ID: 1184818138

View in Genome Browser
Species Human (GRCh38)
Location 22:46887910-46887932
Sequence CAGTGGAAGCTTAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 692}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184818133_1184818138 9 Left 1184818133 22:46887878-46887900 CCTGAGTGTAATTTATAATATGG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG 0: 1
1: 0
2: 1
3: 35
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184818138 Original CRISPR CAGTGGAAGCTTAAGGAGGA TGG Intronic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
902396986 1:16137789-16137811 CAGGTGGGGCTTAAGGAGGACGG - Intronic
903285445 1:22274001-22274023 CATTGGAGGCTTCAAGAGGATGG + Intergenic
903686703 1:25136977-25136999 CACTGGAAGCTCAAGGACCAGGG + Intergenic
903856715 1:26342206-26342228 GAGTGGATGCTCAAGCAGGAAGG - Intronic
904878590 1:33676558-33676580 CATTGGTAGCTTAATGGGGATGG - Intronic
905117147 1:35652117-35652139 AAATGGAAGCTTGAGGAGGAAGG - Intergenic
905725589 1:40248885-40248907 CAGTGGAAACTTAAGGTGACAGG + Intronic
905815741 1:40949410-40949432 CACTAGAAGCTTGAGAAGGAAGG + Intergenic
906375012 1:45289147-45289169 CAGTGGTAGCTTGATGGGGATGG - Intronic
906600525 1:47124490-47124512 CATTGGTAGCTTGATGAGGATGG + Intergenic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907127068 1:52060159-52060181 AAGTGGAAGCTTAACAAGGTTGG - Intronic
907646050 1:56244546-56244568 CAGTGGTAGCTTGATGGGGATGG + Intergenic
907679027 1:56546266-56546288 CAGTGCAAGCTCAATGAGAATGG - Intronic
908049190 1:60209212-60209234 CATTGGTAGCTTAATGGGGATGG - Intergenic
908049811 1:60217010-60217032 CATTGGTAGCTTAATGGGGATGG + Intergenic
908104432 1:60826885-60826907 GAGTGGCAGCTTAATGAGTATGG - Intergenic
908541192 1:65123705-65123727 CATTGGTAGCTTAATGGGGATGG + Intergenic
908576303 1:65463565-65463587 CAGTGGTAGCTTGATGGGGATGG + Intronic
909017342 1:70394119-70394141 CATTAGAGTCTTAAGGAGGAGGG + Intergenic
909249337 1:73331087-73331109 CATTGGTAGCTTAATGCGGATGG + Intergenic
909456701 1:75857808-75857830 CAGTGGTAGCTTGATGGGGATGG + Intronic
909557113 1:76966144-76966166 CATTGGTAGCTTAATGGGGATGG + Intronic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
909807511 1:79890102-79890124 CACTGGTAGCTTAATGGGGATGG + Intergenic
909853628 1:80501250-80501272 CATTGGTAGCTTGATGAGGATGG - Intergenic
910262059 1:85302546-85302568 GAGTGGAGGCCTAAGGAGCAAGG + Intergenic
910384005 1:86662049-86662071 CATTGGTAGCTTGATGAGGATGG - Intergenic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
910954481 1:92686988-92687010 CAGTGGTAGCTTGATGGGGATGG - Intronic
911516780 1:98877140-98877162 CATTGGTAGCTTAATGGGGATGG + Intergenic
912941779 1:114051423-114051445 AAGTGGAATCTCAAGGAGGTAGG + Intergenic
913493112 1:119400868-119400890 CATTGGTAGCTTAATGGGGATGG + Intergenic
914205338 1:145522136-145522158 CAGTGGTAGCTTGATGGGGATGG + Intergenic
914207943 1:145550890-145550912 CAGTGGTAGCTTGATGGGGATGG + Intergenic
914409026 1:147406967-147406989 CATTGGTAGCTTGATGAGGATGG - Intergenic
914484786 1:148098330-148098352 CAGTGGTAGCTTGATGGGGATGG + Intergenic
914679647 1:149930061-149930083 TAGTTGAAGCCTAATGAGGAGGG - Intronic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
915054039 1:153109183-153109205 CATTGGTAGCTTAAAGGGGATGG - Intergenic
915751728 1:158217347-158217369 CATTGGTAGCTTAATGGGGATGG + Intergenic
915891692 1:159779724-159779746 CATTGGAAGCTTAAAGAAGTTGG - Intergenic
916162591 1:161933783-161933805 GAGTGGAAGGTTAAGGGAGATGG - Intronic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
916460285 1:165016912-165016934 CATTGGTAGCTTAATGGGGATGG + Intergenic
916472746 1:165140054-165140076 CAGTGAAAGCTTGAAGAGCAAGG - Intergenic
916647519 1:166800587-166800609 CAGTGGTAGCTTGATGGGGATGG + Intergenic
918592724 1:186258140-186258162 CATTGGTAGCTTAATGGGGATGG + Intergenic
921244126 1:213218469-213218491 CATTGGTAGCTTGATGAGGATGG - Intronic
921440009 1:215174513-215174535 CATTGGTAGCTTGATGAGGATGG + Intronic
921683919 1:218067991-218068013 CAGTGGTTGGTAAAGGAGGAGGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922122989 1:222692383-222692405 GAGTGTAAGCTTCAGGAGGGTGG - Intronic
922393563 1:225172712-225172734 CACTGGTAGCTTGAAGAGGATGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063605384 10:7518824-7518846 CTGTGGAAGCCTGAGGAGGGAGG + Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1064176196 10:13077458-13077480 CATTGGTAGCTTAATGGGGATGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064492467 10:15874062-15874084 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1064794580 10:18997030-18997052 CATTGGTAGCTTGATGAGGATGG - Intergenic
1065077316 10:22093905-22093927 CATTGGTAGCTTAATGGGGATGG - Intergenic
1066168954 10:32820414-32820436 CATTGGTAGCTTAATGGGGATGG - Intronic
1066172840 10:32870137-32870159 CATTGGTAGCTTAATGGGGATGG + Intronic
1066608106 10:37204087-37204109 CATTGGTAGCTTAATGGGGATGG - Intronic
1067149769 10:43721278-43721300 CATTGGTAGCTTGATGAGGATGG - Intergenic
1067194853 10:44108276-44108298 CATTGGTAGCTTGATGAGGATGG + Intergenic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068125984 10:52842450-52842472 CATTGGTAGCTTAATGGGGATGG + Intergenic
1068536593 10:58246252-58246274 CATTGGTAGCTTGATGAGGATGG - Intronic
1068541250 10:58297080-58297102 CATTGGTAGCTTGATGAGGATGG + Intergenic
1069265080 10:66447273-66447295 CATTGGTAGCTTGATGAGGATGG - Intronic
1069348538 10:67498476-67498498 CAGTGGTAGCTTGATGGGGATGG + Intronic
1071379327 10:85042375-85042397 AGGTGGGAGCTAAAGGAGGAGGG + Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071663208 10:87527088-87527110 CATTGGTAGCTTAATGAGGATGG + Intronic
1071806286 10:89124657-89124679 CAGTGAAAGTTTCAGGAAGAAGG + Intergenic
1071900387 10:90114618-90114640 CATTGGTAGCTTGATGAGGATGG + Intergenic
1072407177 10:95166400-95166422 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1072408227 10:95174788-95174810 CATTGGTAGCTTAATGGGGATGG + Intergenic
1072527857 10:96289883-96289905 GAGTGGGGGCTTAAGGGGGAGGG - Intergenic
1073046863 10:100644556-100644578 CAGTGGCAGATTAAGGATGAGGG + Intergenic
1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG + Intronic
