ID: 1184826803

View in Genome Browser
Species Human (GRCh38)
Location 22:46957997-46958019
Sequence GCATCTCCTGCATTTCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184826791_1184826803 17 Left 1184826791 22:46957957-46957979 CCCCTGAACTGGTGATGGCAGAA 0: 1
1: 0
2: 3
3: 18
4: 177
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139
1184826795_1184826803 -7 Left 1184826795 22:46957981-46958003 CCCCACAGAGCACCCTGCATCTC 0: 1
1: 0
2: 3
3: 28
4: 347
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139
1184826793_1184826803 15 Left 1184826793 22:46957959-46957981 CCTGAACTGGTGATGGCAGAACC 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139
1184826790_1184826803 18 Left 1184826790 22:46957956-46957978 CCCCCTGAACTGGTGATGGCAGA No data
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139
1184826794_1184826803 -6 Left 1184826794 22:46957980-46958002 CCCCCACAGAGCACCCTGCATCT 0: 1
1: 0
2: 1
3: 29
4: 309
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139
1184826797_1184826803 -9 Left 1184826797 22:46957983-46958005 CCACAGAGCACCCTGCATCTCCT 0: 1
1: 0
2: 4
3: 47
4: 439
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139
1184826796_1184826803 -8 Left 1184826796 22:46957982-46958004 CCCACAGAGCACCCTGCATCTCC 0: 1
1: 0
2: 2
3: 25
4: 332
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139
1184826792_1184826803 16 Left 1184826792 22:46957958-46957980 CCCTGAACTGGTGATGGCAGAAC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184826803 Original CRISPR GCATCTCCTGCATTTCTCGG GGG Intronic
901459636 1:9383877-9383899 GCATCTCCAGTATTTCTCACTGG + Intergenic
902771107 1:18646166-18646188 GCATGTCCGGGATTTGTCGGAGG + Intronic
904477212 1:30773058-30773080 GCAGCTCCTGCACTTCTCCATGG - Intergenic
906729804 1:48071227-48071249 CCATCGCCTGCCTTTCTCAGGGG - Intergenic
907418216 1:54329105-54329127 GCATCTCCTGGACTTCTGGAAGG + Intronic
909654265 1:78013128-78013150 ACATTTGCTGCATTTTTCGGAGG + Exonic
910276440 1:85454130-85454152 GCATCTTTTGCATTTTTCAGAGG - Intronic
913086609 1:115443428-115443450 GCATCTCCTTCATTGCTCCTAGG + Intergenic
918797897 1:188928528-188928550 TCATCTCAAGCATTTCTCAGTGG - Intergenic
919039467 1:192364679-192364701 CCATCTCCTGCATTTTTCCAAGG + Intronic
919767322 1:201135775-201135797 GCAGCTGCTGCATCCCTCGGGGG - Exonic
921310287 1:213835565-213835587 GCCTCTCCTGCATTTCTTGAGGG - Intergenic
921949574 1:220915431-220915453 GCCTCTCCTGCACCTCTCAGAGG - Intergenic
923770909 1:236936834-236936856 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1063454637 10:6174530-6174552 CCAGCTCCTGGCTTTCTCGGCGG - Intronic
1071180123 10:82974022-82974044 GCTTCTCCTGTAGTTCTCTGTGG + Intronic
1071296244 10:84222168-84222190 GCACCTCCTGCATGTCACAGTGG - Exonic
1072620528 10:97076227-97076249 GCATCTCCAGCATTGCCAGGAGG + Intronic
1074641273 10:115385025-115385047 GCATGTCTTGCATTTCTCTTGGG + Intronic
1076790750 10:132775522-132775544 GCCCCTCCTGCATTTCTCCCTGG + Intronic
1078022229 11:7665542-7665564 GCATCTCCTTCATTTCAGGCTGG - Exonic
1080985437 11:37458219-37458241 GCCTCTACTGCATTTCTCTCAGG + Intergenic
1095102876 12:38201915-38201937 CCATCTCTTGCAGTTCTGGGAGG + Intergenic
1098599089 12:72308165-72308187 CTAGCTCCTGCATTTCTCGGTGG + Intronic
1102346833 12:112166156-112166178 GCGTCTCCTGCACTCCTCCGAGG - Intronic
1102471928 12:113164111-113164133 GCTTCTCCTGCAGTGCTGGGCGG + Exonic
1106565132 13:30878090-30878112 GCTTTTCCTGCATATCTCTGTGG + Intergenic
1108379745 13:49844424-49844446 GCATGTCTTGCATTTCTCCTGGG - Intergenic
1112305266 13:98267742-98267764 GCACGTCCTGCAGTCCTCGGTGG - Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1117202479 14:53406467-53406489 GCATCTACTTCTTTTCTCAGGGG - Intergenic
1118600804 14:67470448-67470470 GCATCTCCTCCAGGTCTGGGTGG + Exonic
1121114061 14:91331353-91331375 ACATCTCCTGCAGCTCTCAGAGG - Intronic
1125598544 15:40902918-40902940 GCAGCTCCTGCAGGTCTCGCCGG - Exonic
