ID: 1184813814

View in Genome Browser
Species Human (GRCh38)
Location 22:46855405-46855427
Sequence CAGTGATACCACCAGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184813810_1184813814 0 Left 1184813810 22:46855382-46855404 CCTTCCTCAGCACCTCATCTGTG No data
Right 1184813814 22:46855405-46855427 CAGTGATACCACCAGGAGTTAGG 0: 1
1: 0
2: 1
3: 7
4: 143
1184813811_1184813814 -4 Left 1184813811 22:46855386-46855408 CCTCAGCACCTCATCTGTGCAGT 0: 1
1: 0
2: 7
3: 24
4: 296
Right 1184813814 22:46855405-46855427 CAGTGATACCACCAGGAGTTAGG 0: 1
1: 0
2: 1
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184813814 Original CRISPR CAGTGATACCACCAGGAGTT AGG Intronic
901664924 1:10820547-10820569 CAGAGACACCTCCAGGGGTTGGG - Intergenic
904091802 1:27950105-27950127 CAGTGCTCACACCAGGATTTGGG - Intronic
905915859 1:41683874-41683896 CAGTGATAGGACCAGGAGGGTGG - Intronic
907239201 1:53071320-53071342 CAGTGATCACAACAGGAGTGTGG - Intronic
907314649 1:53560611-53560633 CAGTGATGCCAACAGGACCTGGG - Intronic
907384019 1:54114137-54114159 CAGTGATACGGCCAGGTGTGAGG - Intergenic
908687595 1:66739516-66739538 CAGTGCTCCCACCAGCAGTCTGG + Exonic
916506984 1:165436878-165436900 CTGAAATCCCACCAGGAGTTTGG - Intronic
916865881 1:168858156-168858178 CACTTATACCACCAGAAATTGGG + Intergenic
924059707 1:240159791-240159813 CATTCATACCACCATGACTTGGG - Intronic
924498837 1:244616688-244616710 AATTGGTCCCACCAGGAGTTTGG - Intronic
1064225782 10:13483607-13483629 ATGTGGTACCTCCAGGAGTTGGG + Intronic
1064288216 10:14011291-14011313 CTTTGATGTCACCAGGAGTTGGG + Intronic
1065804285 10:29380676-29380698 CAGCGTAACCAGCAGGAGTTGGG - Intergenic
1065833213 10:29633365-29633387 AGGGGATACCACCAGCAGTTTGG + Intronic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1067829117 10:49599859-49599881 CTGTGACATCACTAGGAGTTTGG + Intergenic
1067957590 10:50809474-50809496 TCATGATACCACCAAGAGTTAGG - Intronic
1071176697 10:82934595-82934617 TAGTGACACCAACAGGCGTTTGG - Intronic
1071570726 10:86695364-86695386 CAGAGATACCATCAGGAGCCAGG - Intronic
1073083321 10:100873364-100873386 CAGAGATAAGACCAGGACTTCGG + Intergenic
1074951369 10:118340509-118340531 GAGTGATACATCCAGGAGTGAGG - Intronic
1075886535 10:125904369-125904391 CAGTGATGCCATCAGGAACTTGG - Intronic
1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG + Intronic
1083899880 11:65638440-65638462 CAGTGCCGCCACCAGGAGTCAGG - Intronic
1084796503 11:71509362-71509384 CAGTGATTCCAACAGGTGTGAGG - Intronic
1087264304 11:96043894-96043916 CAGAGTTACCACCAGCACTTAGG - Intronic
1090006496 11:123007393-123007415 CAGTGAGACCCCGAGGGGTTAGG - Intergenic
1091611354 12:2012774-2012796 CAGTGAGACCTCTAGTAGTTGGG + Intronic
1092184039 12:6465602-6465624 AAGTGATACCCTGAGGAGTTTGG - Intronic
1097608741 12:61789749-61789771 CAGTGAAACCACCAAGTCTTTGG - Intronic