1073997863 10:109336921-109336943 CATTGGAAGCTTGATGGGGATGG + Intergenic
1074372538 10:112911821-112911843 CAGTGGAGAGTTATGGAGGAAGG - Intergenic
1074814118 10:117132024-117132046 CAGTGGGAAATTAAGGAGGAGGG + Intronic
1075172034 10:120124651-120124673 CAGTTCAAACTTAAGGAGAAGGG + Intergenic
1075174966 10:120151118-120151140 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1075216777 10:120543247-120543269 CAATGCCAGCTTGAGGAGGAAGG - Intronic
1076574849 10:131457760-131457782 CAGTGGAAGATGAAAGTGGATGG + Intergenic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1077710945 11:4536334-4536356 CAGTGGTAGCTTCATGGGGATGG - Intergenic
1077986405 11:7355562-7355584 CAGTAGAAGCTTATGGAAGAAGG - Intronic
1078034559 11:7789643-7789665 CATTGGTAGCTTAATGGGGATGG - Intergenic
1078242395 11:9541878-9541900 CATTGGTAGCTTAATGGGGATGG + Intergenic
1078722091 11:13894501-13894523 CATTGGTAGCTTGATGAGGATGG + Intergenic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1079625147 11:22608179-22608201 CATTGGTAGCTTGATGAGGATGG - Intergenic
1079824097 11:25168574-25168596 CATTGGTAGCTTGATGAGGATGG + Intergenic
1080077923 11:28174088-28174110 CAGTGCATACTTAAGGAGTAGGG + Intronic
1080117905 11:28641157-28641179 CATTGGTAGCTTGATGAGGATGG - Intergenic
1080374710 11:31694704-31694726 CATTGGTAGCTTAATGGGGATGG + Intronic
1080468724 11:32524625-32524647 CATTGGTAGCTTGATGAGGATGG + Intergenic
1080519734 11:33057542-33057564 CAGAGAAAGCTTTAGGTGGAGGG + Intronic
1080661455 11:34299622-34299644 CACTGAAACCTTCAGGAGGACGG + Intronic
1081151214 11:39635088-39635110 CATTGGTAGCTTGATGAGGATGG - Intergenic
1081169664 11:39851103-39851125 CATTGGTAGCTTGATGAGGATGG - Intergenic
1081174042 11:39903713-39903735 CAATAGAAGCTTAAAGATGAAGG + Intergenic
1082141368 11:48613298-48613320 CATTGGTAGCTTGATGAGGATGG + Intergenic
1082226457 11:49713423-49713445 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1082227892 11:49729753-49729775 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1082231761 11:49776664-49776686 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1082292108 11:50388448-50388470 CACTGGTAGCTTGATGAGGATGG - Intergenic
1082568519 11:54710113-54710135 CATTGGTAGCTTGATGAGGATGG + Intergenic
1082578879 11:54842445-54842467 CATTGGTAGCTTGATGAGGATGG - Intergenic
1082618697 11:55394807-55394829 CATTGGTAGCTTGATGAGGATGG + Intergenic
1083002094 11:59301871-59301893 CACTTGCAGATTAAGGAGGAAGG - Intergenic
1083012980 11:59421857-59421879 TAGTGAAATCTTAAGCAGGAGGG + Intergenic
1083690367 11:64404663-64404685 CAATGAGAGCTTCAGGAGGAGGG + Intergenic
1083909371 11:65697071-65697093 CCATGGAAGCTAAAGGGGGATGG - Intergenic
1084443960 11:69192647-69192669 CCGTGGAAGCTTCCGGAGGCTGG + Intergenic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084992853 11:72944999-72945021 CATTGGTAGCTTGATGAGGATGG - Intronic
1085794722 11:79528559-79528581 GAGTGGAAGCTGGTGGAGGAAGG - Intergenic
1086298814 11:85401939-85401961 CAGTGGTAGCTTGATGGGGATGG - Intronic
1086456466 11:86963624-86963646 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1086516518 11:87619694-87619716 CATTGGTAGCTTGAGGGGGATGG + Intergenic
1086531879 11:87796018-87796040 CATTGGTAGCTTGATGAGGATGG + Intergenic
1086580672 11:88394643-88394665 CATTGGTAGCTTGATGAGGATGG + Intergenic
1086612463 11:88773994-88774016 CATTGGAAGCTTGATGGGGATGG + Intronic
1086870502 11:92031342-92031364 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1087131801 11:94675155-94675177 CAGTGGAGGCCCAAGGGGGAGGG - Intergenic
1087243827 11:95810796-95810818 CAGTGGTAGCTTGATGGGGATGG - Intronic
1088302898 11:108378080-108378102 CATTGGTAGCTTGATGAGGATGG - Intronic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1090114520 11:123954239-123954261 CAGTGGTAGTTTAATGAGAATGG - Intergenic
1090265116 11:125348767-125348789 CAAAGGAAGCTCAACGAGGAGGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1092301592 12:7255703-7255725 CATTGGTAGCTTGAGGAGGATGG - Intergenic
1092604851 12:10107460-10107482 CATTGGTAGCTTAATGGGGATGG - Intronic
1092828500 12:12420587-12420609 CATTGGTAGCTTAATGGGGATGG + Intronic
1093777269 12:23090493-23090515 CATTGGTAGCTTGATGAGGATGG + Intergenic
1094273699 12:28645491-28645513 AAGAGGATGCTTCAGGAGGAAGG - Intergenic
1095137726 12:38626383-38626405 CATTGGTAGCTTGATGAGGATGG + Intergenic
1095337160 12:41042598-41042620 CATTGGTAGCTTGAGGGGGATGG - Intronic
1095798889 12:46250941-46250963 CATTGGTAGCTTGATGAGGATGG - Intronic
1095911532 12:47431364-47431386 CATTGGTAGCTTGAGGGGGATGG - Intergenic
1097365319 12:58705877-58705899 CATTGGGAGCTTAATGGGGATGG + Intronic
1097544246 12:60978940-60978962 CTGCGGAAGCTCGAGGAGGATGG - Intergenic
1097749980 12:63341462-63341484 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1098109106 12:67102817-67102839 CATTGGATGTTTAGGGAGGAGGG - Intergenic
1099025879 12:77463856-77463878 CATTGGTAGCTTAATGAGGATGG - Intergenic
1099313564 12:81057876-81057898 CATTGGTAGCTTAATGGGGATGG + Intronic
1099512058 12:83550655-83550677 CATTGGTAGCTTGATGAGGATGG + Intergenic
1099575287 12:84371795-84371817 CATTGGTAGCTTGATGAGGATGG + Intergenic
1100895868 12:99181944-99181966 TAGTGGGAGGATAAGGAGGAAGG - Intronic
1101384398 12:104243572-104243594 CAGTTCAAGCTCAAGGAGTATGG - Intronic
1101840007 12:108321227-108321249 GAGTGCAAACTTAGGGAGGAGGG + Intronic
1103175698 12:118861439-118861461 CAGTGAAAGTTTGAGGAGAAGGG + Intergenic
1104636517 12:130440868-130440890 CAGTGGAGGCTTCCGGAGGTGGG + Intronic
1105241181 13:18610544-18610566 CACAGGCAGCTTGAGGAGGATGG + Intergenic
1105925993 13:25008822-25008844 CACTGGTAGCTTGATGAGGATGG + Intergenic
1106738507 13:32612924-32612946 CAGTGGATGCCTAAGGTTGAGGG - Intronic
1107183356 13:37487718-37487740 AAGTGGAAGATGAAGGAGAAAGG + Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1107904700 13:45051290-45051312 CGGTTGAGGCTTAAGGAGAAGGG - Intergenic
1108465946 13:50715463-50715485 CGGTGGCAGCTAAAGGAGAAAGG + Intronic
1108811007 13:54223473-54223495 CATTGGTAGCTTGATGAGGATGG - Intergenic
1109267878 13:60221622-60221644 CAATAGAAGGGTAAGGAGGACGG - Intergenic
1110001907 13:70213323-70213345 CATTGGTAGCTTAATGGGGATGG - Intergenic
1110022871 13:70498069-70498091 CATTGGTAGCTTAATGGGGATGG - Intergenic
1110258115 13:73454526-73454548 CATTGGTAGCTTGATGAGGATGG + Intergenic
1111299047 13:86322555-86322577 CATTGGTAGCTTGATGAGGATGG + Intergenic
1112182642 13:97099628-97099650 CATTGGTAGTTTAATGAGGATGG + Intergenic
1112327780 13:98454760-98454782 CAGTGGGAGCTTCAGGAGCAGGG + Intronic
1113405960 13:110040611-110040633 CATTGGTAGCTTGATGAGGATGG - Intergenic
1113590674 13:111497646-111497668 CATTGGTAGCTTGATGAGGATGG + Intergenic
1114044104 14:18706710-18706732 CATTGGTAGCTTGATGAGGATGG - Intergenic
1114246067 14:20915175-20915197 CATTGGCAGCTTGATGAGGATGG - Intergenic
1114757520 14:25276575-25276597 CAGAGGAAGCTTAGGCAGGAAGG + Intergenic
1115000475 14:28415495-28415517 CATTGGTAGCTTAATGGGGATGG - Intergenic
1115289734 14:31756242-31756264 CATTGGTAGCTTGATGAGGATGG + Intronic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1116439455 14:44935703-44935725 CAGTGGATACTTCTGGAGGAAGG + Intronic
1117389223 14:55247325-55247347 CACTGGAAGCTCAAGGTAGAAGG - Intergenic
1117508940 14:56429439-56429461 CTGGGGAAGCTTAAGGAGTTTGG + Intergenic
1117797993 14:59414045-59414067 CATTGGTAGCTTAATGGGGATGG - Intergenic
1117811895 14:59556064-59556086 CACTGGTAGCTTAATGGGGATGG - Intronic
1118120166 14:62830932-62830954 CCTTGGAAGCTTAGCGAGGAAGG - Intronic
1118465610 14:66027977-66027999 CATTGGTAGCTTGATGAGGATGG + Intergenic
1118519011 14:66560282-66560304 CATTGGTAGCTTAATGGGGATGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118931201 14:70242664-70242686 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1119041018 14:71274635-71274657 AAATTGAAGCTAAAGGAGGAGGG - Intergenic
1119930163 14:78538155-78538177 CATTGGTAGCTTAATGGGGATGG + Intronic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121597548 14:95177048-95177070 CATTGGTAGCTTAATGGGGATGG + Intergenic
1123490174 15:20774603-20774625 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123546675 15:21343690-21343712 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1124791114 15:32728084-32728106 CAGTGGTAGCTTGATGGGGATGG - Intronic
1125207731 15:37173778-37173800 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1125227605 15:37412740-37412762 CAGTGGTAGCTTAATGGGGATGG - Intergenic
1125232764 15:37475619-37475641 CATTGGTAGCTTAATGGGGATGG - Intergenic
1125454005 15:39839084-39839106 CATTGGTAGCTTGATGAGGATGG - Intronic
1125774136 15:42195769-42195791 CATTGGTAGCTTGATGAGGATGG - Intronic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126305046 15:47246344-47246366 CAGTGGGAGCTAAAGCATGAGGG + Intronic
1126657731 15:50998010-50998032 AAGTAGAAGATTAAGGAGTAAGG + Intronic
1127223363 15:56904116-56904138 CATTGGTAGCTTGATGAGGATGG - Intronic
1127355762 15:58197996-58198018 CATTGGAAGCTTGATGGGGATGG - Intronic
1128927536 15:71672027-71672049 CATTGGTAGCTTAATGGGGATGG + Intronic
1129463452 15:75711363-75711385 CAGTTGAAGCCCAAGGAGGTGGG + Intronic
1129613087 15:77075789-77075811 CTGTGGAAGGTTTAGTAGGAGGG - Intronic
1129721435 15:77880039-77880061 CAGTTGAAGCCCAAGGAGGTGGG - Intergenic
1129967155 15:79746632-79746654 CATTGGTAGCTTGATGAGGATGG + Intergenic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130701250 15:86184734-86184756 CATTGGTAGCTTGATGAGGATGG - Intronic
1130800547 15:87258306-87258328 CATTGGTAGCTTAATGGGGATGG + Intergenic
1130822943 15:87514354-87514376 CATTGGTAGCTTGATGAGGATGG - Intergenic
1132078977 15:98848440-98848462 TAGTGGATGCTTGCGGAGGATGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1202955006 15_KI270727v1_random:70905-70927 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135053258 16:19209535-19209557 CACTGGGGGCTTATGGAGGAAGG + Intronic
1135397479 16:22142191-22142213 CAGTGGGAGATTCAGGGGGAGGG + Intronic
1137046511 16:35668352-35668374 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1139183508 16:64775185-64775207 CATTGGTAGCTTAATGGGGATGG - Intergenic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140992218 16:80224281-80224303 CATTGGAAGCTTGATGGGGATGG - Intergenic
1141778148 16:86138177-86138199 CAGTGGAAGCCCAAGGAGTAGGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1144364725 17:14531665-14531687 CATTGGTAGCTTAATGGGGATGG + Intergenic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1146298106 17:31666457-31666479 CATTGGAAGCTTGATGGGGATGG + Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147886415 17:43687487-43687509 CAGTGGAACCTTATGGAAAAAGG - Intergenic
1149291331 17:55220487-55220509 CAGTGGAAAAGTAAAGAGGAAGG - Intergenic
1149514151 17:57267315-57267337 AGGTGTCAGCTTAAGGAGGAGGG + Intronic
1150004222 17:61459889-61459911 CAGTGGTTGCTGAAGGAGGGGGG - Intronic
1151353460 17:73545128-73545150 AAGTGGAGGCTCAAGGAAGAAGG + Intronic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1154444440 18:14423366-14423388 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1154447777 18:14449357-14449379 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1154478320 18:14789933-14789955 CATTGGTAGCTTAATGGGGATGG + Intronic
1155624844 18:27822450-27822472 CATTGGTAGCTTGATGAGGATGG + Intergenic
1155794857 18:30023390-30023412 CATTGGTAGCTTGATGAGGATGG + Intergenic
1156532180 18:37828307-37828329 CATTGGTAGCTTAATGGGGATGG + Intergenic
1156543478 18:37940479-37940501 CATTGGTAGCTTGATGAGGATGG - Intergenic
1157123021 18:44929477-44929499 CATTGGTAGCTTGATGAGGATGG + Intronic
1157127670 18:44972418-44972440 CATTGGTAGCTTGAGGAGGATGG + Intronic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1158074806 18:53515898-53515920 CATTGGTAGCTTGATGAGGATGG - Intronic
1158560614 18:58510427-58510449 CATTGGTAGCTTGATGAGGACGG + Intronic
1158909967 18:62050242-62050264 CATTGGTAGCTTAATGGGGATGG + Intronic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1160284974 18:77533687-77533709 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1162364206 19:10238122-10238144 CAGTGGAGGCCCAGGGAGGATGG - Intergenic
1163248357 19:16111277-16111299 CAGTGGGGGCCTAGGGAGGAAGG - Intergenic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163670609 19:18625960-18625982 ACTTGGAAGGTTAAGGAGGAAGG + Intergenic
