82318832-82318854 CCTCATGTATAAAGTGGGGTTGG - Intergenic
1130393475 15:83480405-83480427 TCTCATCTGTGAAATTGGGATGG - Intronic
1130430933 15:83846293-83846315 CTCCATTTGTTAAATGGGGAGGG - Intronic
1130539787 15:84814072-84814094 TCTCCTTTGTAAAATGGAGTGGG - Intergenic
1130600654 15:85271138-85271160 CCTCATGTATAAAGTGGGGTTGG + Intergenic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130954008 15:88614104-88614126 CAGCATTTTTAAAGTGGGGAGGG - Intergenic
1130960554 15:88656026-88656048 TCCTATTTGTAAAATGAGGAAGG + Exonic
1131235418 15:90692700-90692722 CCTCATAGGTCAAATGGGAAAGG - Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131533780 15:93216695-93216717 CTTCATTTGTAAAGTGAAGATGG + Intergenic
1131677273 15:94683318-94683340 CCTCCTCTGTAAAAAGGGGGTGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132244051 15:100280743-100280765 TCCGATTTGTCAAATGGGGATGG - Intronic
1132653087 16:1030431-1030453 CCGCATCTGTAAAGTGGGGGTGG + Intergenic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133298932 16:4769840-4769862 ACTCCTTTGTACAATGGGGATGG + Intergenic
1133348901 16:5088806-5088828 CCTCATCTATAAAATGGAGGTGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133598743 16:7318526-7318548 TCTCATCTGTGAGATGGGGATGG + Intronic
1133683234 16:8140644-8140666 TCTCATCTGTCAAATGGGTAGGG + Intergenic
1133703408 16:8330855-8330877 CCTAATTTATAAAGTGGGAATGG - Intergenic
1133826978 16:9286869-9286891 CCTCAGCTGTAAAATGGAAATGG - Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134106790 16:11491417-11491439 CCTCATCTGTAAAATAGGATGGG - Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134557961 16:15182476-15182498 TCCCATTTGTAAAATCAGGAAGG - Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134918497 16:18094079-18094101 TCCCATTTGTAAAATCAGGAAGG - Intergenic
1135155538 16:20049769-20049791 CTTTATCTGTAAAGTGGGGATGG + Intronic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135381643 16:22000935-22000957 CCTCCTCTGTAAAATGGCAACGG - Intronic
1135421008 16:22305527-22305549 CCTCACTTGCAAAGTGGTGATGG + Intronic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1135659841 16:24286711-24286733 CCACTTTTGTAAAATAAGGATGG - Intronic
1135856996 16:26020925-26020947 CCATATATGTAAAATGGGGATGG + Intronic
1136061771 16:27731504-27731526 CCCCATCTGTAAAATGGAGCTGG - Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136099156 16:27980567-27980589 CTTCATCTGTAAAATGGGTGTGG - Intronic
1136180138 16:28546132-28546154 CCTCTTCTGTTAAATGGGGTCGG - Intergenic
1136237369 16:28923002-28923024 CTTCCTCTGTAAAATGGAGATGG + Intronic
1136318458 16:29467233-29467255 CCACATCTCTAAGATGGGGATGG + Exonic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136433033 16:30206582-30206604 CCACATCTCTAAGATGGGGATGG + Exonic
1136454950 16:30375148-30375170 TCTCATTTGTAAAATGGGATGGG - Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136624834 16:31456000-31456022 CTTCATCTGTAAAACAGGGATGG - Intergenic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136863164 16:33714656-33714678 CTACATTTGGAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137430635 16:48415528-48415550 CCTCATCTATAAAATGGGCTGGG + Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137584579 16:49656855-49656877 TCTCATCTATAAAATGGGGCTGG - Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137699314 16:50484912-50484934 CCCTGTCTGTAAAATGGGGAGGG - Intergenic
1137706326 16:50538378-50538400 CCTCATCTGTGAAGTGGAGATGG + Intergenic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138305050 16:55966740-55966762 CCCCATCTATAAAGTGGGGAGGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138922105 16:61543765-61543787 CCATATCTGTAAAATGGGCATGG + Intergenic
1138946447 16:61856738-61856760 GCACATCTGTAAAATGGGTATGG - Intronic
1139166587 16:64573176-64573198 CCTCAGATTTGAAATGGGGATGG - Intergenic
1139349508 16:66326410-66326432 CCTAATCTGTAACATGGTGATGG - Intergenic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139416134 16:66812279-66812301 CTTCATGTGTAAAATGGGGCCGG + Intronic
1139645012 16:68322683-68322705 CCTCAATTGTAAACCAGGGATGG - Intronic
1139658250 16:68402258-68402280 TCTCCTCTATAAAATGGGGAAGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140324966 16:73992657-73992679 CCCAATTTTTAAAATGGGCAGGG + Intergenic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141201808 16:81904021-81904043 CCACATCTGTAAAGTGGGCAAGG - Intronic
1141292542 16:82733589-82733611 TCTCATTTGTAAGATGAAGATGG - Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1141713756 16:85715364-85715386 CCACATTTGTAAGATGGGGCTGG - Intronic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142117479 16:88367310-88367332 CCTCATCTGTAAAGTGGGCTTGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142401819 16:89862899-89862921 TCTCTTCTGTAAAATGGGGCTGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1203124656 16_KI270728v1_random:1562809-1562831 CTACATTTGGAAAATGGGGATGG - Intergenic
1142601278 17:1054127-1054149 CCTCGTGTGTAAAACAGGGATGG + Intronic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143065424 17:4243543-4243565 CCTCCTCTATAAAATGGGGCTGG - Intronic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143971704 17:10800690-10800712 CCAAATATGTAAAATGGAGATGG - Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144138774 17:12324758-12324780 CCTGATTTGCAAAAAGGTGAGGG + Intergenic
1144162372 17:12572375-12572397 CCTCATCTGTGAGATGGGGCTGG - Intergenic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144599373 17:16599123-16599145 CCTCTTTAGAAAACTGGGGAGGG - Intergenic
1144602864 17:16633906-16633928 TCTCATTTGGAGAATGGGAAAGG - Exonic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764913 17:17727413-17727435 CCCCATCTGTGAAATGGGCAGGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144995355 17:19264516-19264538 CCTCATTTGTAAAATGGAAATGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868166 17:28253829-28253851 CCTCATCTGTGAAATGGAGCTGG + Intergenic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145898483 17:28474548-28474570 TCCCATTTGACAAATGGGGAAGG + Intronic
1145973421 17:28970285-28970307 TCTCATCTGTAAAGTAGGGATGG + Intronic
1146066388 17:29639180-29639202 CCTCTTTCATAAAATGGTGATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146270996 17:31485783-31485805 CTTCATCTGTAAGATGGGAATGG - Intronic
1146350363 17:32087043-32087065 CCTCATTTATAAAATGAAGATGG + Intergenic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146579708 17:34025982-34026004 TCTCATCTGTGAAATGGGTATGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1146626990 17:34442480-34442502 CCTCCTCAGTGAAATGGGGATGG - Intergenic
1146637649 17:34518189-34518211 CTGCATCTGTTAAATGGGGATGG + Intergenic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147021349 17:37536406-37536428 CCTCATCTGTGAAGTTGGGATGG + Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147043591 17:37736434-37736456 CTTCATCTGTAAAATGGAGGTGG - Intronic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147171128 17:38619575-38619597 CTTCATCTGTAAAATGGGCCTGG + Intergenic
1147441105 17:40447730-40447752 CCTAATTTTTAAAGTGGGGAGGG + Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147923940 17:43935375-43935397 CCTCATCTGTGAAATGGAGCTGG - Intergenic
1147995713 17:44359431-44359453 GCTCATTTGTAAGACGTGGAAGG - Intronic
1148138764 17:45313068-45313090 CCTCATTTGGAGTATGGTGAGGG + Intronic
1148335378 17:46837525-46837547 CCTTATTTGTAAAACGAGGGTGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148383059 17:47214053-47214075 TATCACTTGTAAAATGGGGGAGG - Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148804767 17:50258655-50258677 CCTCACCTGTAAAATGGGATGGG - Intergenic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1148964692 17:51425086-51425108 TCTCATTGGTAAAATGTAGATGG + Intergenic
1148988610 17:51646217-51646239 TCCCATCTGTAAACTGGGGATGG + Intronic
1149081314 17:52660991-52661013 TCTCATTTGGATATTGGGGATGG + Intergenic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1149865195 17:60147717-60147739 CCTCATCTATAAACTGGAGATGG - Intergenic
