ID: 1184828839

View in Genome Browser
Species Human (GRCh38)
Location 22:46971298-46971320
Sequence CTGAGTGCACAGATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184828839_1184828843 -7 Left 1184828839 22:46971298-46971320 CCCAGCTGCATCTGTGCACTCAG 0: 1
1: 0
2: 0
3: 32
4: 233
Right 1184828843 22:46971314-46971336 CACTCAGGCAGAGGCTGTCAAGG 0: 1
1: 0
2: 3
3: 25
4: 243
1184828839_1184828845 -1 Left 1184828839 22:46971298-46971320 CCCAGCTGCATCTGTGCACTCAG 0: 1
1: 0
2: 0
3: 32
4: 233
Right 1184828845 22:46971320-46971342 GGCAGAGGCTGTCAAGGTCTGGG 0: 1
1: 0
2: 1
3: 30
4: 260
1184828839_1184828844 -2 Left 1184828839 22:46971298-46971320 CCCAGCTGCATCTGTGCACTCAG 0: 1
1: 0
2: 0
3: 32
4: 233
Right 1184828844 22:46971319-46971341 AGGCAGAGGCTGTCAAGGTCTGG 0: 1
1: 0
2: 0
3: 34
4: 330
1184828839_1184828846 2 Left 1184828839 22:46971298-46971320 CCCAGCTGCATCTGTGCACTCAG 0: 1
1: 0
2: 0
3: 32
4: 233
Right 1184828846 22:46971323-46971345 AGAGGCTGTCAAGGTCTGGGAGG 0: 1
1: 0
2: 0
3: 34
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184828839 Original CRISPR CTGAGTGCACAGATGCAGCT GGG (reversed) Intronic
900796256 1:4710360-4710382 ATGAGTGTAAAGATGCATCTGGG - Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901041079 1:6363937-6363959 CTGGGACCACAGGTGCAGCTGGG - Intronic
902058428 1:13621427-13621449 CTGAGTACAGATATCCAGCTGGG + Intergenic
902332219 1:15736196-15736218 GTGTGGGCACAGAGGCAGCTGGG + Intergenic
903162327 1:21497993-21498015 CTGAGTGCCCAGAAACACCTGGG + Intergenic
903360689 1:22775227-22775249 CTGTGTGCACTTATGCAGGTTGG + Intronic
904356312 1:29942408-29942430 CTGAGTGCACAGTTGACACTCGG + Intergenic
906415774 1:45620700-45620722 GTGAGGGCCCAGCTGCAGCTAGG - Intronic
909197665 1:72648403-72648425 CTTGGTTCACAGCTGCAGCTGGG - Intergenic
910602235 1:89043956-89043978 CTGGGTGTGCAGCTGCAGCTTGG + Intergenic
911288768 1:96029177-96029199 CTGAGTCCACAGCCACAGCTGGG + Intergenic
912309971 1:108610341-108610363 ATGTGGGCACAGATGCAGGTAGG + Intronic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
915834820 1:159168299-159168321 CTGAGTGGACAGGGGCACCTAGG + Intergenic
917736940 1:177929989-177930011 TTGATTGGACAGATGGAGCTAGG + Intronic
918693156 1:187507923-187507945 ATGAATGCACAGATACAACTGGG - Intergenic
923426842 1:233879068-233879090 ATGAGTGCTCAGATGGAGGTGGG + Intergenic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
1063391472 10:5652545-5652567 CTGGGTGCAGAGCTGCTGCTTGG - Intronic
1063476879 10:6336562-6336584 CTGAGACCACAGGTGCAGCCAGG + Intergenic
1064023163 10:11825428-11825450 CTTAGAGCACAGAGGCACCTAGG - Intronic
1065514069 10:26507065-26507087 CTGAGGACAGAGAGGCAGCTGGG + Intronic
1067267452 10:44757691-44757713 CTCAGGGCACAGCTGCAGCCTGG + Intergenic
1067730569 10:48807937-48807959 CTCAGAGGACAGATGAAGCTGGG - Exonic
1067792675 10:49299730-49299752 CTGAGTGCACAGATGTGCCCAGG + Intronic
1067947919 10:50702332-50702354 CTGAGTGTCCAGCTGCTGCTGGG + Intergenic
1070762741 10:79034881-79034903 CTGAGTGCACAGGTGTGGGTGGG - Intergenic