1163941135 19:20495050-20495072 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1164326685 19:24199319-24199341 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1164347294 19:27282098-27282120 CATTGGTAGCTTGAGGGGGATGG + Intergenic
1164349485 19:27318505-27318527 CATTGGTAGCTTGATGAGGATGG + Intergenic
1164393102 19:27842649-27842671 CAGTGCAAGAATAAGTAGGAAGG + Intergenic
1165260938 19:34617227-34617249 CATTGGTAGCTTGATGAGGATGG + Intronic
1165332653 19:35149723-35149745 GAGTGGAAGGTCCAGGAGGAGGG - Intronic
1165563197 19:36699464-36699486 CAGTGGTAGCTTGATGGGGATGG + Intronic
1166076316 19:40415635-40415657 AAATGGAAGATTGAGGAGGAGGG + Intergenic
1166182103 19:41116384-41116406 TGGTGGAAGGATAAGGAGGAGGG + Intronic
1166678936 19:44756041-44756063 CAGTGGTGGCTAAAGCAGGATGG + Intronic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925220641 2:2137288-2137310 CATTGGTAGCTTGATGAGGATGG - Intronic
925546037 2:5017726-5017748 CAGTGGAATCCTAAGAGGGAAGG + Intergenic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
926265788 2:11319146-11319168 CAGTGGTAGCTTGATGGGGATGG + Intronic
927151803 2:20200531-20200553 CAGTGGAGCCTTAAGGAACAAGG + Intergenic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
929284277 2:40117809-40117831 CACTGGAAGTTTACGGAGGAAGG - Intronic
930267253 2:49214361-49214383 CATTGGTAGCTTAATGGGGATGG - Intergenic
930444571 2:51453509-51453531 CAGTGGAGACTCAATGAGGAAGG - Intergenic
930569637 2:53069308-53069330 CATTGGTAGCTTAATGGGGATGG - Intergenic
931594921 2:63931113-63931135 CAGTGGTAGCTTGATGGGGATGG - Intronic
931750349 2:65324693-65324715 CAAGGGAAGCTCAAGGAGGGAGG + Intronic
932379237 2:71267052-71267074 CATTGGTAGCTTGATGAGGATGG + Intergenic
932727019 2:74188332-74188354 CAGTGGAAGTGTGAGGAGGGTGG - Intergenic
932992084 2:76800051-76800073 CATTGGTAGCTTGAGGGGGATGG - Intronic
933116426 2:78478801-78478823 CATTGGTAGCTTAATGGGGATGG - Intergenic
933202333 2:79465524-79465546 CATTGGAAGCTTGATGGGGATGG + Intronic
933696819 2:85225319-85225341 CAGTGGTAGCTTGATGGGGATGG + Intronic
933980979 2:87550520-87550542 CAGTTCAAGCTTCAGGAGAAGGG - Intergenic
935492344 2:103735772-103735794 CAGTGGAAGCTGCTGGAGGCAGG + Intergenic
936312852 2:111400265-111400287 CAGTTCAAGCTTCAGGAGAAGGG + Intergenic
936664936 2:114583853-114583875 CAGTGGAACATCAATGAGGAGGG - Intronic
936911027 2:117593937-117593959 CATTGGTAGCTTAATGGGGATGG + Intergenic
937735626 2:125284598-125284620 CACTGGCAGCTTGAGGGGGAAGG - Intergenic
937784365 2:125877901-125877923 CATTGGTAGCTTGATGAGGATGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938597307 2:132801100-132801122 CAGTGGAAGGATAAAGAGCATGG - Intronic
938767254 2:134468672-134468694 CGCTGGAAACTTAGGGAGGAGGG - Intronic
939030685 2:137072149-137072171 CATTGGTAGCTTGATGAGGATGG + Intronic
939947369 2:148426250-148426272 CATTGGTAGCTTAATGGGGATGG - Intronic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
940824914 2:158400157-158400179 CAGTGGTAGCTTGATGGGGATGG - Intronic
940990512 2:160091887-160091909 CAGTGGGAAAATAAGGAGGAAGG - Intergenic
940993229 2:160119114-160119136 CATTGGTAGCTTGAGGGGGATGG - Intronic
941552715 2:166936955-166936977 TATTGGTAGCTTAATGAGGATGG + Intronic
941658985 2:168175096-168175118 CTGTGGAATCCTCAGGAGGAAGG - Intronic
942036009 2:172011250-172011272 TAGTGGTTGCTTAAGGATGAGGG - Intronic
942733931 2:179088929-179088951 CATTGGTAGCTTAATGGGGATGG + Intergenic
942905977 2:181181225-181181247 CATTGGTAGCTTGATGAGGATGG + Intergenic
943273873 2:185843272-185843294 CATTGGTAGCTTGATGAGGATGG + Intergenic
943323982 2:186476209-186476231 CATTGGTAGCTTGATGAGGATGG - Intergenic
943548083 2:189306235-189306257 CAGTGGGTGATTAAGGACGATGG - Intergenic
944018998 2:195078254-195078276 CAGTGGTAGCTTGATGGGGATGG - Intergenic
944601124 2:201304530-201304552 CATTGGTAGCTTAATGGGGATGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
947283501 2:228482736-228482758 CAGTGGTAGCTTGATGGGGATGG + Intergenic
947293787 2:228607468-228607490 CAGTGGTAGCTTGATGGGGATGG - Intergenic
947337344 2:229101080-229101102 CAATGGAAACTTGGGGAGGATGG + Intronic
948023416 2:234756246-234756268 CATTGGTAGCTTGATGAGGATGG + Intergenic
1169101168 20:2950970-2950992 CAATGGTTGCTTAAGGATGAGGG - Intronic
1169190432 20:3655563-3655585 CACTGGAAGCTGGAGGAGGTAGG - Intergenic
1169817319 20:9671316-9671338 CATTGGTAGCTTGATGAGGATGG + Intronic
1169967401 20:11232831-11232853 CAGTGGAAACTGACAGAGGATGG + Intergenic
1170228957 20:14023942-14023964 CAGTGGTAGCTTGATGGGGATGG + Intronic
1170752437 20:19163180-19163202 CATTGGAAGCTTGATGGGGATGG + Intergenic
1171057513 20:21921486-21921508 CCGTCAAAGCTTAAGGAGAACGG + Intergenic
1172385700 20:34532604-34532626 CAGTTGAAGCTTCCTGAGGATGG - Intronic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1174908424 20:54577812-54577834 GAGTTGAAGCTCAAGGAGGGAGG + Intronic
1176612773 21:9000668-9000690 CATTGGTAGCTTAATGGGGATGG - Intergenic
1177111880 21:17038693-17038715 CATTGGTAGCTTGATGAGGATGG - Intergenic
1177116725 21:17094969-17094991 CATTGGTAGCTTGATGAGGATGG - Intergenic
1177138461 21:17331950-17331972 CATTGGTAGCTTGAGGGGGATGG - Intergenic
1177143267 21:17380502-17380524 CATTGGTAGCTTGAGGGGGATGG - Intergenic
1177143478 21:17382592-17382614 CATTGGTAGCTTGAGGGGGATGG - Intergenic
1177196569 21:17909625-17909647 CATTGGTAGCTTGATGAGGATGG + Intronic
1178116421 21:29422191-29422213 CATTGGTAGCTTAATGGGGATGG - Intronic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180317918 22:11292854-11292876 CATTGGAAGCTTGATGTGGATGG - Intergenic
1180466926 22:15619828-15619850 CATTGGTAGCTTGATGAGGATGG - Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181353398 22:22278334-22278356 CATTGGTAGCTTGAGGGGGATGG + Intergenic
1181750107 22:24983318-24983340 CACTGGAAGCTGAAGAAGAAAGG - Intronic
1181999248 22:26906777-26906799 CAGTTAAAGCTTATGGAAGAAGG + Intergenic
1182790148 22:32945140-32945162 CATTGGTAGCTTAATGGGGATGG - Intronic
1183738252 22:39655715-39655737 AAGTGGGAGCCCAAGGAGGAGGG - Intronic
1184336070 22:43853956-43853978 CAATGGGACCTTAAGGATGAGGG + Intronic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184930919 22:47680786-47680808 CTGAGAAAGCTTAAAGAGGAGGG + Intergenic
1185035671 22:48475374-48475396 CAGTGGAAGCTTCTGGAGCCAGG - Intergenic
1203236439 22_KI270732v1_random:6317-6339 CATTGGTAGCTTGAGGGGGATGG - Intergenic
949593403 3:5517290-5517312 CATTGGTAGCTTAATGGGGATGG + Intergenic
949912738 3:8926507-8926529 CATTGGTAGCTTAATGGGGATGG - Intronic
950431124 3:12951812-12951834 CAGTGGAAACCTAGGGAGGGTGG + Intronic
950593673 3:13958759-13958781 CATTGGTAGCTTAATGGGGATGG + Intronic
950718740 3:14867733-14867755 CAGTGGAAGACAAATGAGGATGG - Intronic
950930102 3:16780436-16780458 CATTGGTAGCTTGATGAGGATGG - Intergenic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951413690 3:22396806-22396828 CACTGGTAGCTTAACGGGGATGG + Intergenic
951646713 3:24899870-24899892 CAGTGAAAAATTTAGGAGGAAGG + Intergenic
951986131 3:28623181-28623203 CATTGGTAGCTTAATGGGGATGG - Intergenic
952133136 3:30387231-30387253 CAGTGGTAGCTTGATGGGGATGG + Intergenic
952266656 3:31793504-31793526 CTGTGTAGGTTTAAGGAGGATGG + Intronic
953554805 3:43935977-43935999 CAGTGGTAGCTTGATGGGGATGG + Intergenic
953756261 3:45648259-45648281 CAGTGGTTGCTTAGGGATGAGGG - Intronic
953788543 3:45929271-45929293 CCCTGGAAGCTAGAGGAGGAAGG + Intronic
954125932 3:48528865-48528887 TAGTGGTAGCTTAAGGCAGAAGG + Intronic
954489465 3:50888459-50888481 CATTGGTAGCTTGATGAGGATGG - Intronic
954500381 3:51008166-51008188 CATTGGTAGCTTGATGAGGATGG + Intronic
954525433 3:51266277-51266299 CAGTGGTAGCTTGATGGGGATGG - Intronic
955556898 3:60147915-60147937 CAGTGGAAAATCAAGGTGGAAGG + Intronic
956025343 3:64977315-64977337 CTGTGGAAGCTTAAGCTGGCAGG + Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956657967 3:71570443-71570465 GAGTGGAGGCTGAAAGAGGATGG - Intronic
957735970 3:84202788-84202810 CATTGGTAGCTTGATGAGGATGG + Intergenic
957815705 3:85294388-85294410 CATTGGTAGCTTGATGAGGATGG - Intronic
957917466 3:86704839-86704861 CATTGGTAGCTTGATGAGGATGG + Intergenic
957992836 3:87649423-87649445 CAGTGGTAGCTTGATGGGGATGG + Intergenic
958473636 3:94553040-94553062 CAGTGGTAGCTTGATGGGGATGG - Intergenic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
958618918 3:96531606-96531628 CAGTGGTAGCTTGATGGGGATGG - Intergenic
959795421 3:110422186-110422208 CAGTGGAAGTTTTGGGAGGTGGG + Intergenic
959812886 3:110639662-110639684 AAGTGGATGCTTAATGAGTATGG - Intergenic
960508494 3:118521351-118521373 CATTGGAAGCTTGATGAGGATGG - Intergenic
960643606 3:119853463-119853485 CATTGGTAGCTTGATGAGGATGG + Intronic
960911753 3:122656247-122656269 CATTGGTAGCTTAATGGGGATGG - Intergenic
962190704 3:133307902-133307924 CATTGGTAGCTTGATGAGGATGG + Intronic
962762096 3:138523823-138523845 CAGTGGTAGCTTGATGGGGATGG - Intronic
963488487 3:145967824-145967846 CAGAGGAAGCTTTAGGAGTTAGG - Intergenic
963576348 3:147065398-147065420 CATTGGTAGCTTAATGGGGATGG - Intergenic
963578593 3:147095771-147095793 CATTGGTAGCTTAATGGGGATGG - Intergenic
963580940 3:147125743-147125765 CATTGGTAGCTTAATGGGGATGG + Intergenic
963910923 3:150817606-150817628 CATTGGTAGCTTAATGGGGATGG + Intergenic
964033482 3:152167305-152167327 CATTGGTAGCTTAATGGGGATGG - Intergenic
964315414 3:155438901-155438923 CATTGGTAGCTTGATGAGGATGG - Intronic
964695865 3:159507009-159507031 CATTGGTAGCTTGATGAGGATGG + Intronic
964779898 3:160325229-160325251 CATTGGTAGCTTAATGGGGATGG - Intronic
964876490 3:161373107-161373129 CAGAGGAAGCTAAAGGTAGATGG + Intergenic
965085102 3:164085176-164085198 CATTGGTAGCTTAATGGGGATGG + Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
967115320 3:186332373-186332395 CAGTGGAAATTTAAGGAAGCAGG + Intronic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
968078691 3:195831791-195831813 CACTGGAAGCTGAAGATGGAGGG + Intergenic
968408364 4:362920-362942 CATTGGTAGCTTGATGAGGATGG + Intronic
968486129 4:863424-863446 CAGTGGCAGGTTTGGGAGGACGG + Intronic
969079028 4:4603870-4603892 CAGTGGATGCTTATGCAAGAAGG - Intergenic
970652668 4:18195807-18195829 GAGAGGAAGCTACAGGAGGATGG - Intergenic
970654976 4:18220858-18220880 CAGTGGTAGCTTGATGGGGATGG + Intergenic
970678299 4:18477473-18477495 CAGTGGAAGCTGAAGCAGCTGGG + Intergenic
970684271 4:18548457-18548479 CATTGGTAGCTTGATGAGGATGG + Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971437662 4:26645103-26645125 CAGTGGTAGCTTGATGGGGATGG - Intronic
971438228 4:26651258-26651280 CAGTGGTAGCTTGATGGGGATGG + Intronic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
972244501 4:37230453-37230475 CAGAGCAAGCTTAATGAGGACGG - Intergenic
972317417 4:37940065-37940087 CATTGGTAGCTTAATGGGGATGG + Intronic
972686017 4:41354056-41354078 CATTGGTAGCTTAATGGGGATGG - Intergenic
973013477 4:45106793-45106815 CATTGGTAGCTTAATGAGGATGG + Intergenic
973112087 4:46409249-46409271 CAGTGGTAGCTTGATGAGGATGG - Intronic
973183741 4:47298687-47298709 CATTGGTAGCTTAATGGGGATGG - Intronic
973347696 4:49074073-49074095 CATTGGTAGCTTTAGGGGGATGG + Intergenic
973599405 4:52526787-52526809 CATTGGTAGCTTGATGAGGATGG - Intergenic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
973870950 4:55165814-55165836 CAGTGGAAGCTTGATGGGGATGG + Intergenic
974315220 4:60270570-60270592 CAGTGGTAGCTTGATGGGGATGG + Intergenic
974398291 4:61368771-61368793 CATTGGTAGCTTGAGGGGGATGG + Intronic
974577115 4:63739838-63739860 CATTGGTAGCTTAATGGGGATGG + Intergenic
974591106 4:63949618-63949640 CATTGGTAGCTTGATGAGGATGG + Intergenic
974705317 4:65507409-65507431 CATTGGTAGCTTAATGGGGATGG + Intronic
974719215 4:65715406-65715428 CATTGGTAGCTTAATGGGGATGG - Intergenic
974723112 4:65767687-65767709 CATTGGTAGCTTAATGGGGATGG + Intergenic
974898517 4:67968957-67968979 CATTGGTAGCTTAATGGGGATGG + Intergenic
975039232 4:69724470-69724492 CATTGGTAGCTTAATGGGGATGG - Exonic
975058157 4:69962182-69962204 CATTGGTAGCTTAATGGGGATGG - Intergenic
975529126 4:75382705-75382727 CATTGGTAGCTTGATGAGGATGG - Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
976905576 4:90232071-90232093 CAGTGGTAGCTTGATGGGGATGG - Intronic
976910307 4:90297035-90297057 CAGTGGTAGCTTGATGGGGATGG + Intronic
976924557 4:90480920-90480942 CAGTGGTAGCTTGATGGGGATGG + Intronic