1149990009 17:61377814-61377836 CCTCCTTTGTAAACTGGAGAGGG - Intronic
1150035989 17:61798314-61798336 CATCATTTGGAAAATAGTGAGGG + Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151221266 17:72614905-72614927 GCTGATTTTTAACATGGGGATGG - Intergenic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151701082 17:75742891-75742913 CTCCATCTGTAAAATGGGTAAGG + Intronic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1151999409 17:77636194-77636216 CCTCTTCTGTAAAACGGGGGTGG - Intergenic
1152169863 17:78738272-78738294 CCTCATCTGTGATCTGGGGATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152996814 18:415213-415235 CCTTATCTGTAAAATGGAAACGG - Intronic
1153050650 18:900485-900507 ACTGATTTGCAATATGGGGATGG + Intergenic
1153097412 18:1423322-1423344 CCTTCTCTGTAAAATGGAGATGG + Intergenic
1153256767 18:3179508-3179530 CCTCAGATGTGAAATGGAGAGGG + Intronic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154045876 18:10904389-10904411 ACTCATTTGTAAGATGGAAAAGG + Intronic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1155038625 18:22046090-22046112 CCCCATTTATATAATAGGGATGG + Intergenic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155313074 18:24543979-24544001 CCTCATCTATAAAATGGAGCAGG - Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155579489 18:27287013-27287035 CCTCATTTATAAAATGAGAATGG - Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156348587 18:36283136-36283158 CCTCATTTCTAAAATGGAGATGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157084057 18:44559523-44559545 CCTCATTTGTGAAATGAGATCGG - Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157286266 18:46379449-46379471 CCTCATCTGTAAAATGGACTCGG - Intronic
1157346308 18:46838328-46838350 CCTTATTTATAACATGGGGATGG - Intronic
1157396701 18:47347496-47347518 CCTCATCTTTATAATGGGAAGGG - Intergenic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1157583939 18:48789324-48789346 CCTCACTGGTAAGATGAGGATGG + Intronic
1157796766 18:50582043-50582065 TCTCATATGTAAAGTGGAGAGGG + Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158451384 18:57568970-57568992 CCTCAGCTAGAAAATGGGGATGG - Intronic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159052042 18:63429418-63429440 CTGCATCTGTAAAATGGGGGTGG + Intergenic
1159068895 18:63600482-63600504 CCTAATTTTAAAAATGGGCAAGG - Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159448398 18:68568306-68568328 CCTCATTAAAAAAATGTGGATGG - Intergenic
1159994608 18:74952083-74952105 CCTCATTAGTAATAAGGGGCAGG - Intronic
1160120074 18:76122228-76122250 CCTCATTTCTAAGATAGAGAAGG + Intergenic
1161067087 19:2243983-2244005 CCTCATCTGGAAGACGGGGACGG - Intronic
1161084392 19:2327928-2327950 CCTCATTTGTCAAATGGGGCTGG - Intronic
1161394090 19:4035485-4035507 CTGCATTTGTAAAATGGGGCTGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162107416 19:8378429-8378451 CTGCATTTGGAAAATGGGGATGG + Intronic
1162198823 19:9006731-9006753 TCTCATCTATAAAACGGGGATGG + Intergenic
1162328888 19:10014835-10014857 CCTCATTTCTAAAATAGGGCAGG - Intronic
1162416774 19:10543462-10543484 CCTCATGTGCAAAATAGGGCTGG - Intergenic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1164690316 19:30206097-30206119 CCTTCTCTATAAAATGGGGATGG - Intergenic
1165313933 19:35043507-35043529 TCTCATCTGTGAAATGGAGAGGG + Intronic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1165729686 19:38137031-38137053 CCTAATCTGTAATATGGGGCTGG - Intronic
1165925450 19:39323348-39323370 CCTTATCCATAAAATGGGGATGG - Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166108454 19:40609128-40609150 TCTCATTGGTAAAATGGGGATGG + Intronic
1166156953 19:40920906-40920928 CTCCATCTATAAAATGGGGATGG + Intergenic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166166020 19:40989380-40989402 CTCCATCTATAAAATGGGGATGG + Intergenic
1166254921 19:41596782-41596804 CCACATCTGTAAAGTGGGGCAGG + Intronic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1166730055 19:45054087-45054109 CCTCATTTGGAAAATGACAATGG - Intronic
1166785138 19:45363074-45363096 CCTCCTTTGTAAAATGGCCAAGG - Intronic
1166797924 19:45439345-45439367 CCTCATTTATAAAATGGGTGTGG + Intronic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167095347 19:47372502-47372524 CCCCATTTGTAGATTGGAGATGG - Intronic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167508277 19:49882482-49882504 CCTCTTTGGTAAAACGGGGATGG + Intronic
1167573507 19:50305577-50305599 CCTCATTTGTATAATGGAGCAGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1167659828 19:50790176-50790198 CCCCATCGGTACAATGGGGATGG + Intergenic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
1168243390 19:55098242-55098264 CCTTATCTGTCAAATGGGAATGG - Intronic
1168397390 19:56060248-56060270 CCCCATCTGTGAAATGGGGGCGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
925189861 2:1874289-1874311 CCCCATCTGTGAAATGGGCACGG + Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926363540 2:12112627-12112649 TCGCATTTGTAAAGTGGGGATGG + Intergenic
926404120 2:12532536-12532558 TCTCATTTGCAAAAAGGGAATGG + Intergenic
926415018 2:12641306-12641328 TGTCATTTGTAAAATAGAGATGG - Intergenic
926549674 2:14286717-14286739 CTGTATTTGGAAAATGGGGATGG - Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927274646 2:21252296-21252318 CCACATTTTTAGGATGGGGAGGG - Intergenic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
927687006 2:25178048-25178070 CCTCATTTGAACAATGGGGGCGG + Intergenic
927879533 2:26680931-26680953 CCTCCTTGGAAAAATGGGGGTGG + Intergenic
927890622 2:26745855-26745877 CATCATTTGTAAAAGCTGGATGG + Intergenic
928092223 2:28381902-28381924 CCACATTTGTATAATGGTGGGGG + Intergenic
928200399 2:29244279-29244301 CCTCATTTGTGAAATCAGGATGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928649379 2:33388469-33388491 CCTCACTGGTAAAATGGAGATGG + Intronic
928824473 2:35403130-35403152 CCTCATTTGAAAACGGGTGAGGG + Intergenic
929018278 2:37524192-37524214 CCTCATTTTTCAAATGGAGGAGG + Intergenic
929024821 2:37589961-37589983 CCTCATTTTTAAAATGAGAACGG - Intergenic
929273551 2:40000545-40000567 CCTCATCTGTAAAGCAGGGATGG - Intergenic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929404320 2:41624516-41624538 TCTCATTTGTAAAGTGGCAATGG - Intergenic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
929697018 2:44126366-44126388 CCTCATTCATAAAATGAGGATGG - Intergenic
929837122 2:45413314-45413336 CCACATTTATGAAAAGGGGAAGG + Intronic
929954104 2:46442484-46442506 GCTCATGTGTAAACTGGGGATGG + Intronic
930875804 2:56214236-56214258 TCTCATTTGTAAGAAGAGGATGG + Intronic
930953785 2:57178254-57178276 GCACATTTTTAAAAGGGGGAAGG - Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931218496 2:60267696-60267718 GCGCATCTGTAAAATGGGAATGG + Intergenic
931369092 2:61645496-61645518 GCTCAATTTTAAAATGGGGCTGG + Intergenic
931460027 2:62442558-62442580 CCTCACTTGTAGGATGGAGAAGG + Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
931884483 2:66601091-66601113 CCTCATCTTTAAAATGGTGCTGG - Intergenic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932123667 2:69124394-69124416 CCTCTTTTGTAAAATGTCGGGGG - Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932449427 2:71800133-71800155 CTTCATTCACAAAATGGGGATGG - Intergenic
932516687 2:72358332-72358354 CCTCATTTATAAAATGAGAAAGG - Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932909992 2:75796191-75796213 TCTCATCTGTAAAATAGGAATGG - Intergenic
932910110 2:75797393-75797415 CCTCATCTGAAAAACGGAGATGG + Intergenic
933267164 2:80193485-80193507 CTGCATCTGTAAAATGGAGAAGG - Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933411263 2:81928199-81928221 CCTCATTTGTAAAATATGAAAGG - Intergenic
933806135 2:85999026-85999048 CCTCTTCTTTAACATGGGGAAGG + Intergenic
933851171 2:86367850-86367872 CCTCACCTGTAAAACAGGGATGG + Intergenic
934687602 2:96333298-96333320 CCCCGTCTATAAAATGGGGAAGG - Intergenic
934896655 2:98125477-98125499 CTTCATCTGTAAACTGGGCATGG + Intronic
934922936 2:98360182-98360204 CTTCATTTGTAAGAGAGGGAGGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