1070846023 10:79523453-79523475 CTGAGTGCCCAGGTGAAGCTGGG + Intergenic
1070927774 10:80236857-80236879 CTGAGTGCCCAGGTGAAGCTGGG - Intergenic
1071983848 10:91031318-91031340 CAGAGGCCACAGAAGCAGCTGGG - Intergenic
1072274844 10:93812969-93812991 CTGAGTACACTAATGCAGGTTGG - Intergenic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1074036337 10:109742794-109742816 CAGAGTGTACATATGCAGGTTGG + Intergenic
1074386501 10:113020564-113020586 CTGGTTGCAAAGAGGCAGCTGGG + Intronic
1075172005 10:120124289-120124311 CTGACTCCACAGATTCTGCTTGG + Intergenic
1075787803 10:125061732-125061754 CTGGGTTCTCAGATGCACCTCGG + Intronic
1075816967 10:125271862-125271884 CTGAGTGCAGAGCTTGAGCTGGG - Intergenic
1076475493 10:130748848-130748870 CAGAGGGCACAGAGGCTGCTGGG - Intergenic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077197035 11:1286242-1286264 CTGAGTGCACAGGGGACGCTGGG + Intronic
1077790881 11:5438544-5438566 CTGAGTGCAGAGTTTTAGCTTGG + Intronic
1079495447 11:21038149-21038171 CTTTGTGCCCTGATGCAGCTGGG - Intronic
1082085856 11:48048987-48049009 CAGAGAGCACAGTTGCTGCTTGG + Intronic
1084187853 11:67484430-67484452 CTGACTTCAGAGATGCAGCATGG + Intronic
1084495865 11:69502699-69502721 CTCAGTGGGCAGATGCAGCTGGG - Intergenic
1085310058 11:75510798-75510820 CAGAGTGCACAGATGTTGCAAGG - Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089027376 11:115285721-115285743 CTAAGAGCACACAGGCAGCTGGG + Intronic
1090925521 11:131246734-131246756 CTCAATGCCCAGATGCAGATGGG + Intergenic
1092180900 12:6445896-6445918 CAGAGTGCACATGTGCAGGTTGG + Intronic
1092670228 12:10853841-10853863 CTGAGTCTGCTGATGCAGCTGGG + Intronic
1093493182 12:19726871-19726893 CAGGGTCCACAGCTGCAGCTTGG + Intergenic
1093634974 12:21455517-21455539 CTGTTTGCAAAGATGCAGATGGG - Intronic
1094675850 12:32619718-32619740 CTGTGTGCCCAAATTCAGCTTGG + Exonic
1096148269 12:49293847-49293869 AGGAGTGGACAGAGGCAGCTCGG - Exonic
1096264062 12:50110105-50110127 CTGAGGACACAGATGTTGCTAGG - Exonic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1100672906 12:96835670-96835692 CTGAGTTTACAGCTGCAGTTTGG + Intronic
1102529401 12:113534985-113535007 CTGAGTGCAGAGCTGCGGGTTGG + Intergenic
1102606234 12:114069641-114069663 CTGAGTCCACTGATGTAGTTGGG - Intergenic
1104120279 12:125791946-125791968 GTGAGTGCAAAGATGGAGCGGGG - Intergenic
1104155365 12:126126147-126126169 GTGGGTGCACAGATGATGCTGGG + Intergenic
1106332751 13:28754520-28754542 CTAAGGGCAAAGATGAAGCTGGG + Intergenic
1106442228 13:29786138-29786160 CTGTGGGCTCAGATGCACCTGGG - Intronic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1109525144 13:63566069-63566091 CTGGGTCCATAGCTGCAGCTTGG - Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110506883 13:76297499-76297521 GTGAGTGCAAAGGTGCAGCTGGG + Intergenic
1111224093 13:85246575-85246597 CTGATTGGAGAGACGCAGCTTGG + Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1112842890 13:103601389-103601411 CTGAGTCCACAGTGGCAGCCCGG + Intergenic
1113314513 13:109164081-109164103 CTGACTTCACAGGTGCACCTGGG - Intronic
1114669243 14:24400016-24400038 CTGAGTGCTCAGAGTCAGGTAGG + Intronic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116997379 14:51337743-51337765 CTGAGGGCACAGCTCCTGCTTGG - Intergenic
1119285911 14:73454169-73454191 CTGAGAGTACATATGCAGGTTGG - Intronic
1119620182 14:76126001-76126023 GTGAGGCCACAGATGCTGCTGGG - Intergenic
1122484439 14:102069183-102069205 CTGAGTGCAGAGATGTAGTAGGG + Intergenic
1122549865 14:102544133-102544155 CTGGGTGGATACATGCAGCTGGG - Intergenic
1122690146 14:103528434-103528456 CTGAGTGCAGAGCTGCTTCTAGG - Intergenic
1122974449 14:105165342-105165364 GTGCGTGCACACACGCAGCTGGG + Intronic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1125120842 15:36157033-36157055 CTGAGTTGCCAGATGGAGCTTGG + Intergenic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1126215119 15:46145965-46145987 CTGGGTCTACAGCTGCAGCTGGG - Intergenic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1130971438 15:88736662-88736684 CAGAGTCCACCGAGGCAGCTGGG - Intergenic
1131036537 15:89226147-89226169 GGGAGTGGACAGATGCAGTTTGG - Intergenic
1131165396 15:90138620-90138642 CTGAGTGCCAAGAGGCAGCCTGG - Intergenic
1132897474 16:2235942-2235964 CTGGGGGCACAGCTCCAGCTGGG - Exonic
1133589157 16:7226002-7226024 CAGAGTGTACAGATTCAGCAAGG - Intronic
1133636069 16:7666879-7666901 CTGGGTGCAGCGGTGCAGCTCGG + Intronic
1135184048 16:20299484-20299506 CTGACAGGATAGATGCAGCTAGG + Intergenic
1135222036 16:20622260-20622282 CTGAGTGCCCAGGTGAAGCTGGG + Intronic
1135460663 16:22639753-22639775 CTGAGTGTAAGGATGTAGCTTGG - Intergenic
1136654677 16:31702820-31702842 GTGAGTGGACAGATGTACCTGGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1139183024 16:64770275-64770297 CTGGGTCCACAGGTGCAGTTTGG - Intergenic
1139397303 16:66650441-66650463 CTGAGACTACAGATGCAGCCTGG + Intronic
1139734594 16:68976418-68976440 TTGAGTGCTCATATGAAGCTAGG + Intronic
1140132035 16:72171333-72171355 CTGAGGGCATAGATCCAGCTGGG - Intronic
1141280017 16:82622940-82622962 CAAAGGGCACAGATGCAGGTTGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142433049 16:90040804-90040826 CTGAGTCCACAGGTGGGGCTGGG + Intronic
1144433164 17:15213754-15213776 CTTAGTGCACAAGTACAGCTAGG + Intergenic
1145185181 17:20787751-20787773 CTGAGAGCACTGATTCAGGTGGG - Intergenic
1145777157 17:27537159-27537181 CTAAGTGCAGTGGTGCAGCTGGG + Intronic
1146595213 17:34162452-34162474 CTGGGTGCACAGATTCCTCTTGG - Intronic
1148630553 17:49104960-49104982 CAGAGGGCACAGATACAACTGGG + Intergenic
1149664722 17:58357747-58357769 CTGGGTGCACAGTTGCATCCTGG + Exonic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152663937 17:81556501-81556523 CAGACTGCACAGGTGCAGCAAGG - Intergenic
1153797668 18:8639937-8639959 CTGGGTGCAGAGTTTCAGCTGGG + Intergenic
1154046970 18:10915297-10915319 TGGAGTGCACAGAGGCAGATGGG - Intronic
1154174692 18:12077731-12077753 TGGAGTGCACAGAGGCAGATGGG + Intergenic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1157799058 18:50603594-50603616 CTGAGTCCACAGCTGCAGAATGG + Intronic