1131225431 15:90621057-90621079 GAATGTCCTGCACCTCTCGGCGG - Intronic
1132890166 16:2199833-2199855 GTAGCTCCTGCATTTCTGTGGGG - Intergenic
1133100796 16:3478409-3478431 GTCTCTCCTGCAGTTCTCGTGGG + Intronic
1133223360 16:4328562-4328584 GCAGCTCCTTCCTTTCCCGGGGG + Intronic
1133584807 16:7182720-7182742 GCATCTCTTTCATTTCTCTTTGG + Intronic
1136103730 16:28013886-28013908 GCATCTCCTGCCTTCCTATGTGG + Intronic
1137010730 16:35317209-35317231 GAAGCACCTGCATTTCTTGGGGG - Intergenic
1137615749 16:49845919-49845941 CCATGTCCTGCCTTTCTCAGGGG - Intronic
1138422087 16:56905440-56905462 GCCTCTCCTACATTTCCTGGGGG + Intronic
1141731419 16:85825465-85825487 GCATCACCTGGATTTCTGGTGGG + Intergenic
1142263920 16:89054875-89054897 GCTCCTCCTGCATGTCCCGGAGG + Intergenic
1143769313 17:9157897-9157919 TTATCTCCTGCATCTCTTGGAGG - Intronic
1144234436 17:13243840-13243862 GAATCTTCTTCATTTGTCGGAGG + Intergenic
1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
1147374897 17:40017538-40017560 GCGTCTCCTGTTTTTCTGGGTGG + Exonic
1148236933 17:45975235-45975257 GCCTCTTCTGCATTTCTTGTTGG - Intronic
1148826006 17:50394863-50394885 GCATCTCCTTCCTGTTTCGGGGG - Intronic
1151593645 17:75063511-75063533 GCATCTGCTGCACGTCTTGGAGG - Exonic
1157553910 18:48600155-48600177 GCATCTATTGCATGCCTCGGGGG - Intronic
1159310082 18:66696695-66696717 GTGTCTCCTGCATTTCCCAGTGG - Intergenic
1159645994 18:70919123-70919145 GCATATCCTGTATTTCTCTATGG + Intergenic
1160863566 19:1247905-1247927 GCATGTCCTGCATTAATGGGGGG + Intergenic
1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG + Intergenic
926018177 2:9472954-9472976 CCAGCTCCACCATTTCTCGGAGG - Exonic
930368697 2:50476615-50476637 CCTTCTTCTGCATTTCTCAGTGG - Intronic
930773729 2:55152771-55152793 GCATCTCCTGCTTACCTCAGGGG + Intergenic
932446697 2:71786006-71786028 GCATCTCCAGGATTTATGGGTGG - Intergenic
935202124 2:100866226-100866248 TCATCTTCTGCATTTCTCCTTGG + Intronic
935361847 2:102251774-102251796 GCCTCTCCTGCATGTCTGGACGG + Intergenic
936500111 2:113060022-113060044 GCATCTCCTGGATGCCTCTGTGG - Intronic
937702259 2:124877071-124877093 TCATCTACTGAATTTCTCTGTGG - Intronic
939087740 2:137741928-137741950 GCATGTTCTGCATTCCCCGGAGG + Intergenic
939453277 2:142400353-142400375 GGATCTCCTGCAGTTCTCAAAGG + Intergenic
939485108 2:142801738-142801760 GCATCTGCTTCACTTCTGGGAGG + Intergenic
940291758 2:152084174-152084196 GCATGACCTGCATCTCTCTGTGG - Intronic
942306207 2:174609957-174609979 GCAGATCCTGCTTTTCTCAGTGG + Intronic
946071671 2:217039514-217039536 GCATCTTTTGCATTTCTCTAGGG - Intergenic
946418004 2:219550246-219550268 CCACCTCCTGCATGTCTCCGCGG + Exonic
946551593 2:220807450-220807472 GTTTCTCCTGCCTTTCTCTGGGG + Intergenic
948760937 2:240190684-240190706 GGGTCTCCTGCTTTCCTCGGAGG + Intergenic
948949860 2:241242465-241242487 GCAGCTCCTGCATCTGGCGGAGG - Exonic
1170069063 20:12344972-12344994 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1170926754 20:20731737-20731759 GCATATCCTGGAATTCTCCGAGG - Intergenic
1173028281 20:39330070-39330092 GCATCTTCTGCCATTCTCAGGGG + Intergenic
1178362232 21:31958222-31958244 GAAACTCCTGCTTTTCTCTGTGG + Intronic
1182422344 22:30254582-30254604 CCATCTCCTCCCTTTCTGGGTGG + Intergenic
1184573879 22:45346486-45346508 CCAACTCCTGGATTTCTCTGAGG + Intronic
1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG + Intronic
950181706 3:10918118-10918140 GCTTCTCCTGAATTTCTAGAAGG - Intronic
952663653 3:35879065-35879087 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
953417608 3:42731933-42731955 GCAGCTCCTGTATTTCTGTGTGG + Intronic
953465450 3:43115505-43115527 GCATCTCCTCCCTTTCTCAGTGG - Intergenic
955105454 3:55893342-55893364 GCATCCCCTGTATTTCTATGTGG - Intronic
959724773 3:109531091-109531113 GCATCTTCTGCATTTCTTTGGGG + Intergenic
960090097 3:113630299-113630321 GCTTCTCCAGCATTTGTCAGGGG - Intergenic