937969229 2:127536562-127536584 CGTCCTCTGTGAAATGGGGATGG - Intronic
937990982 2:127662197-127662219 CCTCGTTTATAAAATGGGCCAGG + Intronic
938246050 2:129778830-129778852 CCTCATCTGTAAAGTGGGTCTGG - Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938770613 2:134498106-134498128 CCTCTTAGGTAAAATGGAGATGG - Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
939583517 2:143979628-143979650 TCTCGTTTATAAAATGAGGAAGG - Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
939955412 2:148523810-148523832 CCTCCTATGGAAAATGGGGTGGG - Intergenic
940144842 2:150534800-150534822 TCTCATCTATAAAATGGGTAGGG - Intronic
940734459 2:157433663-157433685 GCACATTTGTAAAATGGGTGAGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941049853 2:160720678-160720700 CCCCACCTGTAAAATGGAGATGG + Intergenic
941172230 2:162153258-162153280 CCTTATTTGTAAAATGAGAGGGG + Intergenic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941577739 2:167255602-167255624 AATAATTTATAAAATGGGGAGGG - Intronic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
941754793 2:169173562-169173584 CCTCATCTGTAAAATGGAATTGG + Intronic
942053782 2:172164000-172164022 TCTCATTTGGGAAATGGGAAGGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942368891 2:175259336-175259358 CCTTACCTGTAAAATGGGAATGG - Intergenic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
943600521 2:189914794-189914816 TCTCATCTATAAAATGGGGCAGG - Intronic
943936544 2:193924133-193924155 CCACATTTGACAAATGGTGATGG + Intergenic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
944134501 2:196383953-196383975 ACTCATCTGTAAAATGGCAATGG + Intronic
944514394 2:200497201-200497223 CCTCATCTATAAAATAGGAATGG + Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944621236 2:201517737-201517759 CCTCACTTGTAAAATGGAAATGG - Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944635945 2:201676255-201676277 CCTCATTTCTAAAGTGAGGAAGG - Intronic
944798226 2:203209372-203209394 CCTCATCTATAATGTGGGGAGGG - Intronic
944824120 2:203463658-203463680 CTTTATTTTTAAAATGGAGAGGG + Intronic
944865762 2:203859980-203860002 CTTCTTTTGTAAAATGGAAATGG + Intergenic
944956629 2:204819759-204819781 CCTCATTGGTGATATGGAGAAGG + Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
945027925 2:205637075-205637097 CCTCATTTGGTAAAGGGGGGTGG - Intergenic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945142578 2:206702694-206702716 CTTCATTTGTAAAATAAGGTGGG + Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945647805 2:212522221-212522243 CCTTGTTTGTAAAATAAGGATGG + Intronic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946109778 2:217404492-217404514 TCTCATTTGTAAAATGAAGGTGG - Intronic
946326610 2:218987744-218987766 CCTCATTTGTAAAGTGGGTATGG + Intergenic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
946492585 2:220164284-220164306 CCTCATCTGTAAAATGGCATTGG + Intergenic
946582043 2:221140304-221140326 ACTCATTAGGAAACTGGGGAAGG - Intergenic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
947406059 2:229778730-229778752 TCTCATTTATCAAATAGGGAAGG - Intronic
947562312 2:231167005-231167027 CCTCATCTGTAAAATTGATATGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948295023 2:236854213-236854235 CCCTATCCGTAAAATGGGGATGG - Intergenic
948329771 2:237155793-237155815 CCTTCATGGTAAAATGGGGAGGG - Intergenic
948404669 2:237708234-237708256 CCTCATATTTAAACTGGGGATGG + Intronic
948631983 2:239308154-239308176 CCTCATCTGTGAGATGGGGGTGG + Intronic
948685352 2:239666432-239666454 CCCCATTTGTAGAATGACGATGG + Intergenic
948907520 2:240986851-240986873 CCCCATCTGTGAAGTGGGGAAGG + Intronic
1168803029 20:655645-655667 CCCCATCTATCAAATGGGGATGG - Intronic
1168830635 20:843610-843632 TCTCATCTGTAAAATGGAGGGGG - Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169213727 20:3781989-3782011 CCTCCTTTGTGAAATGACGATGG + Intergenic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169283747 20:4289931-4289953 CCTCATTTGTAAAGTGAGTCAGG - Intergenic
1169488302 20:6051901-6051923 CCTCATATGTAAAAAGGAGATGG + Intronic
1169906576 20:10610547-10610569 CCTCAAGTCTGAAATGGGGAAGG + Intronic
1170031371 20:11947703-11947725 CCTCATTTTTAAAAAGGGGGAGG - Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170509242 20:17059819-17059841 CCTCATCTTTCAAATGTGGATGG - Intergenic
1170683440 20:18547267-18547289 CCTCACCTGTAAACTAGGGATGG + Intronic
1170740625 20:19052937-19052959 TCTCATCCATAAAATGGGGATGG + Intergenic
1171490986 20:25516975-25516997 CCTCATCTGAATAATGGGTATGG + Intronic
1171998070 20:31748756-31748778 CCTTGTTTATAAAATGGTGATGG + Intronic
1172046819 20:32086357-32086379 CCTCATCTGTAAAGTGGAAATGG - Intronic
1172114312 20:32564668-32564690 CTTCATCTGTAAAATGGGCTAGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172126132 20:32626435-32626457 TCTCCTCTGTAAGATGGGGATGG - Intergenic
1172294950 20:33802931-33802953 CCTCAACTGTAAAATGGAGGTGG + Intergenic
1172298332 20:33829998-33830020 CCTCATTTGTAAAATGGGAGTGG - Intronic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172329615 20:34066186-34066208 TTTCATTTATAAAATGGGGCGGG + Intronic
1172766437 20:37353641-37353663 CCTCTTTGGTGAAATGGGGCCGG - Intronic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1172973427 20:38889624-38889646 CCTGATTTGTGCAATGAGGACGG + Exonic
1173084834 20:39905804-39905826 CCTCATTTGTAACATGGAGGGGG - Intergenic
1173090729 20:39968693-39968715 CCTTCTTTGTGAAATGGGAAGGG - Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173202384 20:40963380-40963402 CTTTATTTGTAAAAAGGGTAAGG - Intergenic
1173224039 20:41151513-41151535 CCTTGTTTGTAAAATGGAAAGGG + Intronic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173413551 20:42836892-42836914 CCTTATTTTTGATATGGGGATGG - Intronic
1173528816 20:43752788-43752810 CTTCAATGGTAAAATGGGAAAGG + Intergenic
1173542393 20:43863877-43863899 CCTCATCTCTAAAACGGGGGTGG + Intergenic
1173547065 20:43905965-43905987 CCTGACCTGTAAACTGGGGATGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173605135 20:44326566-44326588 TCCCATCTGTTAAATGGGGATGG - Intergenic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1173795130 20:45854596-45854618 CTTCAGCTGTAAAATGGAGAAGG - Intronic
1173813468 20:45970504-45970526 CCTCGTCTGTAAAGTGGGAATGG - Intronic
1173852795 20:46229294-46229316 CCTCAGCTGTAAAATTGGGGGGG - Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174052435 20:47776382-47776404 CCTCCTTTGTAAAACGGGGTTGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174297908 20:49562038-49562060 CCTCCTCTGTAAAATGGGCCTGG - Intronic
1174341914 20:49902574-49902596 CCCCATATGTAAGATGGAGATGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174563246 20:51446100-51446122 CCCCATCCGTAAAATGGGAAGGG + Intronic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174822651 20:53740589-53740611 CGTCATTTTTAACTTGGGGATGG - Intergenic
1174911515 20:54612915-54612937 TCTCCTTTGTAAAATGGGAAGGG + Intronic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175226372 20:57446474-57446496 CCTCATTTGTAACATGTGAATGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175550085 20:59811852-59811874 CCTTGTTTGTGAAATGGGGATGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175855754 20:62120070-62120092 CCTTACTTGGAAAATGGGGTGGG + Intergenic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1177345612 21:19864846-19864868 CGTCATTTGTACAATGTAGAGGG + Intergenic
1177535182 21:22417329-22417351 CCTAATTTTAAAAATGAGGAAGG - Intergenic
1177647232 21:23914878-23914900 CCTCATTGGTAGAATGGAGATGG - Intergenic
1177715180 21:24831237-24831259 CATCATATGTAAAATAGGGGTGG + Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1177922337 21:27167926-27167948 CCTCACCTGTAAAATAGGAATGG + Intergenic
1178087696 21:29128749-29128771 GCTCATCTGTCAAATCGGGATGG + Intronic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178235597 21:30837505-30837527 CCTCATGTATAAAATGAAGAGGG - Intergenic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1178681156 21:34672809-34672831 TCTCATTGATAAAATGGGGACGG + Intronic