1159823033 18:73170969-73170991 CTGGGTGCACCCATGCAGCTTGG - Intronic
1162328848 19:10014587-10014609 CTGAGTGCAGTGGTGCATCTTGG + Intronic
1163405168 19:17117418-17117440 GGGAGTGCCCAGAGGCAGCTTGG + Intronic
1163647301 19:18496676-18496698 CTGAGTGGACAGCAGCAGCCTGG - Intronic
1163675165 19:18652067-18652089 CTGAGTGCAGAAATGCTGGTGGG + Intronic
1166685616 19:44794337-44794359 CTGAGTGCACAGGTGAACCAGGG - Intronic
1166731010 19:45059053-45059075 CACAGTGGACAGAGGCAGCTCGG - Intronic
926330949 2:11824860-11824882 CGGAGTGCACAGCTCCACCTGGG + Exonic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
928179530 2:29058278-29058300 CTGTGTGCACAGATGCTCCCTGG + Exonic
928612289 2:33002453-33002475 GTGTGAGCACAGATGCTGCTAGG + Intronic
930329020 2:49958965-49958987 CTGAGTGCTCTCATGCACCTGGG - Intronic
933786003 2:85842065-85842087 CAGAGTTCACAGATTCAGGTGGG + Intronic
935341674 2:102064677-102064699 CTGAGAGCAAGGAGGCAGCTAGG - Intronic
935973313 2:108553210-108553232 CTCACTGCCCAGATGCAGCCTGG + Intronic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
939298266 2:140297942-140297964 CCCAGTGCACAGCTGCAGGTGGG + Exonic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
939968488 2:148634718-148634740 CTGAGTGCACACGTGGAGTTAGG + Intergenic
940105063 2:150090130-150090152 GTGAGAGCACAGAAGCAGCAAGG - Intergenic
940422929 2:153499876-153499898 CTGGGTGCACAGCTGCGGCTGGG + Intergenic
940765248 2:157783264-157783286 CTAAGTACACAGATGCAGGAAGG + Intronic
946176551 2:217925547-217925569 CTGAATGCCCAGATGCACGTGGG - Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948681198 2:239635812-239635834 CTGAGGGCTCAACTGCAGCTGGG - Intergenic
948803598 2:240443648-240443670 CCTAGTTCACAGATGCCGCTGGG - Intronic
1169159830 20:3368208-3368230 CTGAGTTAGGAGATGCAGCTGGG - Intronic
1169325371 20:4671272-4671294 CCGAGTGCACAGGTGGGGCTTGG - Intergenic
1170613819 20:17933892-17933914 CTGTGTGCATAGCTGCAGCCAGG + Intergenic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171318159 20:24214158-24214180 CTGTGTACTCAGATGCACCTTGG - Intergenic
1171336396 20:24389425-24389447 CACAGTGCACAGAGGAAGCTGGG + Intergenic
1176430829 21:6574554-6574576 CTGAGTCCACAGACGCTCCTCGG + Intergenic
1179706223 21:43182016-43182038 CTGAGTCCACAGACGCTCCTCGG + Intergenic
1181027561 22:20134625-20134647 CTGAGTGCAGAGAGGGGGCTGGG - Intronic
1183186420 22:36294006-36294028 CAGAGAGCACACATGCACCTGGG + Intronic
1184778038 22:46633033-46633055 CTGAGTGGGCAGAGGCAGATGGG + Intronic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1184887739 22:47356736-47356758 CTGAGGGCTAAGATGCTGCTAGG + Intergenic
954807849 3:53230663-53230685 GTGAGTGCACACCTGCAGCCTGG + Intronic
955793070 3:62608108-62608130 CTGAGTTCCCAGTTGCATCTGGG + Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
961357112 3:126346189-126346211 CTGTGTGCCCAGCTGCAGCTGGG - Intronic
961561556 3:127733863-127733885 CTGGGTGCGCAGCTGCACCTGGG + Intronic