960092985 3:113660621-113660643 GAATCACCTGCAGTTCTGGGAGG + Exonic
961389253 3:126542629-126542651 GCAGCACCTGCATTCCCCGGGGG - Exonic
962212820 3:133493124-133493146 ACATAACCTGTATTTCTCGGAGG - Intergenic
963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
963974197 3:151462108-151462130 ATATCTCCTGCAATTCTTGGTGG + Intergenic
965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
966936656 3:184714572-184714594 GTATCTCCTGCATATCTCCCTGG - Intergenic
967740284 3:192996636-192996658 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
968797997 4:2721808-2721830 GGTTCTCCTGCATGTCCCGGGGG + Intronic
970087369 4:12364781-12364803 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
971725809 4:30310326-30310348 GAATCTTCTGCATTTCCAGGTGG - Intergenic
975235403 4:71989688-71989710 GCATCTCTTGGACTTCTCTGTGG + Intergenic
975934105 4:79558732-79558754 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
977041855 4:92027006-92027028 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
977217308 4:94297736-94297758 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
979290436 4:118974207-118974229 GCATCTGTAGCATTTCTCAGTGG + Intronic
979895353 4:126149807-126149829 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
982373481 4:154660175-154660197 CCATCTGCTGTATTTCTCAGAGG - Intronic
985268968 4:188176629-188176651 GCACCTCCTGCATTGCTGGGTGG - Intergenic
986099804 5:4596628-4596650 GTATCTGCTGCATTTCACGCTGG + Intergenic
986803182 5:11282542-11282564 GGATCTCCTGGATTTCTAGCAGG - Intronic
987079555 5:14414243-14414265 GCACCTCCGGCATTTCTCACTGG + Intronic
995703171 5:114958228-114958250 GCATCTCCTGGAGTACTGGGTGG - Intergenic
997241240 5:132309586-132309608 GCATCTGCTTCATTTCCTGGAGG + Intronic
998359578 5:141573646-141573668 CCACCTCCTCCATTTCCCGGAGG - Exonic
998509248 5:142697760-142697782 GCATCGCCTCCTTTTCTGGGAGG - Exonic
1000328205 5:160188091-160188113 GAATCTCCTGAATTCCTCTGGGG + Intronic
1000461905 5:161532933-161532955 ACATCTCCTGTTTTTCTCTGTGG + Intronic
1003430357 6:6032468-6032490 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1005432933 6:25777444-25777466 GCATCTCTCACATTTCTTGGTGG - Intronic
1005655502 6:27931676-27931698 TCATCTCCTTCACTTCTCAGAGG + Intergenic
1012179351 6:96132015-96132037 GCATCTTCTGCATTTCATGCTGG - Intronic
1012509838 6:99990952-99990974 GCATCTCCTGCTTTATTTGGAGG + Intronic
1014255934 6:119160004-119160026 GCATCTCATGTACTTCTTGGAGG - Intergenic
1016325280 6:142893758-142893780 GTTTCACCTGCATTTTTCGGGGG + Intronic
1019047995 6:169162787-169162809 GCATCCCCTGCATGCCTGGGTGG + Intergenic
1020451955 7:8329708-8329730 TCATCTTCTGCATTTATTGGGGG - Intergenic
1021978047 7:26028707-26028729 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1023629035 7:42144800-42144822 GCAATTCCTTCATTTCTCTGTGG - Intronic
1023640165 7:42249587-42249609 GCATCACCTGCATTTACAGGTGG - Intergenic
1023727965 7:43163786-43163808 ACATCTCCACCATTTCTCAGTGG - Intronic
1035826319 8:2647785-2647807 GCATGTCCTGCATTGTTCTGTGG - Intergenic
1036418507 8:8573342-8573364 GCATCTGCTGGGTTTCTGGGGGG - Intergenic
1049337181 8:142092641-142092663 GAAGCTCCTGTCTTTCTCGGGGG + Intergenic
1049352969 8:142174066-142174088 GCCTCTCCTGCCTTCCTCGCCGG - Intergenic
1049376784 8:142293151-142293173 GCATCTGCTGCCGTTCTCAGTGG + Intronic
1051346046 9:16152113-16152135 GCATCTCCTGCAGGTCCTGGAGG - Intergenic
1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1057073152 9:92117928-92117950 GCCACGCCTGCATTTCTCAGAGG + Intergenic
1189279599 X:39811851-39811873 TCATCTCCTCCATTTATCAGAGG - Intergenic
1194806973 X:98341726-98341748 GCATCTTCTCTATTTCTTGGTGG + Intergenic
1195758058 X:108218816-108218838 GCAGCTCCTCCATTTGTGGGAGG - Intronic
1197352252 X:125393523-125393545 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1202076751 Y:21044144-21044166 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic