ID: 1184823855

View in Genome Browser
Species Human (GRCh38)
Location 22:46933648-46933670
Sequence GCTGCCGGCCAGTGCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184823855_1184823860 21 Left 1184823855 22:46933648-46933670 CCAGGGTGGCACTGGCCGGCAGC 0: 1
1: 0
2: 2
3: 20
4: 218
Right 1184823860 22:46933692-46933714 TTCTCTCTCTGCACTGCCCGGGG No data
1184823855_1184823861 24 Left 1184823855 22:46933648-46933670 CCAGGGTGGCACTGGCCGGCAGC 0: 1
1: 0
2: 2
3: 20
4: 218
Right 1184823861 22:46933695-46933717 TCTCTCTGCACTGCCCGGGGCGG 0: 1
1: 0
2: 0
3: 37
4: 539
1184823855_1184823862 25 Left 1184823855 22:46933648-46933670 CCAGGGTGGCACTGGCCGGCAGC 0: 1
1: 0
2: 2
3: 20
4: 218
Right 1184823862 22:46933696-46933718 CTCTCTGCACTGCCCGGGGCGGG No data
1184823855_1184823858 19 Left 1184823855 22:46933648-46933670 CCAGGGTGGCACTGGCCGGCAGC 0: 1
1: 0
2: 2
3: 20
4: 218
Right 1184823858 22:46933690-46933712 TGTTCTCTCTCTGCACTGCCCGG 0: 1
1: 0
2: 3
3: 33
4: 305
1184823855_1184823859 20 Left 1184823855 22:46933648-46933670 CCAGGGTGGCACTGGCCGGCAGC 0: 1
1: 0
2: 2
3: 20
4: 218
Right 1184823859 22:46933691-46933713 GTTCTCTCTCTGCACTGCCCGGG 0: 1
1: 1
2: 2
3: 42
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184823855 Original CRISPR GCTGCCGGCCAGTGCCACCC TGG (reversed) Intronic
900126685 1:1071871-1071893 GCTGCCTGCCCCTGCCCCCCCGG - Exonic
900715228 1:4139857-4139879 GCTGCCTGCCAGCGCCAGCGGGG - Intergenic
900791087 1:4681397-4681419 GCTGCCAGCCACACCCACCCTGG + Intronic
901022248 1:6261269-6261291 GCGGCCGGCCCGAGCCTCCCTGG + Intergenic
902531083 1:17091147-17091169 GCTGCTGGCCACTGCCATCCTGG + Intronic
902622340 1:17657829-17657851 GAGCCCGGCCTGTGCCACCCTGG + Intronic
902649822 1:17829834-17829856 GCTGCCTGCCAGGGGCAGCCAGG + Intergenic
904840618 1:33369766-33369788 GCTGCATGCTACTGCCACCCAGG + Intronic
905824295 1:41017248-41017270 GCTGTCTGCCAGCGCCATCCAGG - Exonic
905917740 1:41697551-41697573 CCTGCCAGCCAGTCCCACCTTGG - Intronic
906508020 1:46394389-46394411 GCAGCAGGCCAGGGCGACCCCGG - Exonic
907865042 1:58391210-58391232 GCTGCCGGCCAGCAGCAGCCAGG + Intronic
912561645 1:110555588-110555610 GCGGCCGCCCACTGGCACCCGGG - Intergenic
915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG + Intronic
915357059 1:155261759-155261781 GCTGGCACCCAGTGCCACCTAGG + Intronic
915526594 1:156479951-156479973 CCTGCCTGCCAGTCCCACCAAGG + Intronic
915846309 1:159269309-159269331 GCATCAGGCCAGTGCCACTCTGG + Intergenic
919807018 1:201386262-201386284 ACTGCCGGCCAGTCCCACCCAGG - Intronic
922703489 1:227776086-227776108 GCTGCCTGCCTGAGTCACCCAGG + Intronic
922729123 1:227940882-227940904 GGGGCGGCCCAGTGCCACCCAGG + Intronic
922985169 1:229860676-229860698 GCTGCTGGCCACAGCCTCCCAGG + Intergenic
1063189651 10:3681447-3681469 TCTGCAGGCCACCGCCACCCAGG + Intergenic
1067057448 10:43060607-43060629 GCTGCCTGCCAGTGTCACTCTGG + Intergenic
1067090436 10:43263650-43263672 GCTGCCGGCCTGTGCTGCCCAGG - Intronic
1067832190 10:49616672-49616694 GCTGGGGGCCAGTCCCACTCAGG - Intronic
1068395493 10:56456546-56456568 ACTGCTGGCCACTGCCACTCAGG + Intergenic
1071573898 10:86712152-86712174 GCTGCCGGGCCGGGCCACCGAGG + Intronic
1073012286 10:100370860-100370882 GCTCCCTGCCACTGCCACCCAGG - Intergenic
1074858406 10:117490731-117490753 GCTTCCTGGCAGTGCCACCCAGG + Intergenic
1076064828 10:127440814-127440836 GCCTCCAGCCAGTGCCCCCCTGG - Intronic
1076195215 10:128512936-128512958 GCCTCCCGCCAGTGCCACCTGGG - Intergenic
1076805876 10:132858494-132858516 GCTGCCAGCCACTCCCACCCTGG - Intronic
1076957072 10:133748428-133748450 GCAGCCGCCCAGTGCCAGCACGG + Intergenic
1077506241 11:2931145-2931167 GCTGCCGGACAGTGGGACCTGGG + Intergenic
1077630596 11:3808677-3808699 GCTGCCGGGCAGCCCCACTCGGG + Intronic
1078527366 11:12110912-12110934 GAGGCCGGCCAGGGCCGCCCCGG - Intronic
1079276332 11:19040717-19040739 GCATCAGGCCAGTGCCCCCCTGG + Intergenic
1079365705 11:19807534-19807556 GCTGCAGGCCAATCCCAGCCTGG + Intronic
1081835400 11:46149461-46149483 GCTGACCGCTAGTGGCACCCTGG + Intergenic
1081870198 11:46379827-46379849 GCTGCCGGGGAGTGTCGCCCTGG - Exonic
1083299423 11:61732571-61732593 CCTGCCTGCCAGTGATACCCTGG - Intronic
1083994851 11:66266813-66266835 GCTGCCAGTCTGTGCCTCCCTGG - Intronic
1084562734 11:69913617-69913639 GCTCCTGGCAAGTGCCCCCCAGG - Intergenic
1086399101 11:86446365-86446387 GATGACTCCCAGTGCCACCCCGG + Exonic
1087628329 11:100621874-100621896 GGTGCAGGGCAGTGGCACCCTGG + Intergenic
1089457301 11:118633129-118633151 CCTAACTGCCAGTGCCACCCAGG + Intronic
1090105862 11:123853320-123853342 GGTGCTGCCCAGTGCCACCTAGG + Intergenic
1091918960 12:4289309-4289331 GCTGCCGGGCAGAGGCAGCCTGG - Intronic
1096904089 12:54917157-54917179 GCTGCCGGCCTCGGCCTCCCGGG - Intergenic
1098868071 12:75784756-75784778 GTTACCAGCCAGTGCCATCCAGG + Intergenic
1099941385 12:89193195-89193217 GCAGCCAGCCAGTGCTGCCCAGG + Intergenic
1102101497 12:110281700-110281722 GCCGCGGGCTCGTGCCACCCCGG - Exonic
1102346979 12:112166826-112166848 GCTGTTGCCCAGTGCCCCCCTGG - Intronic
1102561288 12:113764054-113764076 GCTGCCAGCCTGTGCCTCCAAGG - Intergenic
1103980878 12:124736265-124736287 CTTGCCCGCCAGGGCCACCCGGG + Intergenic
1106413101 13:29524627-29524649 GCCGCCAGCCAGTCCTACCCCGG + Intronic
1109194217 13:59360251-59360273 GCTGCCAGGCAGGGCCACACAGG + Intergenic
1113930653 13:113967262-113967284 GCTGCCTGGCAGGGCCAGCCTGG - Intergenic
1114452696 14:22837397-22837419 GCTGAAGGCCTGGGCCACCCGGG - Intronic
1117183569 14:53217490-53217512 GCTGCCTGCCAGTCCCGCGCAGG + Intergenic
1120332559 14:83112192-83112214 GCTGCCGCACAGAGCCACACAGG - Intergenic
1122337649 14:101004471-101004493 GCTGCCTGGCAGAGCCTCCCCGG + Intergenic
1124645957 15:31437680-31437702 GCTGCTGGCCAGGGCGAGCCAGG + Intergenic
1126996752 15:54452908-54452930 GCTGCTGGCTACTGCCACCTGGG - Intronic
1129726899 15:77906048-77906070 GCAGGCTGGCAGTGCCACCCAGG + Intergenic
1130115643 15:81002245-81002267 GCGGCATGCCAGTGCCCCCCGGG + Exonic
1131047482 15:89325478-89325500 GCTGCCGACAGGTACCACCCTGG - Exonic
1132487292 16:200854-200876 GCTGTCAGCCAGGGTCACCCAGG - Intronic
1132610483 16:813579-813601 GATGCCGGCCAGCGTCCCCCGGG - Exonic
1132656666 16:1044398-1044420 GCTTCTGGGCAGTGCCGCCCGGG - Intergenic
1132768956 16:1550505-1550527 GATGCTGGCCAGTGCCAGGCAGG + Intronic
1132809861 16:1792349-1792371 GCGGGGGCCCAGTGCCACCCAGG + Exonic
1135207464 16:20495051-20495073 TCAGAAGGCCAGTGCCACCCAGG + Intergenic
1135211421 16:20528581-20528603 TCAGAAGGCCAGTGCCACCCAGG - Intergenic
1136153106 16:28365015-28365037 GCTGCGGGCCTGGGCCACCCGGG - Intergenic
1137576880 16:49605760-49605782 GCTGCCTGCCAGTGACAACGGGG - Intronic
1140470017 16:75208663-75208685 CCTGCCAGCCAGTGCCCACCAGG + Intergenic
1141042481 16:80684160-80684182 TCAGCGGGCCAGTGCCTCCCAGG - Intronic
1141676070 16:85518090-85518112 ACAGCCGGCCAGCGCCAGCCAGG + Intergenic
1141847138 16:86618528-86618550 GCTGAAGGGCAGTGCCACCCAGG - Intergenic
1142066743 16:88067306-88067328 GCCCCCAGCCAGTGTCACCCAGG + Intronic
1142428062 16:90011280-90011302 GCTGCCAGCTAGTGCCACGGGGG - Intronic
1143516239 17:7420579-7420601 CCTGCCGGCCAGGGCCTACCTGG + Intronic
1143711875 17:8741277-8741299 GCTGCTCCCCAGTGCCCCCCAGG + Intronic
1144775997 17:17784900-17784922 GCAGCCCCCCAGTCCCACCCAGG + Intronic
1146167286 17:30600319-30600341 CCTGACGGCCGGTGCCAGCCCGG + Intergenic
1146465683 17:33084380-33084402 CCTGCCAGCCAGTCCCTCCCTGG + Intronic
1152067821 17:78121238-78121260 GCTACCTGCCAGTTCCACCCCGG - Intronic
1152117561 17:78397970-78397992 ACAGCCAGCCCGTGCCACCCTGG - Intronic
1158025248 18:52888224-52888246 GCTGCAGGCCATTAACACCCTGG + Intronic
1160236362 18:77089212-77089234 CCTGCCAGCCAGGGCCACACAGG - Intronic
1160795239 19:942331-942353 GCTGCCCGGCGGTGGCACCCAGG + Intronic
1161076999 19:2290630-2290652 GCTGCCGGCCTGCGCCACCCCGG - Exonic
1161103524 19:2432785-2432807 GCTGCCGGCCAATGCGAGGCAGG - Intronic
1161103835 19:2433728-2433750 GCTGCCGGCCAATGCGAGGCAGG - Intronic
1161767737 19:6216417-6216439 GCTGCCGGCAAGACCAACCCGGG - Exonic
1162341824 19:10095987-10096009 GCTGCCCGCCCGCGCCTCCCGGG + Exonic
1162489857 19:10985671-10985693 GCAGCAGCCCCGTGCCACCCAGG + Intronic
1163652988 19:18529702-18529724 GCTGCCTGCCACAGCCACCCAGG - Intergenic
1165070012 19:33249546-33249568 GCTGGGGCCCGGTGCCACCCGGG + Intergenic
1165104822 19:33462515-33462537 GCAGCGAGCCAGTGGCACCCGGG - Intronic
1165742841 19:38213801-38213823 CCTGCCGGTCAGTGCCCACCAGG - Intronic
1165916469 19:39264165-39264187 GCTGCCGGCCACTGTCCCCTGGG - Intergenic
1167072820 19:47230640-47230662 CCTGGCGGCCAGTGCGGCCCCGG - Intronic
927683537 2:25155548-25155570 GGAGCCGGGCAGAGCCACCCAGG + Exonic
930024966 2:47024296-47024318 GCTGGCGCCCAGTGACCCCCAGG + Exonic
932106124 2:68944265-68944287 CCTGCCTGCCAGTCCCTCCCAGG - Intergenic
932426333 2:71637694-71637716 ACTTCTGGCCAGTGCCACCTGGG - Intronic
932614341 2:73222562-73222584 TCTGCCGGCCTGTTCCAACCCGG - Intronic
933768975 2:85730820-85730842 GCTGCCGGACACTGCCACCTGGG - Intergenic
934520054 2:95014364-95014386 GCTGCCAGGCAGGGCCACACAGG - Intergenic
934615941 2:95771087-95771109 GCTGTAGCCCAGTGACACCCAGG - Intergenic
934644954 2:96053475-96053497 GCTGTAGCCCAGTGACACCCAGG + Intergenic
934838362 2:97609564-97609586 GCTGTAGCCCAGTGACACCCAGG + Intergenic
935213853 2:100960633-100960655 CCTGCCTGCCAGTGGAACCCAGG + Intronic
936938324 2:117859116-117859138 CCTGGCGGCCGGTGGCACCCGGG + Intergenic
937223080 2:120353228-120353250 GCTGCCCACCAGTGCCCCCGGGG - Intergenic
937288091 2:120765618-120765640 CCTGCCTGCCAGTGACACCTTGG + Intronic
937319218 2:120950993-120951015 CCCGCCGGCCAGTTCCACGCTGG - Intronic
937346931 2:121131965-121131987 GGAGCCGGCCAGGGCCACCCTGG + Intergenic
937985854 2:127637777-127637799 TCTGCGGGCCAGAGCCTCCCAGG - Intergenic
937991204 2:127663542-127663564 GAGGAAGGCCAGTGCCACCCAGG - Intronic
941012215 2:160313382-160313404 GCTGCAGGCCAGTGGCCTCCTGG + Intronic
948649279 2:239430006-239430028 GCTGCAGGGCCGTGCCCCCCTGG + Intergenic
948940886 2:241195746-241195768 GCAGCAGGACAGTGCCGCCCGGG + Exonic
1173225937 20:41162530-41162552 GCTGACGGTAAGTGCCACCCAGG + Exonic
1174794481 20:53510755-53510777 CCTGCCCTCCAGTCCCACCCTGG + Intergenic
1175072009 20:56342907-56342929 TCTGCTGGCCAGGGCCAGCCTGG + Intergenic
1175279880 20:57796028-57796050 ATTGCAGGCCTGTGCCACCCAGG + Intergenic
1175524088 20:59621615-59621637 ACTGCCAGCCAGTGCCTGCCTGG - Intronic
1176286119 21:5020487-5020509 GCAGCCCCCCAGTGCCGCCCGGG - Intergenic
1176311634 21:5153927-5153949 GCAGGCGGCCCGTGCAACCCTGG + Intronic
1176412045 21:6454392-6454414 GCTCCCTGCCTGTGCCACCTGGG + Intergenic
1179687539 21:43062714-43062736 GCTCCCTGCCTGTGCCACCTGGG + Intronic
1179845416 21:44108108-44108130 GCAGGCGGCCCGTGCAACCCTGG - Intronic
1179871062 21:44242988-44243010 GCAGCCCCCCAGTGCCGCCCGGG + Intergenic
1180719886 22:17900196-17900218 GCTGCTGGCCGGTGGCTCCCTGG - Intronic
1180839174 22:18950846-18950868 ACTCCCTGCCAGTGCCCCCCAGG - Intergenic
1180949740 22:19715622-19715644 GGGGGCTGCCAGTGCCACCCTGG - Intronic
1181062713 22:20289609-20289631 CCTCCCTGCCAGTGCCCCCCAGG + Intergenic
1182145787 22:27995989-27996011 GAAGCCGGTCAGTGCCATCCTGG + Intronic
1182359997 22:29740715-29740737 GCTGCAGGCCAGTGCGACTTTGG - Exonic
1183442934 22:37833532-37833554 GCTGCTGGGCAGTGCAGCCCTGG + Intronic
1183617220 22:38953269-38953291 GCTCCGGGCCAGTGACAGCCGGG - Intronic
1183689027 22:39377696-39377718 GCTGCCGGCCTCTGCAAGCCGGG - Intronic
1184069419 22:42138672-42138694 GCTGCCTGCTAGTCCCACACCGG - Intergenic
1184523480 22:45008762-45008784 GCGGCCGGGCAGTGCCGCGCGGG + Intronic
1184823855 22:46933648-46933670 GCTGCCGGCCAGTGCCACCCTGG - Intronic
1185417974 22:50720432-50720454 GCTGCCGGCCTGTACGAGCCGGG + Intergenic
950012339 3:9732157-9732179 CCTGCCGGCCACTCCCGCCCTGG - Intronic
950207952 3:11094389-11094411 GCTGCCTGCCAGTCCTGCCCTGG - Intergenic
954239738 3:49284169-49284191 GCCGGCAGCCAGTGCCACCTGGG + Intronic
954626284 3:52023718-52023740 CCTGCTGGCCAGGGGCACCCTGG + Intergenic
955387697 3:58492331-58492353 GCTGCTGGCTCGTGCCAGCCCGG - Intronic
955995755 3:64678862-64678884 GCTGCTGGGCTGTGCCACTCTGG - Intronic
957009275 3:74985699-74985721 GCAACAGGCCAGTGCCCCCCTGG - Intergenic
959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG + Intergenic
959847240 3:111048052-111048074 GCTGCCAGGAAGTGCCACCCTGG - Intergenic
961714660 3:128850097-128850119 GCTCCCGGCCATGGCCTCCCGGG + Intergenic
961823122 3:129585404-129585426 GCTGCCTGCCAGAGCCCTCCTGG + Intronic
965801212 3:172496277-172496299 GCATCAGGCCAGTGCCCCCCTGG - Intergenic
967340365 3:188390544-188390566 GCTGCAGGCCAGGGCCTTCCAGG - Intronic
967715678 3:192758819-192758841 GCTGCAGGCCAGTGCCCCTCTGG + Intronic
968258468 3:197299143-197299165 GCTCCCGGTCTGAGCCACCCAGG + Intronic
968757549 4:2424669-2424691 CCTGCCAGCCAGTGTCACCTTGG + Intronic
969428807 4:7140994-7141016 GCTGCCGGCCCACCCCACCCAGG - Intergenic
969511593 4:7620989-7621011 CCTGCCAGCCACTGCCTCCCTGG - Intronic
969715726 4:8867369-8867391 GCGGTCGGCCATGGCCACCCGGG - Exonic
969942745 4:10750872-10750894 GCTGCTGGCCAGTGGCCACCAGG + Intergenic
972321701 4:37977844-37977866 GCTGCCGCTCGGTGCCTCCCCGG + Intronic
977046981 4:92079746-92079768 GCATCTGGCCAGTGCCACTCTGG + Intergenic
978111106 4:104964590-104964612 GCTCCCAGCCAATGCCAGCCAGG + Intergenic
985059204 4:186059023-186059045 GCTGCCAGGCAGGGCCACGCAGG - Intergenic
985203322 4:187506021-187506043 GCTGCCTGCCAGTCCCGCGCCGG - Intergenic
985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
985889499 5:2704927-2704949 TCTGCCTCCCTGTGCCACCCAGG + Intergenic
988073576 5:26324851-26324873 GCTGCCTGCCAGTCCCACACTGG - Intergenic
992459228 5:76944577-76944599 GCTGCTGGCAAGTCCCACCAAGG + Intergenic
995552460 5:113294684-113294706 GTTCCGGGGCAGTGCCACCCTGG + Intronic
996862751 5:128084043-128084065 CGTGCCGGGCAGTTCCACCCTGG - Exonic
997838930 5:137220337-137220359 CCTGCCTGGCAGTGCCCCCCAGG + Intronic
999264351 5:150256730-150256752 GCTGCCTGGCAATGGCACCCGGG - Intronic
999282664 5:150375409-150375431 GCGCCGGCCCAGTGCCACCCGGG + Exonic
1002427269 5:179183708-179183730 CCTGTAGGCCAGTGCCCCCCTGG - Intronic
1006125392 6:31834636-31834658 CCGGCCGGCCAGCGCCAGCCGGG - Exonic
1007400244 6:41599051-41599073 GCTGCTGGCCCGGGCCTCCCCGG - Exonic
1008315145 6:50030522-50030544 CCTGCCCGCCAGTCCCTCCCAGG + Intergenic
1015493519 6:133855142-133855164 GCTGCCGGCCCCAGCCAGCCAGG + Intergenic
1017811949 6:157989959-157989981 GCTCCTGCCCAGTGCCCCCCAGG - Intronic
1019014947 6:168873448-168873470 GCTGCTGGCCAGCGCTGCCCTGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019374790 7:683650-683672 GGTGCCGGCCAGGCCCACTCTGG - Intronic
1019542536 7:1558035-1558057 GCTGCAGGACAGAGTCACCCGGG - Intronic
1019929607 7:4214977-4214999 CCTGCCCCCCAGTGCCACCCAGG + Intronic
1022497738 7:30863674-30863696 GCTGCCGACCACTGCCTGCCTGG + Intronic
1022796272 7:33734052-33734074 GCTGCCAGCCGGCTCCACCCTGG + Intergenic
1023232553 7:38050060-38050082 GCTGCCTGCCAGTCCCATGCAGG - Intergenic
1023904488 7:44512725-44512747 GCTGCCAGTCAAGGCCACCCAGG - Exonic
1026853636 7:73739261-73739283 TCCGCCGCCCAGAGCCACCCTGG - Intergenic
1029457195 7:100677352-100677374 GCTGCTGGTCAGCGCCTCCCAGG + Exonic
1034306466 7:150048375-150048397 GCTGCCAACCCCTGCCACCCAGG - Intergenic
1034393263 7:150801667-150801689 GCTGCGGCCCCGGGCCACCCAGG + Exonic
1034430627 7:151039531-151039553 GCAGCCGGCCAGCCCTACCCCGG + Intronic
1034800380 7:154052267-154052289 GCTGCCAACCCCTGCCACCCAGG + Intronic
1034879847 7:154755234-154755256 GCTGCCTGCCTGTCCGACCCTGG + Intronic
1034900919 7:154907291-154907313 GCTGCCCGCCAGTCCCACGCAGG - Intergenic
1034951067 7:155297573-155297595 GCAGCCGGCCAGTCCCGCTCGGG + Intergenic
1035354636 7:158269637-158269659 GCTCCCGTCCTGTGCCATCCTGG - Intronic
1035683585 8:1507416-1507438 GCGGCCGGCCAGCGCCAGCGGGG - Intronic
1037396248 8:18447087-18447109 GCTGTGGCCCAGTGCCACTCAGG - Intergenic
1037456280 8:19067619-19067641 GCTGCTGGCTTGTGACACCCTGG - Intronic
1037734772 8:21557004-21557026 GCTGCTTCCCAGTCCCACCCAGG + Intergenic
1040014546 8:42689903-42689925 GCTGCCTGCCAGTCCCGCACCGG - Intergenic
1040550706 8:48435033-48435055 GCAGCTGTCCACTGCCACCCTGG - Intergenic
1040567552 8:48581541-48581563 GCAGCCGCCCAGGGCCACGCCGG - Intergenic
1042819897 8:72918768-72918790 GCAGCTGGCCAGTGGCAGCCAGG + Intronic
1047100121 8:121667415-121667437 GCTGCCTGCCAGTCCCGCGCTGG + Intergenic
1049538403 8:143193768-143193790 GCTGCTGGGCAGGGCCACACGGG - Intergenic
1049604976 8:143525178-143525200 GCTGCTGGGAGGTGCCACCCAGG - Intronic
1051452907 9:17216904-17216926 GCTGCCAGGCAGTTCCACCCAGG + Intronic
1052018486 9:23498136-23498158 GCTGCCAGCCAGGGTCACACAGG + Intergenic
1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
1057785120 9:98081510-98081532 CCTTCCCACCAGTGCCACCCTGG - Intronic
1057870420 9:98712533-98712555 GCTGACACCCTGTGCCACCCAGG + Intergenic
1057902671 9:98961695-98961717 ACTACCGCCCAGGGCCACCCGGG + Intronic
1060790524 9:126482789-126482811 GCTGCCGGGCGCTGCCACCTCGG + Intronic
1061430853 9:130529947-130529969 GCTGTCAGCCAGTGGCCCCCTGG + Intergenic
1061484564 9:130913845-130913867 GCCGACGGCCAATGCCAGCCAGG - Intronic
1062308943 9:135925555-135925577 GCTGTCTGCGAGGGCCACCCTGG + Intergenic
1062543272 9:137050901-137050923 GCTGCTGGCCAGCGCCCTCCAGG - Exonic
1186496552 X:10015910-10015932 GCCGCCGGCCGGCGCCACCGCGG + Intronic
1187509140 X:19901874-19901896 CCTGCCAGACAGTGCCATCCAGG - Intergenic
1190309376 X:49105947-49105969 TCTACAGGCCAGTGCCACCATGG - Intergenic
1190520419 X:51273701-51273723 GCTGCCAGCAACTGCCACTCTGG + Intergenic
1191258526 X:58290320-58290342 GCTGGAGGCCAGTGCCTTCCGGG + Intergenic
1191802784 X:65099486-65099508 GCACCAGGCCAGTGCCACTCTGG + Intergenic
1199292007 X:146114622-146114644 GCTGCCAGCCAATTCCAGCCAGG + Intergenic
1199772584 X:150983999-150984021 GCGGCCGGCCCGCGCCCCCCCGG - Intronic
1200003359 X:153072979-153073001 CCCGCCGCCCCGTGCCACCCTGG + Exonic
1200004364 X:153077030-153077052 CCCGCCGCCCCGTGCCACCCTGG - Intergenic
1202148430 Y:21823577-21823599 GCTGCCGGACAGTGAAACACTGG - Intergenic