961640101 3:128359875-128359897 CTGTGAGCACGGAGGCAGCTGGG - Intronic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
965272633 3:166638449-166638471 CTAGGTTCACAGATGCAGCTTGG - Intergenic
965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG + Intronic
966224382 3:177582303-177582325 CTCTGTGCAAAGAGGCAGCTGGG - Intergenic
966471310 3:180292270-180292292 CTGAGTTCCCAGATGCCTCTTGG - Intergenic
967295699 3:187962707-187962729 ATGTGGGCACAGATGCAGGTGGG + Intergenic
968280047 3:197469661-197469683 ATGGGTGCAAACATGCAGCTAGG + Intergenic
968729840 4:2264525-2264547 CTGAGGGCTGAGCTGCAGCTAGG + Intergenic
972128493 4:35800945-35800967 CTAAGTCCACAGCTGCAGTTTGG - Intergenic
972158888 4:36198648-36198670 AAGAGTGCACAGATCCAGATGGG + Intronic
972239884 4:37178864-37178886 CTGAGTGAACAGAGGTAGCTGGG - Intergenic
973571576 4:52245127-52245149 CTGAGTGCACAATTCCAACTTGG - Intergenic
973756054 4:54074522-54074544 TTGAGTTCCCAGATGAAGCTGGG - Intronic
974663672 4:64929177-64929199 CTGAGGGCACAGGTGCATTTTGG + Intergenic
978080729 4:104588163-104588185 CTGGGTGCTAAGATGCTGCTTGG + Intergenic
980972936 4:139583838-139583860 CAGAGTGCATAGATCCAGATGGG + Intronic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
983628385 4:169826053-169826075 CTGAGAGCCCAGATGGAGATGGG + Intergenic
984067138 4:175062464-175062486 CTGAGTGCACCCCTGCAGCCTGG + Intergenic
984325086 4:178241603-178241625 CTGGGTCCACAGCTGCGGCTTGG - Intergenic
985752864 5:1692319-1692341 CGGAGTGCACAGGTGCTGGTAGG + Intergenic
987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG + Intergenic
997386164 5:133474434-133474456 CTCAGTGCACTGATGGAGCTAGG - Intronic
997870397 5:137500956-137500978 GGGAGTGCAGAGATGCAGGTGGG - Intronic
998104495 5:139459766-139459788 CTGGGTGGACAGAGGCGGCTGGG + Intronic
999142466 5:149371547-149371569 ATGAGTGCACAGACGCCTCTAGG - Intronic
999454911 5:151707205-151707227 CTGGGTGCTGGGATGCAGCTGGG + Intergenic
1002043606 5:176530499-176530521 CTGGGAGCCCAGATGCAGGTCGG + Intronic
1002149094 5:177212070-177212092 CTGACTGCTTAGATTCAGCTGGG + Exonic
1002821324 6:727527-727549 CTGAGTGCTCAAATGCTGTTTGG + Intergenic
1005841215 6:29745668-29745690 CTGACTGCACAGATCCATCCTGG + Intergenic
1005870691 6:29972404-29972426 CTGACTGCACAGATCCATCCCGG + Intergenic
1006072095 6:31505654-31505676 CTGACTGCACAGATCCATCCTGG - Exonic
1006445856 6:34079448-34079470 CTGAATGCAACGATGAAGCTGGG - Intronic
1006828731 6:36955983-36956005 CTGAGAGAACAGATGCACCTTGG + Intronic
1007247313 6:40471898-40471920 CTGAGTGCCCAGAAGCAGCGAGG + Intronic
1007654348 6:43443237-43443259 CTCAGGGCACACATGCAGCAGGG - Intronic
1008616432 6:53230895-53230917 CAGAGTGTCCTGATGCAGCTGGG - Intergenic
1009909925 6:69913466-69913488 CTGAGAGAACAGATGAAGCCAGG + Intronic
1012752662 6:103183735-103183757 CTGACTTCACAGCTGCAACTTGG - Intergenic
1013614103 6:111825635-111825657 CAGAGTGCACATGAGCAGCTGGG - Intronic
1016051423 6:139534394-139534416 CTGAGCAAGCAGATGCAGCTTGG - Intergenic
1017100003 6:150840158-150840180 CTCTGTGCAGAGATGCAGCGTGG + Exonic