1178883205 21:36464776-36464798 CCCCATGTGTAAAAAGGGGATGG - Intronic
1179029244 21:37705368-37705390 CCTCATTTGTTAAATGGGAATGG + Intronic
1179118800 21:38523393-38523415 CCTCATTTGGAAAATGGACTTGG - Intronic
1179144189 21:38752822-38752844 CCTCCTATCTAAAGTGGGGATGG + Intergenic
1179293523 21:40040753-40040775 CTGCATCTGTAAAATGGGAATGG - Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179557839 21:42191959-42191981 TTTCATTTGTAAACTTGGGAGGG - Intergenic
1179956454 21:44742090-44742112 CCGCCATTGTAAAATGGTGAAGG - Intergenic
1179988091 21:44932277-44932299 CCCCATCTCTATAATGGGGACGG - Intergenic
1180487336 22:15815082-15815104 CCTTATTTCTAAAATAGGGAAGG - Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181728303 22:24826894-24826916 CCTCATCTGTGTAACGGGGATGG - Intronic
1181849740 22:25741629-25741651 CCCCACTTGTAAAGTGGGGCTGG + Intergenic
1181876104 22:25942115-25942137 CCTCCTCTATAAAATAGGGATGG - Intronic
1181893121 22:26082380-26082402 ACTCATTTGTTAAATATGGATGG - Intergenic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1181987218 22:26808529-26808551 CCCCATCCTTAAAATGGGGATGG - Intergenic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1181997758 22:26896240-26896262 TCTCATGTGTAAAATGGGAATGG - Intergenic
1182044779 22:27265741-27265763 ACTCATCTTTAAAATGGAGATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182093789 22:27613134-27613156 CCTCATTTGTCAAGTGAGCATGG + Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182427987 22:30284931-30284953 CCTCGTCTGGAAAATGGTGATGG + Intergenic
1182509051 22:30806125-30806147 CTTCATTTGTATAATAAGGATGG - Intronic
1182517897 22:30869331-30869353 CCTCATCTGTCACCTGGGGATGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183228662 22:36567138-36567160 CCTCATCTGTAAAGCAGGGATGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183345688 22:37306414-37306436 CCTCTGCTGTAAACTGGGGACGG - Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183389710 22:37538579-37538601 CCTCTTCTGTAAAGGGGGGAAGG - Intergenic
1183404528 22:37623887-37623909 CCCCAGTTGTGAAAAGGGGATGG - Intronic
1183410177 22:37650363-37650385 TCTCATTTTTACAACGGGGATGG + Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183424664 22:37733115-37733137 CCCCTTCTGAAAAATGGGGATGG - Intronic
1183444671 22:37845442-37845464 CCTCACCTATAAAATAGGGATGG - Intronic
1183594403 22:38801669-38801691 CTTCATCTATAAAATGGGAAGGG + Intergenic
1183629077 22:39022310-39022332 CCTCCTCTGTAAGATGGGAATGG + Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183632562 22:39042100-39042122 CCTCCTCTGTAAGATGGGAATGG + Intronic
1183633719 22:39048301-39048323 CCTCGTCTGTAAAATAGTGATGG + Intronic
1183666939 22:39251579-39251601 CCCCATTTGTGAAATGGGGGTGG - Intergenic
1183684831 22:39355664-39355686 CCTCATCTGTAACATGGGATTGG + Intronic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1183933717 22:41250054-41250076 CCTCAGGTATAAAATGGGCATGG + Intronic
1184088574 22:42280668-42280690 CCCTAGTTGTAAAATGGAGATGG - Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184384835 22:44168079-44168101 CTTCATCTGTAAAATGGGCCTGG - Intronic
1184448934 22:44571376-44571398 CCTCATCCGTAAAGTGGGTAGGG - Intergenic
1184565052 22:45286858-45286880 TCTCTTGTGTAAAATGGGAAAGG - Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1184845079 22:47077828-47077850 CTTCATTTTTAAAATGGGATAGG + Intronic
949317067 3:2768849-2768871 CTACATGTGTAAGATGGGGATGG - Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949577621 3:5353931-5353953 CCCCAGTTGTTAAATGGGTAGGG + Intergenic
949673497 3:6426100-6426122 CCTCATTTATAAAGTAGGAATGG - Intergenic
949876251 3:8627901-8627923 CTTCATCTGTAAAATGGTGCGGG + Intronic
949920444 3:8996105-8996127 CCTCATCTGTTAAATGGAAATGG + Intronic
949934132 3:9103460-9103482 CCTCATTTGTGAAATGGTGATGG - Intronic
949982600 3:9511387-9511409 CCTCATTCGTATAATGAGGGTGG - Intronic
950099665 3:10349060-10349082 CCTCATTTGTAAAATGGCTATGG - Intronic
950143373 3:10630662-10630684 CCTCATCTGTAAAATGGCTCAGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950175661 3:10872401-10872423 CATTACTTGGAAAATGGGGATGG - Intronic
950189606 3:10967416-10967438 CCTCATCTGTGAAATGCAGACGG - Intergenic
950222143 3:11204721-11204743 TCTCATTTGTAAATTGGAGATGG - Intronic
950228576 3:11256322-11256344 TCTCATGTGTCAAATGGGTAGGG - Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950611695 3:14131124-14131146 CTTCGTGTATAAAATGGGGACGG + Intronic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
951159154 3:19395259-19395281 CGTCATTGGAAAAATGGAGAGGG + Exonic
951202526 3:19890965-19890987 CCTCATATGTCAAATGGAAATGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951410217 3:22354192-22354214 ACTCAGTTGGAAAATGGGGATGG - Intronic
951507188 3:23460418-23460440 CCTCATATGTAAAATGGAAATGG + Intronic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951685109 3:25335117-25335139 CCTCAGCTATAATATGGGGATGG + Intronic
951698707 3:25472558-25472580 CCTCATCTGTGAAATGGAGGGGG - Intronic
951793122 3:26508484-26508506 CCTCCTGTGTAAAATGAGGTCGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952000861 3:28784402-28784424 CCTCATTTGTCAAAAAGGGAGGG - Intergenic
952191804 3:31030508-31030530 CCTCCTCTGTAAAATGGAGCCGG + Intergenic
952358565 3:32606860-32606882 CCTCATGTAAAAAATGGGGCGGG + Intergenic
952627607 3:35425838-35425860 CCTCATTTTAATGATGGGGAAGG - Intergenic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953073236 3:39544650-39544672 CCTCAACTCTAAAATGGGAATGG - Intergenic
953203412 3:40798424-40798446 CTTCATCCATAAAATGGGGATGG + Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953864550 3:46572983-46573005 CCTATTTTCTAAAATGGGGTTGG - Intronic
953975106 3:47376489-47376511 CTACATTGGTAAAATGGGGAAGG + Intergenic
954423740 3:50432431-50432453 CCACATTTGTAAACTGGACAGGG + Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954842819 3:53526871-53526893 CCTAATTTGTCAAATGAGCAGGG + Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955098782 3:55826623-55826645 AGCCTTTTGTAAAATGGGGAGGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
955708531 3:61754264-61754286 GCTCAGCTGTAAAATGGAGATGG + Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956482172 3:69684169-69684191 CTTCAGTTTTAAAATTGGGAAGG - Intergenic
956482275 3:69685146-69685168 CCATATCTGTAAAATGGGAATGG + Intergenic
956531757 3:70227767-70227789 CCTCATTTGTAAAACATGGAGGG - Intergenic
956699067 3:71942787-71942809 TCTCATGTGTGAAATGTGGATGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956792046 3:72687424-72687446 CATCATGTGTAAAAAGTGGACGG - Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957159842 3:76596540-76596562 CCTCATTTGTTAAATGTAGGTGG + Intronic
957194228 3:77047314-77047336 CCTTACCTGTAAAATGGGCATGG + Intronic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
957935211 3:86933653-86933675 CCTCATTAGTAAAAAGGAGATGG - Intergenic
958696475 3:97534143-97534165 CCACATCTGTAAAATGGGACAGG + Intronic
958822414 3:98990771-98990793 CCTCATTTTTAAGATGGAAATGG - Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959461745 3:106635101-106635123 CTTCATTGGTAAAATGGAGAGGG + Intergenic
959720733 3:109485002-109485024 CCCCATTTTTAACATGTGGAAGG + Intergenic
960167599 3:114421318-114421340 CCCCATTTCTATAATGGGGAAGG + Intronic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
960649161 3:119926932-119926954 AGTCATTTATAAAGTGGGGAAGG - Intronic
960789597 3:121413870-121413892 TCTTATTTGTAAAATGAGGGGGG - Intronic
960996401 3:123343373-123343395 CCTCACCTGTAACATGGGGTGGG - Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961072404 3:123945872-123945894 CCTCATCAGTAAAATGGGAGTGG + Intronic
961301595 3:125925392-125925414 CCTCATCTATAAAATGGAGGTGG + Intergenic
961363117 3:126380447-126380469 CCTCATTTGGAAAAGCGAGATGG - Intergenic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
961886872 3:130102463-130102485 CCTCATCTATAAAATGGAGGTGG - Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
963062672 3:141237505-141237527 CCTTATTTGTAAAATTTGGGTGG + Intronic
963121568 3:141781036-141781058 CCTCCTTTGTGAGTTGGGGATGG + Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963234921 3:142947183-142947205 CCTCATCTGTAAAATAGAGCGGG - Intergenic
963417703 3:145018998-145019020 CCTCATATGTAATATAGGCATGG - Intergenic
963747227 3:149136615-149136637 CCTGATGTATAAAATGAGGAGGG + Intronic
963841843 3:150115858-150115880 CCTCATATATAAAATGGGATAGG - Intergenic
964159253 3:153626805-153626827 GCACATTTGTAGAAGGGGGATGG + Intergenic
964277970 3:155028040-155028062 CCTTCTTTTTAAAATGGGAATGG + Intronic
964649230 3:158992221-158992243 CCTCATTTGGCAAATGAGGCTGG + Intronic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965638721 3:170811081-170811103 CCTTATCTGTAAAATGGAGGTGG + Intronic
965680866 3:171249983-171250005 CTTCATTAGTATAATGGGGGTGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965772600 3:172196577-172196599 TCTCATCTGTAAAATGGAGGTGG + Intronic
965881830 3:173396569-173396591 CCTGTTTTTTAAAAGGGGGAGGG + Intronic
965944831 3:174227357-174227379 CCTCATGTGTGAAATGGAAAAGG - Intronic
966053416 3:175650969-175650991 CCTCATCTTTGAAATGTGGATGG + Intronic
966226474 3:177603407-177603429 CCACATTTGTAAAAGGGAAAGGG - Intergenic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
966500126 3:180630039-180630061 CCTCACTTGGAAAATGAAGAGGG - Intronic
966618060 3:181933703-181933725 CCTCATTTTTAAAATCAGTAGGG - Intergenic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966833132 3:184028194-184028216 CCTTATCTCTAAAATTGGGAGGG - Intergenic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967260817 3:187640197-187640219 CCTCATCTGTAAAATGGTAGTGG - Intergenic
967447712 3:189586012-189586034 CCTCATTTGTAAAATAATAATGG - Intergenic
967534889 3:190590644-190590666 TTTCACTTGTAAAATGGGAAGGG + Intronic
967939088 3:194752909-194752931 CCTCATTTGTAAATGAGGTATGG - Intergenic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
968999654 4:3970009-3970031 CCTCGTCTGTAACTTGGGGACGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969241909 4:5904528-5904550 CCTTATCTGTAAAATGGGTGTGG - Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
969501721 4:7557354-7557376 CTTCATCTGTAAATTGGGGTTGG + Intronic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
969757949 4:9162231-9162253 CCTCATCTATAAAATGGAGGTGG + Intergenic
969817931 4:9699773-9699795 CCTCATCTATAAAATGGAGGTGG + Intergenic
970108129 4:12608220-12608242 CCTCATCTGTAAAATGGAATAGG - Intergenic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970383482 4:15532030-15532052 TCACATCTGTAAAATGGGTATGG - Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970681125 4:18509563-18509585 CCTCATTAGTTCTATGGGGAAGG - Intergenic
970724791 4:19031051-19031073 CCTGTTTTGTAAAATGGAGATGG + Intergenic
970795692 4:19910248-19910270 CATCATTTGTAAAGTCGGGATGG - Intergenic
970795973 4:19914054-19914076 CCTCATTTTGTAAATGGAGAAGG - Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971159891 4:24122975-24122997 CCCCAGTTCTCAAATGGGGAAGG + Intergenic
971181688 4:24334272-24334294 TCTCATCTATAAAATGGGAAAGG - Intergenic
971198123 4:24488637-24488659 CAGCATCTGTAAAAAGGGGATGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971465498 4:26954610-26954632 CTTCATTGCTAAAATGAGGAGGG + Intronic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
971493840 4:27242821-27242843 CCCAAGCTGTAAAATGGGGAGGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973175817 4:47203660-47203682 CCTCATTTGTGACACAGGGATGG + Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973186528 4:47336447-47336469 CCTCCTTGGAAAAATGGGAACGG - Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973231080 4:47838987-47839009 ATGCATTTGTAAAATGGGGGGGG + Intergenic
973267973 4:48230349-48230371 CTTCATTTGTAAAGTATGGAAGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
974744374 4:66051755-66051777 CTTCATTTGAAAAATGATGATGG - Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
975553879 4:75640525-75640547 CCTTATTTGTGAAATGGGATGGG - Intergenic
975925849 4:79452042-79452064 TCTCATTTGTAAATTGGGTTGGG - Intergenic
975997422 4:80332356-80332378 GCTTATTTTTAAAATGGGAAAGG + Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977067639 4:92338871-92338893 TCTCATTTGTAAAATGCTGTTGG + Intronic
977585055 4:98765783-98765805 ACTCAATTTTAAAATGGGCAAGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978408362 4:108403295-108403317 CATCATTGCTAAAAAGGGGAAGG - Intergenic
978847423 4:113290763-113290785 CCTCATTTGAAAAATGGAAATGG - Intronic
978975653 4:114867295-114867317 CATCATTTCTAAACTGGGGCTGG + Intronic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980997760 4:139796981-139797003 CCTCATCTGTAAAATGGTCCTGG + Intronic
981000683 4:139825948-139825970 CCTCATTTGTAACCCGGGGTCGG + Intronic
981316314 4:143343137-143343159 CCTTACCTGTAAAATGGGGGAGG + Intronic
981410003 4:144418502-144418524 CCTCATCTATGAAATGGGAAGGG - Intergenic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
981785837 4:148478725-148478747 CCTCATTTGTAATTTGAAGATGG + Intergenic
982225404 4:153160912-153160934 CTTCATTTTTAAAAAGGGGAGGG + Intronic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
983201730 4:164868341-164868363 TCTCATTTGTAAAATGGATGCGG + Intergenic
983948178 4:173609384-173609406 CTTTCTTTGTAAAATGGAGATGG + Intergenic
984653295 4:182291580-182291602 CCTCAGCTGTACCATGGGGAGGG - Intronic
985821381 5:2163195-2163217 TCTCATCTCTAACATGGGGATGG + Intergenic
986633583 5:9798579-9798601 CCCCATCTGTAAAATGCTGAGGG + Intergenic
986791933 5:11170059-11170081 CCTCATCTGTAAAATGGACTTGG - Intronic
986805512 5:11305211-11305233 CCTCATCTGTCAAACGGAGATGG - Intronic
986856808 5:11878841-11878863 CATCATTTGCAAGGTGGGGAAGG + Intronic
987002711 5:13676425-13676447 CCTCATCTATAAAATAGGCATGG + Intergenic
987072776 5:14353593-14353615 TCTCATCTATAAAATGGGCATGG - Intronic
987333540 5:16878021-16878043 CTCCATCTGTAAAATGGGAATGG - Intronic
987807386 5:22786638-22786660 CTTCATTTGTGTAATGGGGAAGG + Intronic
988392105 5:30647665-30647687 AATCATATGTAAAAAGGGGAGGG + Intergenic
988528123 5:32004018-32004040 GCTAGTTTGGAAAATGGGGAAGG + Intronic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989344393 5:40412772-40412794 TCCCATGTGTAAAATGGGAAAGG + Intergenic
989606717 5:43251459-43251481 CCTCGTTTGTAAAACATGGAAGG - Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990626014 5:57612351-57612373 TCTAATTTGTAAAATGGGAAGGG - Intergenic
990821862 5:59850371-59850393 GCCCATTTGTAAAATGAGCATGG + Intronic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991290203 5:65026327-65026349 CCTCATTTGTGATATGGAAACGG - Intergenic
991439481 5:66631827-66631849 CCCCTTTGGTAAAATGGGGATGG - Intronic
991442516 5:66665775-66665797 CCTCACTGGTAAAATGTGGTGGG + Intronic
991490188 5:67175163-67175185 TCTCATCTATAAAATGGGAATGG - Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
991990795 5:72337109-72337131 TCTCATTTGTAAAATGAGATAGG - Intronic
992009371 5:72511532-72511554 CTTCATCTGTAAAAAGGGCAGGG - Intergenic
992182719 5:74213761-74213783 CTTTATTTGTAAAATGCGAATGG - Intergenic
992300142 5:75369569-75369591 CCTCATCTGTAAAACAGGGGTGG + Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993050174 5:82917308-82917330 TCTTATTTGTTAAATGGAGATGG + Intergenic
993520595 5:88894954-88894976 CCCTTTTTGTAAAATGGGGAAGG + Intronic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
993969765 5:94404873-94404895 CCTCATTTATAAAATGGTGAGGG + Intronic
994294828 5:98078387-98078409 CCTTATTTGTAAAATGGAGATGG - Intergenic
994711012 5:103264019-103264041 CCTCATTTGTGAAATGGTTGGGG - Intronic
995000328 5:107120006-107120028 TCTCATTTTAAAAATGGGAATGG - Intergenic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
996347043 5:122498833-122498855 TCCCACTTGTAAAATGGGGATGG - Intergenic
996767690 5:127050673-127050695 CCTCATATATAAAATGGGAGTGG + Intronic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
996864161 5:128100320-128100342 CCTTATATGAAAAATGGGAAAGG + Intronic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997779839 5:136645579-136645601 CCTCATGTGTACAATGGAGGTGG - Intergenic
997880213 5:137582615-137582637 TCTCATCTATAAAATGGGAATGG - Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998607406 5:143649194-143649216 CCTCATTTATAAACTAGGGATGG - Intergenic
998778462 5:145629686-145629708 CCTCATTTATAAAAAGGGGCAGG - Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
998928008 5:147148542-147148564 TCTCAAGTATAAAATGGGGATGG + Intergenic
998986293 5:147761379-147761401 CCTCATGTGTAAAATGGAAAAGG - Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999111744 5:149127348-149127370 CCTCATCTCTAAAATGGGTTTGG - Intergenic
999327862 5:150654439-150654461 CATCATTTGTAAAATGGGTGTGG + Intronic
999343643 5:150795803-150795825 CCTTATCTTTCAAATGGGGATGG + Exonic
999364091 5:151010134-151010156 CCTCATCTGTAAAATGGATGTGG + Intergenic
999438140 5:151580353-151580375 CCCCATTTGTGAAATGGGGCTGG + Intergenic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999586160 5:153091934-153091956 CCTCTTTTCAAAAATGGGTATGG + Intergenic
999645265 5:153711554-153711576 CCTCATGTGTAACATGGGGTGGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999892052 5:155988760-155988782 TCTCCTTTGTAAAATGGTAATGG + Intronic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1000062379 5:157668926-157668948 GCTCATTTGTAAAGTGAGAATGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000327259 5:160181819-160181841 CCCCATTTGTAACATGAGGCAGG - Intergenic
1000421643 5:161044817-161044839 TCTCACTTATAAAATGAGGATGG - Intergenic
1000632168 5:163602947-163602969 CCTCATTTGTAAAATAAAGATGG - Intergenic
1001003715 5:168031259-168031281 CCTCTTTTGTAAAATGAGTCTGG + Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001086665 5:168704981-168705003 CCTCAGCTGTAAAATGGAGGAGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001131614 5:169069148-169069170 CCTCAACTGTAAATTGGGGGTGG - Intronic
1001165816 5:169365890-169365912 TCTCATTTGAGAAATGGGGAGGG - Intergenic
1001274085 5:170337597-170337619 CCTCTTCTGTAAAATGGAAAAGG + Intergenic
1001287360 5:170433795-170433817 CCTCATTTGTAAAATAATAAGGG - Intronic
1001301674 5:170538081-170538103 TCTCATCTTTAAAATGGGAAAGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001775750 5:174327960-174327982 CCTTATCTGTAAAAATGGGACGG + Intergenic
1001874159 5:175184985-175185007 CATTATCTGTGAAATGGGGATGG - Intergenic
1002026498 5:176399443-176399465 TCTCATTTGAAAAATGGGGCTGG + Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002077455 5:176717444-176717466 CCTCCTTTGTAAGCTGTGGAGGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1002777971 6:344654-344676 TCTCATTTATAAAGTGGGGCTGG - Intronic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1002845235 6:939456-939478 GTTCATTTGTAAGATGGAGAAGG + Intergenic
1003106409 6:3219817-3219839 CCTCATTTGTGAACTGATGAGGG + Intergenic
1003480358 6:6525526-6525548 CATCATCTGTAAAACAGGGAAGG + Intergenic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004020162 6:11770000-11770022 CCTCGTTTGTAAAATGGTGGTGG - Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1005210353 6:23453498-23453520 CATCATTTGTAAAATAGGTTGGG - Intergenic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1006235436 6:32626721-32626743 CCTAATTGGTAAAATGGGGGAGG + Intergenic
1006387313 6:33738575-33738597 TCTCATCTGTAAAACGGGGCTGG - Intronic
1006453064 6:34116277-34116299 CCTCTCCTGTAAAATGGGGCCGG + Intronic
1006590814 6:35155558-35155580 TCTTATATGTAAAATGGTGAAGG - Intergenic
1006623098 6:35380799-35380821 CCTCATTTGTAAAACAGGCATGG + Intronic
1006793208 6:36716901-36716923 GCTCATTTGTAAAATGGGGTGGG - Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1006969139 6:38022589-38022611 CCTCATTTGAAAAATGGAGTGGG - Intronic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007267410 6:40607512-40607534 CCACATCAGTAAAATGGAGAAGG - Intergenic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007811463 6:44489157-44489179 GCTCATCTGTGAAATAGGGATGG - Intergenic
1007897133 6:45374392-45374414 CCTCATTTATAAAATGAAGATGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008299572 6:49818561-49818583 CATTATCTGTAAAATGGAGATGG + Intergenic
1008476125 6:51937715-51937737 CTCCATCTGTAAAATGGGCATGG + Intronic
1009558547 6:65207784-65207806 CCCCATTTAAAAAATGGTGATGG + Intronic
1010084998 6:71906753-71906775 TCTTATTTGTGAAATGGGGATGG + Intronic
1010166574 6:72921601-72921623 CCTCCTCAGTAAAATTGGGAAGG + Intronic
1010188911 6:73174739-73174761 CCTCACTGGCAAACTGGGGATGG + Intronic
1010393995 6:75369649-75369671 CCACACTTCTAAAACGGGGATGG + Intronic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1010872089 6:81056238-81056260 CTTCATTTCTAAAATGGGTGTGG - Intergenic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1011180573 6:84615227-84615249 CTTAATTTGTAAAATGGGAATGG + Intergenic
1011350850 6:86422107-86422129 CTTCATTTGCAAAATGGTGTGGG + Intergenic
1011787572 6:90864190-90864212 TCACTTTTATAAAATGGGGATGG + Intergenic
1011812053 6:91144225-91144247 GCTCATTGCTACAATGGGGAAGG - Intergenic
1011971642 6:93231876-93231898 TCTCGTTTGTAAAATGAGAATGG - Intergenic
1012187583 6:96238947-96238969 CCTCATTTGTGAAATAAGAATGG + Intergenic
1012318564 6:97813572-97813594 CCTTATTTGTAAAATTATGATGG - Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012952317 6:105531480-105531502 TCTCATCTATAAAATGGGAATGG - Intergenic
1013080083 6:106804822-106804844 CCTCCTTCCTAAAATGGGTATGG - Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013193852 6:107828088-107828110 CCTTATCTGTAAGATGGGAATGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013324768 6:109033649-109033671 TTTCATTTGTAAAATGGGAGGGG + Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014057685 6:117035403-117035425 CCTCATCTATAAAAAGGAGATGG - Intergenic
1014388527 6:120831646-120831668 CCTCATATTTGAAATAGGGATGG - Intergenic
1015025521 6:128527749-128527771 GCTTATTTGAAAAATGGAGAAGG + Intergenic
1015090034 6:129344976-129344998 CCTAATTTGGGATATGGGGAAGG + Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015264387 6:131276022-131276044 CATCATTTTTACACTGGGGATGG - Intronic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016676328 6:146773607-146773629 CTTCATCTGTAAAACTGGGATGG - Intronic
1016723527 6:147331496-147331518 CCTCATTTATAAAATGAAGGTGG + Intronic
1016840025 6:148516701-148516723 CCTCATTTTCGAAATGAGGATGG - Intronic
1017094968 6:150796742-150796764 CTTCATCTATGAAATGGGGAAGG - Intronic
1017131513 6:151112129-151112151 CCTTAATTACAAAATGGGGAAGG - Intergenic
1018071869 6:160171800-160171822 TCATATTTATAAAATGGGGAGGG + Intronic
1018284226 6:162219653-162219675 ACCCATTTGTGAAATGGAGAAGG - Intronic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020026689 7:4904698-4904720 TCTCAGTTGCTAAATGGGGAAGG - Intergenic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020320309 7:6934877-6934899 CCTCATCTATAAAATGGAGGTGG - Intergenic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1020678135 7:11204127-11204149 CTACCTCTGTAAAATGGGGACGG + Intergenic
1021229750 7:18071904-18071926 CCTCATTTGTAAAACCTAGATGG + Intergenic
1021330088 7:19326142-19326164 CTTCATTTGTAAATATGGGAGGG - Intergenic
1021407612 7:20291254-20291276 CTACAGTTGTATAATGGGGATGG - Intergenic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021542195 7:21772235-21772257 TTTCATTTGTAAATCGGGGATGG - Intronic
1021610016 7:22447894-22447916 GCTCATCTGTAAAAAGGAGATGG - Intronic
1021659029 7:22899790-22899812 CCTTCTTTTTAAAATGGGAAAGG + Intergenic
1021675646 7:23077863-23077885 CCTCATCTGTAAAACAGGGGTGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022101590 7:27172644-27172666 CATCATTGGTCCAATGGGGAAGG + Intronic
1022270805 7:28805790-28805812 TCCCATCTGTAAAATGGGGCTGG + Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023312802 7:38904805-38904827 CCTAATTTCTAAAATGCAGAAGG + Intronic
1023354310 7:39351783-39351805 CCTCATGTGTGAAATGGAGCTGG - Intronic
1023375306 7:39549852-39549874 CCTTATCTATAAAATGGAGAGGG + Intergenic
1023627285 7:42128845-42128867 CCTCATCTCTAAAATGGGAGTGG - Intronic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026523465 7:71135333-71135355 TCTCATTTCTCAACTGGGGATGG - Intronic
1026840336 7:73667453-73667475 TCTCTTCTGTAAAATGGGGTTGG - Intergenic
1026918314 7:74136472-74136494 CTTAATTTTTAAAATAGGGATGG + Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1026953330 7:74361695-74361717 CCTGATGTGTAAAATGAGAATGG - Intronic
1026977010 7:74505209-74505231 TTTCATTTGTAAAGTGGGAATGG - Intronic
1027380241 7:77600414-77600436 TCTCAGTTATAAAATGAGGATGG + Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028137559 7:87238297-87238319 CTTGATCTGTCAAATGGGGATGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029464925 7:100719569-100719591 CCTCATCTGTCAAATGGGTGTGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029585633 7:101468977-101468999 TCTCATCTGTGAAATGGGGTTGG + Intronic
1029734974 7:102460600-102460622 CCTCCTTTGTAAAATGGAGAAGG - Intronic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1029910092 7:104136615-104136637 CATCATTTGTAAATTTGAGAAGG + Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030281626 7:107782011-107782033 CCACATTTGTAAAATAGAAAGGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030684717 7:112473357-112473379 CCTCATTTGTAAAACGAGTCTGG - Intronic
1030694044 7:112565115-112565137 CCTTATCTGTAAGATTGGGATGG - Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030738403 7:113078749-113078771 CCTGGTTTTTAAAATGGGGCAGG - Intronic
1030880449 7:114871755-114871777 TCACATTTGTAAAAAGGGGTCGG - Intergenic
1030934652 7:115570461-115570483 GCACATTTTTAAAAAGGGGAGGG - Intergenic
1031056183 7:116995272-116995294 CCTCATTTGTCAAAGGGCAAAGG - Intronic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031154920 7:118098403-118098425 CAACATTTTTAAAATGCGGAAGG + Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031537937 7:122958266-122958288 TCTCTTTTGAAAAATGGGTATGG - Intergenic
1031971717 7:128069389-128069411 CCTTAATGGTAAAATGAGGAGGG - Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032857327 7:135846287-135846309 TCTCATTTGTAAAATGAAGAGGG - Intergenic
1033025142 7:137764909-137764931 CCTCTTGGGTAAAATGTGGAAGG - Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033673464 7:143514814-143514836 CCTCATCTATAACATGGGTATGG - Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034097127 7:148419742-148419764 CATCATTTAAAAAATGGGGCTGG - Exonic
1034384778 7:150731890-150731912 CCTTATCTGTAATATGGGGGAGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035232017 7:157470852-157470874 CCTCATCTGTTAAATGGAAATGG - Intergenic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036079048 8:5533445-5533467 CCTCAGTTGTAAGAGGTGGATGG + Intergenic
1036377583 8:8213949-8213971 CCTCGTCTGTAACTTGGGGATGG - Intergenic
1036381202 8:8237553-8237575 CCTCATCTATAAAATGGAGGTGG + Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036848361 8:12185075-12185097 CCTCATCTATAAAATGGAGGTGG - Intronic
1036851980 8:12209199-12209221 CCTCGTCTGTAACTTGGGGATGG + Intergenic
1036869721 8:12427356-12427378 CCTCATCTATAAAATGGAGGTGG - Intronic
1036873346 8:12451721-12451743 CCTCGTCTGTAACTTGGGGATGG + Intergenic
1036959801 8:13231668-13231690 CCTCATCTGTTAAATGGAGGTGG - Intronic
1037153481 8:15669925-15669947 CCTAATTCGTAAATTGGGTAAGG + Intronic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1037748322 8:21663593-21663615 TCTCATCTGTCAAATGGAGATGG - Intergenic
1037801628 8:22039093-22039115 CCTCATCTGGGAAATGGGGCTGG - Intergenic
1037994621 8:23343341-23343363 TCTCATCTGTAAGGTGGGGATGG - Intronic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038410889 8:27359040-27359062 CCTAATGGCTAAAATGGGGAGGG - Intronic
1038467045 8:27773933-27773955 TATTATTTGTAAAATGGGAATGG + Intronic
1038477563 8:27878786-27878808 CCTCATTTGAAAAACAGGGATGG + Intronic
1038531116 8:28318573-28318595 TCTCATTTGTAAAGTGTGGCAGG + Intronic
1038543088 8:28405041-28405063 CCTCATTTGTAAACCTGGGATGG + Intronic
1039344052 8:36684432-36684454 CCTCATTTCTAAAATCAGGGAGG + Intergenic
1039914794 8:41852014-41852036 CCTCAGTTATAAAATGGGCATGG - Intronic
1039965579 8:42281377-42281399 CCTCATCCATAAGATGGGGATGG - Intronic
1040397959 8:47017370-47017392 CCTCATTTGTATTCTGGGTAAGG + Intergenic
1040981157 8:53247383-53247405 CCTCATCTGTTAAGTGGGTATGG + Intronic
1041307190 8:56473461-56473483 ACTCATTTATAAAATGAGCAAGG + Intergenic
1041482396 8:58336442-58336464 GCTCATCTGTAAGTTGGGGATGG - Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042113594 8:65407888-65407910 CCTCATCTCTGAACTGGGGAAGG - Intergenic
1042122206 8:65500473-65500495 TCTCATTTGTAAATAGGGGATGG - Intergenic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1042804885 8:72760424-72760446 CCCCATTTTTCAAATGGGGCAGG + Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1043205202 8:77429360-77429382 TCTCATTTATATAATGGGGTGGG - Intergenic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043663406 8:82776242-82776264 CTTCATTTGTGAAATGGAGATGG - Intergenic
1043804003 8:84647927-84647949 TCTCATCTGTAATTTGGGGAAGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045041620 8:98229987-98230009 CCTCACTTGTCAAATGTAGATGG - Intronic
1045051455 8:98330887-98330909 CCTCATCAGTCAAATGGAGAGGG - Intergenic
1045116139 8:98982473-98982495 ACTCATTTGTAAAACAGGGAGGG - Intergenic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1045202450 8:99998330-99998352 CCTCATTTGAAAAATTGAGTTGG - Intronic
1045362034 8:101441808-101441830 CTTCATTTGTCAAGTGGGCATGG - Intergenic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045498122 8:102725567-102725589 CCTCCTTTTTGAAATGGCGATGG - Intergenic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1045575297 8:103414493-103414515 CCTGATTTGTAAAATAAAGAAGG - Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045640140 8:104240697-104240719 CCTCATTTATGAAAAAGGGAGGG - Intronic
1046565341 8:115892389-115892411 TCCCATTTATAAAATGGGGATGG - Intergenic
1046582744 8:116113239-116113261 GCTTATTTGTAAAATTGGCAGGG + Intergenic
1046766085 8:118071891-118071913 TCTCCTTTGTAAAATGGGACAGG - Intronic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1046902861 8:119541506-119541528 GCTCACTTATAAAATAGGGATGG - Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047218867 8:122902432-122902454 CCTCAGCTGTACATTGGGGATGG + Intronic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047506538 8:125485081-125485103 CCTTATCTCTAAAGTGGGGAGGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047706037 8:127500569-127500591 CCTCACCTCTAAAATGGAGATGG - Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1047765926 8:127989888-127989910 CCTCATTAGTAAAATAGGGATGG + Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1047873030 8:129106091-129106113 CCTGGCCTGTAAAATGGGGATGG + Intergenic
1047977383 8:130144387-130144409 CCTCATTTATGAAATGGGTTTGG - Intronic
1048070386 8:131014732-131014754 TCTCATATGTTAAATGGGAATGG + Intronic
1048180274 8:132188010-132188032 CTTCATCTCTAAAATGGGAATGG - Intronic
1048234320 8:132675248-132675270 CCTAATCTGTAAAATGGGCGGGG - Intronic
1048291290 8:133183576-133183598 CCTCTTTTATAAAAAGAGGATGG - Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1048509665 8:135050774-135050796 CCTTAGCTGTAAAATGGGGCTGG + Intergenic
1048559785 8:135521624-135521646 CCTCATTTGTAATATGAGGTTGG + Intronic
1048569937 8:135643810-135643832 CCTTATCTGTCAAATGGGTATGG + Intronic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048837815 8:138537962-138537984 CCTCATTTCTTAAATGGGTATGG - Intergenic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049001309 8:139827103-139827125 GCCCATTTCTAAAATGGGGAAGG + Intronic
1049168573 8:141142787-141142809 CCTCTTCTGTAAAATGTAGATGG + Intronic
1049216558 8:141410963-141410985 CCCCATTTGTCAGATGGGGAAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049488637 8:142879444-142879466 CATCCTTTGGAAGATGGGGAAGG - Intronic
1049933604 9:479486-479508 CCACATTTTCCAAATGGGGACGG + Intronic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050565654 9:6879762-6879784 CCTAATTTGTAAAATGTGGTTGG + Intronic
1050728856 9:8684327-8684349 GCTCATTTGTAAAATAGAGATGG - Intronic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1050753590 9:8971630-8971652 CCTCTTTTGTAAAATTTGTATGG + Intronic
1050953174 9:11623236-11623258 CTTCATTTCTAAAATGGAGAGGG + Intergenic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051584016 9:18707569-18707591 TCTCATCTGTAAGATGGGGGTGG - Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1052830007 9:33207380-33207402 CCTCATTTGTCAGATGGTTATGG - Intergenic
1052896559 9:33752378-33752400 CCTCAAATGTAAAATGGGTGAGG + Intronic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1053308307 9:36999601-36999623 CCTCATCCGAAAAATGGGCAAGG + Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054760661 9:69001347-69001369 CCACATTTGAAAAATGTGGGGGG - Intronic
1054784720 9:69199889-69199911 CCCTATTTGTAAAATGGGGATGG + Intronic
1054811900 9:69441709-69441731 CCTCCTTGGGAGAATGGGGAGGG + Intronic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1054830661 9:69621061-69621083 CCTGATCTGTAAAATGGAGTTGG + Intronic
1054881877 9:70152433-70152455 CCTCATCTGTTAAATGGCGCTGG - Intronic
1055071432 9:72170564-72170586 CCTCATTCGTAAAATGGATATGG + Intronic
1055106450 9:72518310-72518332 CCTCATACATAAAATGAGGATGG + Intergenic
1055159863 9:73113236-73113258 CTTCATTTGTAAATTGTTGAAGG + Intergenic
1055356076 9:75438294-75438316 CTTAATTAGTAAAATGGTGATGG - Intergenic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056282407 9:85054389-85054411 CCTCCTTTGTAAAATGGGGTTGG + Intergenic
1056508481 9:87280364-87280386 CCTCATTTGTAAGAAGGGAATGG - Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057180734 9:93028716-93028738 CCTCACCTGTAAAATGGGATGGG - Intronic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057483156 9:95461626-95461648 CCTCATCTGTCAAATGGGACAGG - Intronic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057729792 9:97598417-97598439 CCTCATCCATAAAATGGGAATGG + Intronic
1057744547 9:97741020-97741042 CCTCACTGGTAAAATGAGAAGGG + Intergenic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1057990138 9:99760390-99760412 CTTCATTTGTAAAATCGTGTAGG + Intergenic
1058059434 9:100479142-100479164 CCTGTTGTGTAAAATGTGGATGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058702957 9:107615750-107615772 CCTCATTTGAGCAATGGAGATGG - Intergenic
1058712411 9:107691744-107691766 CCTCATTTATAAAATTGGGTCGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1058907438 9:109493352-109493374 CCCCCTCTGTAAAATGGGGCTGG + Intronic
1059308490 9:113372900-113372922 CCTCATTTGTAAAGTTGTGGAGG + Intergenic
1059338996 9:113586816-113586838 CCTCCTTGGTGAAATGGGTATGG + Intronic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060052309 9:120386155-120386177 TCTCATTTGTAAAATGGGTGAGG + Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060105346 9:120869644-120869666 CCTCAACTGTAAAGTGGAGATGG - Intronic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060157447 9:121329483-121329505 CCTCATCTGTAAACTGGGAGTGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060238445 9:121883251-121883273 TCTCTTCTGTAAAATGGAGATGG + Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060407023 9:123377840-123377862 GGTCATTTGTCAAAGGGGGAAGG + Exonic
1060471984 9:123955792-123955814 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060694725 9:125698695-125698717 CGGCATTTGTAAAATGGGGACGG + Intronic
1060732793 9:126048793-126048815 CCACATCTGTAAAATGCGGCTGG + Intergenic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060926939 9:127461665-127461687 CCTCGTGTGTAAACTGGGGATGG - Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061165372 9:128919297-128919319 TCTCATTTGTAAAATCAGGAAGG + Intergenic
1061226950 9:129285974-129285996 CCTTGTCTATAAAATGGGGATGG - Intergenic
1061551288 9:131336254-131336276 CTTAATGTGTAAAGTGGGGATGG + Intergenic
1061806717 9:133141041-133141063 CCCCATCTGTCAAATGGGCAAGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061894559 9:133640438-133640460 GCCCATCTGTAAAATGGAGATGG + Intronic
1061946361 9:133910447-133910469 CCTCATCTGTCAAATGGGCTTGG - Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062037020 9:134386890-134386912 CCTCATCTTTAAAATGGGAGTGG - Intronic
1062099107 9:134718821-134718843 CTGCATCTGTGAAATGGGGATGG + Intronic
1062164530 9:135100728-135100750 CCTCCTCTGTAAAATGGTGCAGG + Intronic
1203653774 Un_KI270752v1:4085-4107 GCTCATTTGTAATATGGGAGGGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1185943979 X:4353754-4353776 CTTCATCTATAAAGTGGGGATGG + Intergenic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186972005 X:14856771-14856793 CATAATTTTTAAAAGGGGGAAGG + Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187118433 X:16378894-16378916 CCTCATTTGTAAAATATGAACGG + Intergenic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187378431 X:18778551-18778573 CCCAATTTGCAAAATGGGGATGG - Intronic
1187590798 X:20714993-20715015 ACTTATTTGTAAAATAGGGAGGG + Intergenic
1187668290 X:21640577-21640599 CCTCCCTTAGAAAATGGGGAGGG - Intronic
1187769943 X:22683873-22683895 ACTTATTTGTGAAATGGGGATGG + Intergenic
1187951966 X:24479906-24479928 CCTAATTGGTAAAATGGGCATGG - Intronic
1188058920 X:25576632-25576654 CCTTATTTGGCAAAGGGGGAAGG + Intergenic
1188072220 X:25730536-25730558 CTACATTTTTAAAATTGGGATGG - Intergenic
1188128794 X:26404423-26404445 CTTCATTTGTAATATGAGAATGG - Intergenic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189144797 X:38644701-38644723 TCTCATTTGTAAAATTGTGAGGG + Intronic
1189150962 X:38706184-38706206 CCTCATTTACAAAATGGTGAGGG + Intergenic
1189254778 X:39629468-39629490 CCACATCTATAAAATGGGAATGG + Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189300976 X:39952082-39952104 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190309570 X:49107270-49107292 CCTCATATGTAAAATGGACATGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1192094897 X:68200172-68200194 CCTCACTGGTAAAATGGGGGGGG + Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1192549595 X:72043457-72043479 CCTTGTGTGTAAAATGGGGATGG - Intergenic
1193223021 X:78949411-78949433 CCTCTTTTGTAAAATTAGAATGG - Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194444476 X:93971112-93971134 CATCATTTGTAAAATAGAGCAGG - Intergenic
1194697222 X:97068243-97068265 CCTCATTTGTAAAATGACAGTGG + Intronic
1194713745 X:97266606-97266628 TCTAATTTGTAAAGTGGGGTGGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195208887 X:102631641-102631663 CCTTATTTTTAAAATGGCAAAGG + Intergenic
1195282746 X:103352645-103352667 CTACATTTTTAACATGGGGAAGG - Intergenic
1195576614 X:106458855-106458877 ACTCATTTAAATAATGGGGATGG + Intergenic
1195676689 X:107512182-107512204 CCCCATCTGTGAGATGGGGAGGG + Intergenic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196020350 X:110984694-110984716 TGTCATTTTTAAAATGAGGAAGG + Intronic
1196141651 X:112269294-112269316 GCTGATTTGTAAAATGGGAATGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197464564 X:126786558-126786580 TTTCATTTGTTAAATGGGGATGG + Intergenic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197721736 X:129749897-129749919 CCTTATCTGTAAAATGGGATGGG + Intronic
1197721763 X:129750191-129750213 GCACATTTGTAAAATGGGGATGG - Intronic
1197893374 X:131287240-131287262 GTTCATCAGTAAAATGGGGATGG - Intronic
1198030253 X:132747642-132747664 TCCCATTTGTACAAGGGGGAGGG + Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1198551487 X:137749778-137749800 CCTCATCTGAAAAATTGAGAAGG + Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199001014 X:142636254-142636276 CCTCATTTGTGAGAAGAGGAGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199541236 X:148959977-148959999 TCTCTTTTATAAGATGGGGAAGG - Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1199760451 X:150900183-150900205 TCTCATGTGTCAAAGGGGGAGGG + Intergenic
1200059652 X:153478603-153478625 TCTCCTCTGTAAAATGGGGTAGG - Intronic
1200336094 X:155353110-155353132 TTTCATTTGTAAAATGGAGATGG - Intergenic
1200350376 X:155488117-155488139 TTTCATTTGTAAAATGGAGATGG + Intergenic
1200374552 X:155766491-155766513 CCTCATCTATAAAATTGAGATGG - Intergenic