976991925 4:91378292-91378314 CAGTGGTAGCTTGATGTGGATGG + Intronic
977108269 4:92917893-92917915 CATTGGTAGCTTAATGGGGATGG + Intronic
977109887 4:92940108-92940130 CATTGGTAGCTTAATGGGGATGG + Intronic
977164775 4:93681377-93681399 CATTGGTAGCTTGATGAGGATGG - Intronic
977216108 4:94285736-94285758 CTGTGGAAGCTTGGGGAGGTGGG + Intronic
977264402 4:94837302-94837324 CATTGGTAGCTTGATGAGGATGG + Intronic
977333665 4:95668303-95668325 CATTGGTAGCTTGATGAGGATGG - Intergenic
977391044 4:96410739-96410761 CATTGGTAGCTTGATGAGGATGG + Intergenic
977680568 4:99794193-99794215 CATTGGTAGCTTGATGAGGATGG + Intergenic
977748103 4:100575889-100575911 CAGTGGAAAGTTAAAGATGAGGG + Intronic
977927445 4:102717320-102717342 CAGTGAGAGGTTGAGGAGGATGG + Intronic
978039379 4:104040545-104040567 CATTGGTAGCTTGATGAGGATGG - Intergenic
978059739 4:104323026-104323048 CATTGGTAGCTTGATGAGGATGG + Intergenic
978068912 4:104441606-104441628 CATTGGTAGCTTGATGAGGATGG - Intergenic
978864378 4:113490684-113490706 CATTGGTAGCTTCATGAGGATGG + Intronic
979175450 4:117657027-117657049 CATTGGTAGCTTAATGGGGATGG + Intergenic
979199874 4:117964523-117964545 AAATGGAAGCTGAAGGATGAGGG - Intergenic
979272444 4:118778644-118778666 CATTGGTAGCTTGACGAGGATGG + Intronic
979599375 4:122570720-122570742 CACTGGAAGCTTGATGGGGATGG + Intergenic
981054598 4:140347433-140347455 GAGTGGAAGCATAGGAAGGAAGG - Intronic
981124903 4:141094374-141094396 CAGTGGAAGCTGAAAGACAATGG + Intronic
981165633 4:141553890-141553912 CATTGGTAGCTTAATGGGGATGG - Intergenic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
982313185 4:154006361-154006383 CAGTGCCAGGCTAAGGAGGATGG + Intergenic
982638160 4:157923187-157923209 CATTGGTAGCTTCATGAGGATGG + Intergenic
983791305 4:171800800-171800822 CAGTGGTAGCTTGATGGGGATGG + Intergenic
984217870 4:176936558-176936580 CATTGGTAGCTTGATGAGGATGG + Intergenic
984605505 4:181781164-181781186 CATTGGTAGCTTAATGAGGATGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985067076 4:186133074-186133096 CAGTGAATGCCTAGGGAGGAGGG - Intronic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
986654264 5:9995305-9995327 CATTGGCAGCTTAATGGGGATGG - Intergenic
987606169 5:20138913-20138935 CATTGGTAGCTTGATGAGGATGG - Intronic
988251149 5:28759582-28759604 CATTGGTAGCTTGATGAGGATGG - Intergenic
988794714 5:34642225-34642247 CATTGGTAGCTTGATGAGGATGG + Intergenic
989210434 5:38853926-38853948 CTGTGGAGCCTTGAGGAGGAAGG + Intronic
989337925 5:40340484-40340506 CAGTGGTAGCTTGATGGGGATGG - Intergenic
989508454 5:42255780-42255802 CATTGGTAGCTTGATGAGGATGG + Intergenic
989824217 5:45834384-45834406 CATTGGTAGCTTGATGAGGATGG + Intergenic
989828011 5:45882773-45882795 CATTGGTAGCTTGATGAGGATGG + Intergenic
990133205 5:52612918-52612940 CATTGGTAGCTTGATGAGGATGG - Intergenic
990369301 5:55101114-55101136 CATTGGAAGCTTGATGGGGATGG - Intergenic
990664135 5:58052808-58052830 CATTGGTAGCTTGATGAGGATGG + Intergenic
990916522 5:60912134-60912156 CATTGGTAGCTTAATGGGGATGG + Intronic
991179587 5:63734244-63734266 CATTGGTAGCTTGATGAGGATGG + Intergenic
991363889 5:65848426-65848448 CAGTGGTAGCTTGATGGGGATGG + Intronic
992037558 5:72795445-72795467 CAATGGAATCTGAAGGAGAAGGG - Intergenic
992811438 5:80392673-80392695 CAGTGGTAGCTTGATGGGGATGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
993576774 5:89611773-89611795 CATTGGTAGCTTAATGGGGATGG + Intergenic
993842191 5:92893426-92893448 CATTGGTAGCTTGATGAGGATGG + Intergenic
994033174 5:95168438-95168460 CATTGGTAGCTTAATGGGGATGG + Intronic
994477288 5:100287556-100287578 CATTGGTAGCTTGATGAGGATGG + Intergenic
994625038 5:102208004-102208026 CATTGGTAGCTTAATGGGGATGG - Intergenic
994630234 5:102276225-102276247 AAGTGGATGCTAAAGAAGGAGGG - Intronic
994835747 5:104850032-104850054 CAGTGGTAGCTTGATGGGGATGG + Intergenic
995823588 5:116267547-116267569 CAGTGGTAGCTTGATGGGGATGG - Intronic
996012298 5:118494485-118494507 CATTGGTAGCTTGATGAGGATGG - Intergenic
996012648 5:118498310-118498332 CATTGGTAGCTTAATGGGGATGG + Intergenic
996090482 5:119346243-119346265 CAGTGGAAGCTGCTGGAGGCTGG + Intronic
996213133 5:120836017-120836039 CATTGGTAGCTTGAGGGGGATGG - Intergenic
996629853 5:125617572-125617594 CATTGGTAGCTTAATGGGGATGG + Intergenic
996965077 5:129298410-129298432 CATTGGTAGCTTGATGAGGATGG + Intergenic
997539585 5:134650645-134650667 CTTTGGAAGGTTAAGGAGGCAGG - Intronic
998006783 5:138662316-138662338 CAGGGGGAGATTATGGAGGAAGG + Intronic
998694472 5:144623738-144623760 CAGTGTAATATTAAGGAGAAAGG + Intergenic
999106696 5:149077765-149077787 CATTGGTAGCTTGATGAGGATGG - Intergenic
999966096 5:156811055-156811077 CATTGGTAGCTTAATGGGGATGG - Intergenic
1001080600 5:168664695-168664717 CAGTGGAAGCTCCTGGGGGAAGG + Intronic
1002335110 5:178472046-178472068 CTGTGGGAGCTCAAGGAGGGAGG + Intronic
1002936971 6:1682353-1682375 CAGTGGAGGCCTGAGGAGGCGGG - Intronic
1003225337 6:4200057-4200079 CATTGGTAGCTTGATGAGGATGG + Intergenic
1004318817 6:14616167-14616189 CACTGGAAGCTTGAAGAGGCAGG - Intergenic
1004844341 6:19622970-19622992 CATTGGTAGCTTGATGAGGATGG - Intergenic
1005411482 6:25552605-25552627 AACTGGAAGCTTAACCAGGAAGG + Intronic
1006027566 6:31157384-31157406 CCATAGAAACTTAAGGAGGAGGG - Exonic
1006218717 6:32469141-32469163 CATTGGTAGCTTGATGAGGATGG + Intergenic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1006278033 6:33021953-33021975 CAGTGGAAACTTATTGAGTAAGG - Intergenic
1006572119 6:35014421-35014443 GAATGGAAACTTACGGAGGAAGG - Intronic
1006999877 6:38300401-38300423 CATTGGAAGCTTGATGGGGATGG + Intronic
1008086421 6:47249550-47249572 AAGTTGAAGCTCCAGGAGGAAGG + Intronic
1008414969 6:51228936-51228958 CATTGGTAGCTTGATGAGGATGG - Intergenic
1008452395 6:51668088-51668110 CATTGGTAGCTTGATGAGGATGG + Intronic
1008825576 6:55689123-55689145 CATTGGTAGCTTAATGGGGATGG - Intergenic
1009239317 6:61164506-61164528 CATTGGTAGCTTGATGAGGATGG + Intergenic
1009370752 6:62898652-62898674 CTGTGGAAACTTAAGTAAGAAGG + Intergenic
1009381002 6:63029598-63029620 CATTGGTAGCTTAATGGGGATGG + Intergenic
1009662794 6:66635419-66635441 CATTGGTAGCTTGATGAGGATGG - Intergenic
1009664068 6:66653392-66653414 CATTGGTAGCTTGAGGGGGATGG + Intergenic