1020260343 7:6527262-6527284 CTGAGTGGGCAGCTGCAGATGGG - Intronic
1020441216 7:8218783-8218805 CTGAGTGCTCATTTGAAGCTGGG + Intronic
1020812529 7:12864414-12864436 CTGAGTTCACAGCTGCAGAAGGG + Intergenic
1022126676 7:27364440-27364462 GGGAGAGCACAGATGCTGCTGGG - Intergenic
1023042172 7:36181310-36181332 CAGTGTGCACAGATGCTGTTGGG + Intronic
1023489796 7:40726771-40726793 CTGACTGCACAGGTGCTGCTTGG + Intronic
1027752461 7:82167398-82167420 TTTAGTGCACAGATACAGCAAGG - Intronic
1027983551 7:85256101-85256123 CTGAGTTCACATAGGCATCTCGG - Intergenic
1028907694 7:96173498-96173520 ATAAGTGAACAAATGCAGCTGGG - Intronic
1031230998 7:119106144-119106166 CTGAGAACAAAGCTGCAGCTGGG + Intergenic
1031837129 7:126691428-126691450 CTGAGTCCGCAGCCGCAGCTAGG + Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG + Intergenic
1035755621 8:2029024-2029046 CTGAGGGCGAGGATGCAGCTGGG - Intergenic
1035819049 8:2571928-2571950 CTGAGTCCGCAGATGCAGAAGGG - Intergenic
1035987280 8:4448407-4448429 CTGTGTGCCCTGATGCAGATTGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037489989 8:19389019-19389041 TTGAGTGCTCAGATGGAGGTGGG + Intronic
1039469797 8:37806260-37806282 CTGAGTGCACAGTGGCTGTTAGG + Intronic
1040605909 8:48930936-48930958 CTGGTTGTACAGATGCAGTTTGG + Intergenic
1041468368 8:58180651-58180673 CTGAGGCCACAGATAGAGCTAGG - Intronic
1044683255 8:94802698-94802720 CTGATTGCACCACTGCAGCTTGG - Intergenic
1046597693 8:116280591-116280613 CTGCTTGCAGAGATGCAGATAGG - Intergenic
1046748220 8:117898406-117898428 CTCAGTGGACAGAAGGAGCTAGG + Intronic
1047905090 8:129464459-129464481 CTGAGGGAACAGAAGCAGCCTGG - Intergenic
1048313484 8:133344466-133344488 CCCACTGCACACATGCAGCTAGG + Intergenic
1049213382 8:141396851-141396873 CTGAGTGCACTGAGCCCGCTGGG + Intronic
1050163962 9:2745264-2745286 CTAGGTTCACAGATGCAGCCAGG - Intronic
1050929661 9:11307575-11307597 CTGAATGCTAAGATGAAGCTGGG - Intergenic
1051433164 9:17001585-17001607 CTAAGAGCAGAAATGCAGCTAGG + Intergenic
1051595127 9:18817624-18817646 CAGAGTGCAGAAATGCAGGTGGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057055038 9:91953937-91953959 CTGAATCCACACAAGCAGCTGGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058916235 9:109568568-109568590 ATGAGTGCACAGATGCACATGGG - Intergenic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061598058 9:131645531-131645553 CTGAGTTCACGGAGGCAGCCTGG - Intronic
1062150433 9:135015663-135015685 CTGAGTAGACAGAGGCAGCTGGG + Intergenic
1187956952 X:24528539-24528561 CTGAATGCATAGCTGCCGCTTGG + Intronic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1189717514 X:43881613-43881635 CAGAGAGCAAAGCTGCAGCTTGG + Intronic
1190710078 X:53061326-53061348 TTAACTGCACAGAAGCAGCTAGG - Intronic
1190722287 X:53159678-53159700 CTGAGTGCAAAGATGGAGAGAGG - Intergenic
1192210208 X:69123136-69123158 CTGTGTGTACAAATACAGCTTGG - Intergenic
1197718346 X:129726638-129726660 CTGAGGTCACAGTGGCAGCTAGG - Intergenic
1199713221 X:150487031-150487053 CTGACTCCACAGATACAGGTGGG + Intronic