1103943294 12:124512567-124512589 TGGTGATACCCCCAAGAGTTAGG - Intronic
1105301579 13:19140361-19140383 CAGAGATAACCTCAGGAGTTTGG - Intergenic
1105447446 13:20470027-20470049 CAGTGCGATCACCTGGAGTTGGG + Intronic
1105992338 13:25635061-25635083 CAGTGTCAGCACCATGAGTTAGG + Intronic
1110917797 13:81045329-81045351 CATTGATATCACCAAGAATTGGG - Intergenic
1113343257 13:109447433-109447455 CAGTGATACCACCACCAGGCAGG - Intergenic
1113620105 13:111756488-111756510 CAGAGAGACCCCCAGGAGTGGGG + Intergenic
1114345391 14:21789467-21789489 CAGTGATACGAACAGGAGGCAGG + Intergenic
1115305487 14:31929747-31929769 CAGTGTTACCAGCAGGATTAAGG - Intergenic
1116367813 14:44090188-44090210 CAGTGAAGCCACCAGGTCTTGGG + Intergenic
1116723759 14:48534224-48534246 CAGTGATGGCAGAAGGAGTTGGG + Intergenic
1119323735 14:73746430-73746452 CAGGGATCCCAGCAGGAGTAGGG + Intronic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1202871551 14_GL000225v1_random:169566-169588 CAGTGATGCCATCAGGAACTGGG + Intergenic
1124004915 15:25787877-25787899 CACTGGTACCACCTGCAGTTGGG + Intronic
1126215140 15:46146069-46146091 CAGAGTTGGCACCAGGAGTTGGG - Intergenic
1128246075 15:66133726-66133748 CAGCAATCCCACCAGGGGTTGGG + Intronic
1128754577 15:70172722-70172744 AAATGCTACCAGCAGGAGTTGGG - Intergenic
1129206822 15:74042183-74042205 CAGTGTTCCCACCAGGACCTTGG + Intronic
1134014063 16:10876538-10876560 CCTTGATACCACCAGGAGGATGG + Intergenic
1136418471 16:30117575-30117597 CAGGGATACCACCACGTGTGGGG - Intronic
1137331409 16:47500619-47500641 CAGTGATAAAACCAGAAATTGGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1139198349 16:64947929-64947951 CATTGATACCATCAGGATTCTGG + Exonic
1141193455 16:81841909-81841931 AAGTGAAACCACCAGCAGCTGGG + Intronic
1141490880 16:84371851-84371873 GAGTGCTACCAGCTGGAGTTGGG + Intronic
1142145023 16:88489306-88489328 CAGTGATACCACCAGCTGCACGG - Intronic
1147463901 17:40595541-40595563 GAAGGATAACACCAGGAGTTTGG - Intergenic
1150064533 17:62097946-62097968 CTGTGATAAGACCTGGAGTTGGG - Intergenic
1155680258 18:28478479-28478501 AACTGGTACCACCAGGAGTGGGG + Intergenic
1159648379 18:70947280-70947302 CAGTGAAACCATCAGGTCTTAGG - Intergenic
926057190 2:9780953-9780975 AGGTGATCCCACCTGGAGTTAGG + Intergenic
928897504 2:36282081-36282103 CAGGGATAACACCAAGATTTTGG - Intergenic
930778335 2:55197225-55197247 CAGAGATACCATCAGGAGCCAGG - Intronic
940503429 2:154523392-154523414 CAGTGAAGCCACCAGGCCTTGGG + Intergenic
941232357 2:162926603-162926625 CAGTGAGAGCACCAGTTGTTTGG + Intergenic
941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG + Exonic
945613047 2:212030062-212030084 CAGTGATACCACCTGTAGTCAGG - Intronic
948233110 2:236366152-236366174 CAGTAATACCTCCAGGAGGGTGG + Intronic
948834852 2:240620940-240620962 CAGTGACACCGCCAGGCTTTAGG + Intronic
1172307057 20:33888322-33888344 CTGGGAAACCACCAGGAGCTAGG - Intergenic
1175401993 20:58706311-58706333 CACTGACACCACCAGCAGTGAGG - Intronic
1177033307 21:16010609-16010631 CAGTGATACAACCAGTATCTTGG + Intergenic
1177723150 21:24933528-24933550 CTTTGATATCACCAGGAGATAGG - Intergenic
1178456628 21:32760163-32760185 TAGTGATTCCACCAAGAGATAGG - Intronic
1179435059 21:41356546-41356568 AAGTTAAACCACCATGAGTTGGG + Intronic
1179510728 21:41871482-41871504 GAGTGAGCCCACCAGGAGGTAGG + Exonic
1180010192 21:45044283-45044305 CAGTGAGAACACCAAGAGGTGGG + Intergenic
1184813814 22:46855405-46855427 CAGTGATACCACCAGGAGTTAGG + Intronic
949700003 3:6745705-6745727 CAGTGAAACCACCAGTTGGTGGG + Intergenic
950323885 3:12086250-12086272 CAGTGAAACCATCAGGTCTTGGG - Intronic
952318785 3:32256703-32256725 GAGAGATCCCACCAGGACTTGGG - Intronic
953937170 3:47055750-47055772 CAGTAATCCCACCAGCACTTTGG + Intronic
958740819 3:98068902-98068924 CAATGACACCATCAGGAATTTGG + Intergenic
959981272 3:112520399-112520421 CAGATATAAAACCAGGAGTTTGG + Intergenic
961945125 3:130678764-130678786 CAGTGACAGAACCAGGTGTTAGG - Intergenic
962446712 3:135472428-135472450 CAGAGGTAGCATCAGGAGTTTGG - Intergenic
964046837 3:152338547-152338569 CAGTGGTAGCAGCAGGTGTTGGG + Intronic
964499354 3:157331241-157331263 AAGTGATACCGTCTGGAGTTCGG + Intronic
967789677 3:193533860-193533882 CACTGATACCACAGGGAGTGGGG - Intronic
969412968 4:7042010-7042032 CAGTGGTACCACCAGGAGCTGGG - Exonic
973253504 4:48085469-48085491 CACTGATACCAACAGGAGGCAGG + Intronic
974129123 4:57731085-57731107 CTGTGATGCCACCAGGACATTGG - Intergenic
975108409 4:70595656-70595678 CAGTTATACCACAAGGATTTAGG - Intronic
981199372 4:141962138-141962160 CAGTGATTCCAGCAGGTTTTTGG + Intergenic
983597519 4:169487396-169487418 AAGTGATACCATGAGGTGTTTGG + Intronic
987197431 5:15540884-15540906 AAGTGATACTATCAGGAGATGGG - Intronic
990174446 5:53091548-53091570 TAATGGTACCACCAGGAGGTGGG - Exonic
990214158 5:53512832-53512854 CAGAGATACCATCAGGAGCCAGG + Intergenic
993885373 5:93409608-93409630 CAGTATCACGACCAGGAGTTTGG + Intergenic
995059750 5:107801197-107801219 CTCTGATACCACAAGGATTTGGG - Intergenic
999651011 5:153767569-153767591 TAATTATCCCACCAGGAGTTTGG + Intronic
1002537140 5:179882367-179882389 CAATGCTACCACCAGTCGTTAGG + Intronic
1003879140 6:10464595-10464617 CATTGAAATCACCAGGAATTGGG - Intergenic
1004137605 6:12982769-12982791 AAGTGATAGAAACAGGAGTTTGG - Intronic
1009403690 6:63287434-63287456 CTGTAATACCAGCAGGAGTGAGG + Intronic
1010634352 6:78239543-78239565 CAATGATACAAACAGGAGGTAGG + Intergenic
1014212742 6:118723327-118723349 CTGTGATACAACAAGGACTTAGG - Intergenic
1015312454 6:131780752-131780774 CAGCGAAACCACCAGTAGTGTGG + Intergenic
1015925407 6:138305102-138305124 CAGTGAAACCAACAGGGCTTGGG - Intronic