1009741088 6:67747079-67747101 CATTGGTAGCTTAATGGGGATGG + Intergenic
1010171407 6:72980219-72980241 CACTGGTAGCTTAATGGGGATGG + Intronic
1010737393 6:79458386-79458408 CATTGGTAGCTTGATGAGGATGG + Intergenic
1010974957 6:82301723-82301745 CATTGGTAGCTTGATGAGGATGG - Intergenic
1011012634 6:82719302-82719324 CATTGGTAGCTTGATGAGGATGG - Intergenic
1011539082 6:88410971-88410993 CATTGGTAGCTTGATGAGGATGG - Intergenic
1011755220 6:90491917-90491939 AAGTCTAAGTTTAAGGAGGAAGG - Intergenic
1012032424 6:94088571-94088593 AAGTGGAATCTTAAGAAAGATGG + Intergenic
1012102120 6:95103474-95103496 CAGTAGAACCTTAAGGCTGAGGG - Intergenic
1012288956 6:97427014-97427036 CAGAGGGAGCTTAGAGAGGAGGG + Intergenic
1012834289 6:104245790-104245812 CATTGGTAGCTTAATGGGGATGG - Intergenic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1014217771 6:118768964-118768986 CAGTGGAAACTTTCAGAGGAAGG + Intergenic
1014424696 6:121289597-121289619 CATTGGTAGCTTAATGGGGATGG - Intronic
1014679282 6:124408739-124408761 CATTGGTAGCTTAATGGGGATGG + Intronic
1014765432 6:125400680-125400702 CATTGGTAGCTTAATGGGGATGG - Intergenic
1014910173 6:127082958-127082980 CAATGGCAGCTTGAGGTGGAAGG + Intergenic
1014967321 6:127771362-127771384 CATTGGTAGCTTAATGGGGATGG - Intronic
1016009332 6:139122602-139122624 CATTGGTAGCTTGAGGGGGATGG + Intergenic
1016142874 6:140634544-140634566 AAGTGGAAGACTAAGGTGGAAGG - Intergenic
1016258354 6:142137038-142137060 CATTGGTAGCTTAATGGGGATGG + Intergenic
1016422156 6:143896713-143896735 AAATGGAAGCTTAAGGAGGTTGG + Intronic
1016655217 6:146511012-146511034 CATTGGTAGCTTAATGGGGATGG + Intergenic
1016834987 6:148467971-148467993 CATTGGAAGATTCAGCAGGATGG + Intronic
1016875437 6:148860037-148860059 CATTGGTAGCTTAATGGGGATGG + Intronic
1017538196 6:155371259-155371281 CACAGGAAGGGTAAGGAGGAAGG - Intergenic
1017713120 6:157187398-157187420 CAGTGGAAGATAAATGAGAAAGG + Intronic
1018527100 6:164724639-164724661 CATTGGTAGCTTGATGAGGATGG + Intergenic
1020787691 7:12591147-12591169 CAGTGGAAGAATGAGTAGGAAGG + Intronic
1021671705 7:23041167-23041189 CATTGGTAGCTTGATGAGGATGG - Intergenic
1021701672 7:23325521-23325543 CATTGGTAGCTTGATGAGGATGG - Intronic
1021766212 7:23951759-23951781 CATTGGTAGCTTGATGAGGATGG - Intergenic
1022187687 7:27986562-27986584 CATTGGTAGCTTGATGAGGATGG - Intronic
1022594318 7:31697419-31697441 CCGTGGAAGCCTTGGGAGGAGGG - Intronic
1022631176 7:32086453-32086475 CATTGGTAGCTTGATGAGGATGG - Intronic
1023146634 7:37157753-37157775 CATTGGTAGCTTAATGGGGATGG - Intronic
1023193914 7:37613597-37613619 CATTGGTAGCTTGATGAGGATGG + Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023990301 7:45124646-45124668 CAGGGGAAGCTCAGGGAGAAAGG + Intergenic
1024202617 7:47122125-47122147 CAGTGGAAGTTTAATGTGGCTGG + Intergenic
1024738514 7:52331336-52331358 CATTGGTAGCTTGATGAGGATGG - Intergenic
1025214091 7:57040988-57041010 CATTGGTAGCTTAATGGGGATGG - Intergenic
1025570173 7:62552484-62552506 CATTGGTAGCTTAATGGGGATGG - Intergenic
1025651187 7:63470947-63470969 CATTGGTAGCTTAATGGGGATGG - Intergenic
1025657863 7:63535825-63535847 CATTGGTAGCTTAATGGGGATGG + Intergenic
1026589794 7:71684768-71684790 CTCTGGAAGCTGAAGCAGGAGGG - Intronic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1027810578 7:82892025-82892047 CATTGGAAGCTTAATGGGGATGG - Intronic
1028051887 7:86198100-86198122 CATTGGTAGCTTGATGAGGATGG + Intergenic
1028643373 7:93069037-93069059 CATTGGTAGCTTGATGAGGATGG + Intergenic
1030166021 7:106556045-106556067 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1030893276 7:115026638-115026660 CATTGGTAGCTTGATGAGGATGG + Intergenic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031590870 7:123590841-123590863 CAGTGGTAGCTTGATGGGGAGGG + Intronic
1031851551 7:126870444-126870466 AAGATGAAGCTTAATGAGGAAGG - Intronic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1032857728 7:135849588-135849610 CATTGGTAGCTTGATGAGGATGG + Intergenic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033887944 7:145971149-145971171 CATTGGTAGCTTGACGAGGATGG - Intergenic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034314916 7:150121681-150121703 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1034791982 7:153979086-153979108 CAGTGGTAGCTTGATGGGGATGG + Intronic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037028837 8:14075257-14075279 CAATGGCAGCTTAATGGGGATGG + Intergenic
1037590817 8:20310618-20310640 GAGTGGGAGATTAAGGAGGGTGG - Intergenic
1037835131 8:22211148-22211170 CAGTGGACTCTTAGGGAAGACGG - Intronic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1038840824 8:31183310-31183332 CTGTCGGAGCTTCAGGAGGAGGG - Intergenic
1040608142 8:48955443-48955465 CATTGGTAGCTTGAGGGGGACGG + Intergenic
1040651281 8:49451560-49451582 CATTGGTAGCTTAATGGGGATGG - Intergenic
1041051230 8:53936698-53936720 CAGTGGTAGCTTGATGGGGACGG - Intronic
1041143399 8:54845885-54845907 CAGTAGATGTTTCAGGAGGAAGG - Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041446759 8:57960750-57960772 CATTGGTAGCTTGATGAGGATGG - Intergenic
1041518523 8:58729245-58729267 CATTGGTAGCTTGATGAGGATGG - Intergenic
1041559033 8:59193444-59193466 CAGTGCAAGCTTGAGGGTGATGG - Intergenic
1041619644 8:59951907-59951929 CATTGGTAGCTTGATGAGGATGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1042014365 8:64290948-64290970 CATTGGTAGCTTGATGAGGATGG + Intergenic
1042348906 8:67756324-67756346 CATTGGTAGCTTGAGGGGGATGG - Intergenic
1042732696 8:71954859-71954881 CTGAGGAAGCTAAAGCAGGAGGG - Intronic
1043095134 8:75959216-75959238 CTTTGGGAGCTTAAGGTGGATGG + Intergenic
1043499118 8:80835945-80835967 CAGTGGTGGCTTAACCAGGATGG - Intronic
1043604740 8:81986621-81986643 CATTGGTAGCTTGATGAGGATGG + Intergenic
1043819368 8:84843566-84843588 CATTGGTAGCTTGATGAGGATGG - Intronic
1044102609 8:88159208-88159230 CATTGGTAGCTTGAGGGGGATGG + Intronic
1044798542 8:95929430-95929452 CAGTGGTAGCTTAACACGGATGG + Intergenic
1044878251 8:96694895-96694917 CATTGGTAGCTTGATGAGGATGG + Intronic
1045111406 8:98941440-98941462 CAGTGGAAGGCTGAGGAGAAGGG + Intronic
1045694653 8:104794829-104794851 CAGTGGAAGGTTAATGATAAAGG - Intronic
1046022425 8:108681115-108681137 CATTGGTAGCTTAATGGGGATGG - Intronic
1046197896 8:110886857-110886879 CTCTGGAAGCTTGAGGAGCAAGG - Intergenic
1046329420 8:112696173-112696195 CATTGGTAGCTTGATGAGGATGG - Intronic
1046459040 8:114508485-114508507 CATTGGTAGCTTTATGAGGATGG - Intergenic
1047578137 8:126181228-126181250 CAGTGGAAGCTAAAGAAAGCAGG + Intergenic
1047604525 8:126461851-126461873 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1047840755 8:128749071-128749093 CATTGGTAGCTTGATGAGGATGG - Intergenic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1048412622 8:134191131-134191153 CATTGGTAGCTTAATGGGGATGG + Intergenic
1048726952 8:137396973-137396995 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1050521943 9:6510035-6510057 CAGTGTAAGCTCAAGGTGAACGG - Intergenic
1050837169 9:10097280-10097302 CATTGGTAGCTTGATGAGGATGG + Intronic
1051232917 9:14971565-14971587 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1051338420 9:16088809-16088831 CAATGGTAGCTTGATGAGGATGG - Intergenic
1051379926 9:16446339-16446361 AAGTGGAAGTTTGAGGAGCATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051790555 9:20797359-20797381 CATTGGTAGCTTGATGAGGATGG + Intronic
1051960662 9:22759064-22759086 CATTGGTAGCTTAATGGGGATGG + Intergenic
1052408355 9:28091163-28091185 CATTGGAAGCTTGATGGGGATGG - Intronic
1052479842 9:29009629-29009651 CATTGGTAGCTTAATGGGGATGG - Intergenic
1052697759 9:31899950-31899972 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1055614650 9:78058811-78058833 CATTGGTAGCTTGATGAGGATGG - Intergenic
1056398742 9:86206379-86206401 CATTGGTAGCTTAATGGGGATGG - Intergenic
1056425896 9:86476435-86476457 CATTGGTAGCTTGATGAGGATGG + Intergenic
1056460537 9:86805784-86805806 TGGTGGAAGCTTCAGGAGAAGGG - Intergenic
1057844535 9:98512854-98512876 CATTGGTAGCTTGATGAGGATGG - Intronic
1058310227 9:103491514-103491536 CATTGGTAGCTTAATGGGGATGG - Intergenic
1058494818 9:105544969-105544991 CAGTGGTAGCTTGATGGGGATGG + Intronic
1058557269 9:106183162-106183184 CATTGGTAGCTTAATGGGGATGG + Intergenic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1058944768 9:109846107-109846129 CATTGGAAGAATGAGGAGGAAGG + Intronic
1058962135 9:110001556-110001578 CATTGGTAGCTTGAGGGGGATGG + Intronic
1059048795 9:110900244-110900266 CAGTGGAAGCTTCTGGAAGCTGG - Intronic
1059467957 9:114481293-114481315 CAGTGGAGGGATAACGAGGATGG + Intronic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1059807646 9:117820984-117821006 CACTGGAAGCTGAGGGAGCAAGG + Intergenic
1060051802 9:120383390-120383412 CAGTGGCAGCTTGAGGCGGGTGG - Intergenic
1060323681 9:122591686-122591708 CATTGGTAGCTTAATGGGGATGG + Intergenic
1061273805 9:129558294-129558316 CAGTGGAGGCTGGAGCAGGATGG - Intergenic
1061423308 9:130483886-130483908 AAGTGGAGGAGTAAGGAGGAAGG - Intronic
1203366147 Un_KI270442v1:258614-258636 CATTGGAAGCTTGATGGGGATGG - Intergenic
1203371167 Un_KI270442v1:306570-306592 CATTGGTAGCTTGAGGGGGATGG - Intergenic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186805183 X:13133862-13133884 CATTGGTAGCTTGAGGGGGATGG + Intergenic
1186864005 X:13701204-13701226 CAGTGGCAGGTAAAGGAGGAGGG - Intronic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187365625 X:18663727-18663749 TGGTGGAAGCTAAAGGAAGATGG - Intronic
1188088912 X:25938270-25938292 CATTGGTAGCTTAATGGGGATGG - Intergenic
1188227088 X:27612992-27613014 CATTGGTAGCTTGATGAGGATGG + Intronic
1188592805 X:31859887-31859909 CAATGGAAGTTAAATGAGGAAGG - Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189584800 X:42447929-42447951 CATTGGTAGCTTGATGAGGATGG - Intergenic
1191170330 X:57440143-57440165 CATTGGTAGCTTAATGGGGATGG + Intronic
1191185881 X:57611372-57611394 CATTGGTAGCTTAATGGGGATGG + Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191681328 X:63843226-63843248 CATTGGTAGCTTGATGAGGATGG - Intergenic
1191709396 X:64133421-64133443 CATTGGTAGCTTAATGGGGATGG + Intergenic
1192258244 X:69484366-69484388 CAGTGGTAGCTTGATGGGGATGG + Intergenic
1192396298 X:70784925-70784947 CATTGGTAGCTTAATGGGGATGG - Intronic
1192877935 X:75251661-75251683 CATTGGTAGCTTAATGGGGATGG - Intergenic
1192976567 X:76292455-76292477 CATTGGTAGCTTCATGAGGATGG - Intergenic
1193223975 X:78959985-78960007 CAATGCAGGCTTAAGGAGGCAGG + Intronic
1193953490 X:87828709-87828731 CATTGGTAGCTTGATGAGGATGG - Intergenic
1194231749 X:91333097-91333119 CATTGGTAGCTTGATGAGGATGG + Intergenic
1195288204 X:103405823-103405845 AACTGGAAGCCTAAGGAGAAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196472835 X:116048448-116048470 CATTGGTAGCTTGATGAGGATGG + Intergenic
1196901348 X:120386607-120386629 CATTGGAAGCTTGATGGGGATGG + Intergenic
1197408770 X:126089515-126089537 CAGTTGAAGTTTGAGTAGGATGG + Intergenic
1197497501 X:127203139-127203161 CATTGGTAGCTTGATGAGGATGG - Intergenic
1197730257 X:129803790-129803812 CATAGGAAGCTTGAGGAAGAAGG + Exonic
1198484783 X:137076265-137076287 CATTGGTAGCTTGATGAGGATGG + Intergenic
1198489711 X:137126984-137127006 CATTGGTAGCTTGATGAGGATGG - Intergenic
1198490370 X:137134060-137134082 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1198572764 X:137975566-137975588 CAGTGGTAGCTTGATGGGGATGG - Intergenic
1198622596 X:138530840-138530862 CATTGGTAGCTTGATGAGGATGG + Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199670831 X:150146857-150146879 CAGTGGATGCTTATGAGGGATGG - Intergenic
1200215368 X:154365900-154365922 CAGTAGAAGCTCAAAGAGTAGGG + Intronic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1200842192 Y:7793854-7793876 GAGAGGAAGCTCAAGGAGAATGG + Intergenic
1201259009 Y:12139446-12139468 CATTGGTAGCTTGATGAGGATGG - Intergenic
1201353867 Y:13076345-13076367 CATTGGTAGCTTAATGAGGATGG - Intergenic
1201413678 Y:13726532-13726554 CATTGGTAGCTTGATGAGGATGG - Intergenic
1201432155 Y:13913848-13913870 CATTGGTAGCTTAATGGGGATGG - Intergenic
1201704107 Y:16916640-16916662 CATTGGTAGCTTGATGAGGATGG - Intergenic
1201915457 Y:19177092-19177114 CACTGGAAGCTTGATGGGGATGG - Intergenic
1202013952 Y:20380296-20380318 CATTGGTAGCTTGATGAGGATGG + Intergenic
1202577575 Y:26344127-26344149 CATTGGTAGCTTAATGGGGATGG - Intergenic