1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG + Intergenic
1018801016 6:167222250-167222272 GCGTGATACCACCAGGGGTCTGG + Intergenic
1018809118 6:167284921-167284943 GCGTGATACCACCAGGGGTCTGG - Intronic
1024447951 7:49503655-49503677 CAGTGAAACAACCAGTTGTTTGG + Intergenic
1028612590 7:92728893-92728915 CAGTAATTCAACCACGAGTTAGG + Intronic
1029530470 7:101122048-101122070 CAGTGAAATCACCAGGAATCAGG + Intergenic
1030212217 7:107007683-107007705 CAGTGATACTTCCAGCAGTAAGG + Intergenic
1031808232 7:126333525-126333547 TGGTGATGCCATCAGGAGTTAGG - Intergenic
1034368237 7:150570387-150570409 TAGTGAGACCACCAGGAGCTGGG - Intronic
1037568968 8:20142364-20142386 CAGAGCTACCTCCAGGAGTAGGG + Intergenic
1037623125 8:20584485-20584507 CAGAGATGCCACCAGGGGTTGGG + Intergenic
1039421154 8:37442239-37442261 CAGAGGTACCACCAGCAGCTAGG - Intergenic
1041616336 8:59911401-59911423 CAGTGAAACCATCAGGTGCTGGG - Intergenic
1042002565 8:64142128-64142150 CAGTGAAACCATCAGGTCTTGGG - Intergenic
1042285391 8:67104491-67104513 CTGTAATCCCACCATGAGTTTGG - Intronic
1043627285 8:82277459-82277481 CAGTGAAGCCACCAGGTCTTAGG - Intergenic
1045420199 8:102006899-102006921 CAGTGATACCGGCATGACTTGGG + Intronic
1047303309 8:123633612-123633634 CATTGCCACCACCAGGAGTATGG - Intergenic
1048261395 8:132948465-132948487 CAGTGATGCCCCCAGGAAGTTGG + Intronic
1048531355 8:135253250-135253272 CAGTGATACAAACAGGAGACAGG + Intergenic
1050311660 9:4359344-4359366 CAGTGATTCCAAAAGCAGTTTGG - Intergenic
1050438844 9:5638452-5638474 CAGTGAAACCACTAGGTCTTGGG + Intronic
1050949157 9:11566377-11566399 CAGAGATGCCATCAGGAGTTAGG + Intergenic
1053512622 9:38701601-38701623 CCAGGATACCACCAGGAGCTGGG - Intergenic
1055553007 9:77448260-77448282 CAGTCAAACCATCATGAGTTGGG - Intronic
1056809514 9:89753508-89753530 CAGTGGTACCAGCATGCGTTGGG + Intergenic
1058364204 9:104188439-104188461 CAGTGATACCATAGGGTGTTGGG + Intergenic
1060368188 9:123041644-123041666 CAGTGATGCCAGCAGAATTTTGG + Intronic
1061479562 9:130890401-130890423 CAGTGATATCAACTGGAGTGTGG - Intergenic
1203732897 Un_GL000216v2:107033-107055 CAGTGATGCCATCAGGAACTGGG - Intergenic
1186054021 X:5629693-5629715 CAGTCATATCAACAAGAGTTGGG - Intergenic
1189365757 X:40387282-40387304 CAGTGAAATCACCAGGAAATAGG + Intergenic
1190283242 X:48945181-48945203 CGCTGATAACACCAGGACTTAGG - Intronic
1190880918 X:54492134-54492156 CAGTGATCCAACAAGGACTTCGG + Intronic
1192991888 X:76468138-76468160 CAGTTATATACCCAGGAGTTGGG + Intergenic
1193152190 X:78137412-78137434 AAATGATACCATCAGGAATTAGG - Intronic
1193345736 X:80402007-80402029 CAGTGAAACCATCAGCACTTGGG + Intronic
1197324892 X:125080853-125080875 CCGGGATACCTCCAGGAGTGTGG - Intergenic
1198141468 X:133808113-133808135 CAGTGACATCACCATGACTTGGG + Intronic
1202628053 Y:56880637-56880659 CAGTGATGCCATCAGGAACTGGG + Intergenic