ID: 1184830216

View in Genome Browser
Species Human (GRCh38)
Location 22:46981231-46981253
Sequence ACATAAGTATGATGGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184830210_1184830216 -3 Left 1184830210 22:46981211-46981233 CCCTGTATTTCTGCACATGTACA 0: 1
1: 0
2: 3
3: 31
4: 280
Right 1184830216 22:46981231-46981253 ACATAAGTATGATGGGAGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 242
1184830209_1184830216 3 Left 1184830209 22:46981205-46981227 CCTTGACCCTGTATTTCTGCACA 0: 1
1: 0
2: 1
3: 18
4: 246
Right 1184830216 22:46981231-46981253 ACATAAGTATGATGGGAGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 242
1184830211_1184830216 -4 Left 1184830211 22:46981212-46981234 CCTGTATTTCTGCACATGTACAT 0: 1
1: 0
2: 1
3: 16
4: 246
Right 1184830216 22:46981231-46981253 ACATAAGTATGATGGGAGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184830216 Original CRISPR ACATAAGTATGATGGGAGAG GGG Intronic
901336967 1:8457923-8457945 ACAGAAGTATGCCAGGAGAGAGG + Intronic
904452503 1:30623246-30623268 ACAACACTAAGATGGGAGAGGGG - Intergenic
905894766 1:41538358-41538380 ACAGAAATAAGAGGGGAGAGTGG + Intronic
906773841 1:48510681-48510703 ACCTAAGCATGATGGGAAAAGGG + Intergenic
908844044 1:68306613-68306635 GCAGAAGTATGATTGGAGAGAGG + Intergenic
909067689 1:70955516-70955538 AGATAAGGAGGAAGGGAGAGAGG + Intronic
910923515 1:92374806-92374828 ACATAAAGTTGATGGGTGAGAGG + Intronic
911057107 1:93718432-93718454 ACAGCAGTATGATGGGAGAAGGG + Intronic
914761749 1:150604712-150604734 ACAAAAGGATAATGAGAGAGTGG - Intronic
916763139 1:167834762-167834784 ACTGGAGTTTGATGGGAGAGGGG + Intronic
917636190 1:176939208-176939230 AGTTAGGTATGATGAGAGAGAGG - Intronic
918809781 1:189101108-189101130 TCAGAAGAATGAGGGGAGAGAGG + Intergenic
919229351 1:194753769-194753791 AAATAAGTATGATTTGAGACTGG + Intergenic
919692120 1:200537227-200537249 AAATAAATATGAGGGGAGTGTGG - Intergenic
920137553 1:203782166-203782188 ACATAAGCATGAGGGCAGGGAGG - Intergenic
920288947 1:204903027-204903049 TCATCAATATGATGGGAGAATGG - Intronic
921685488 1:218084241-218084263 ACATAAATTTGGTGGGAGTGGGG + Intergenic
921965932 1:221089694-221089716 ACCTAAGTTTGAAGGGAGCGTGG - Intergenic
923008775 1:230072150-230072172 TCAGAAAAATGATGGGAGAGGGG + Intronic
924902247 1:248413427-248413449 ACAATAGTATAATGGGATAGTGG + Intergenic
1065126998 10:22583542-22583564 ACATTAGCATGGTGGGGGAGTGG + Intronic
1065294433 10:24261091-24261113 ACATATGTATAATGGCAAAGAGG - Intronic
1065680741 10:28229019-28229041 ACACTAGAATGATAGGAGAGAGG + Intronic
1066985081 10:42458035-42458057 ACAAAAGCAAGATGGGAGAAAGG + Intergenic
1067695496 10:48532336-48532358 TCAGAAATATGATGGGAGAAGGG - Intronic
1068510310 10:57957442-57957464 AGTTAAGTATGATGGGACATCGG - Intergenic
1069630193 10:69892945-69892967 ATATAAGTGTGATGGGGGAGGGG - Intronic
1070986684 10:80695609-80695631 GACTGAGTATGATGGGAGAGGGG - Intergenic
1071713760 10:88074695-88074717 ACATATGTTTGATGGGGGAGGGG + Intergenic
1072979817 10:100090753-100090775 AAATAATTTTGATGGGAAAGGGG - Intergenic
1074572799 10:114639763-114639785 AGTGAAGTCTGATGGGAGAGCGG + Intronic
1074617293 10:115081814-115081836 AGATAATTATGGTGGGAGACAGG - Intergenic
1075518153 10:123126125-123126147 ACATATGAATTTTGGGAGAGGGG - Intergenic
1075877467 10:125819928-125819950 ACATAAGTATGAGGGTAAAATGG - Intronic
1078715666 11:13836814-13836836 TCATAAGTTTGAGGGAAGAGAGG + Intergenic
1079520122 11:21316585-21316607 ACAGAAGTATGATTGGAGGTGGG - Intronic
1080720014 11:34839481-34839503 CCATAATGATAATGGGAGAGTGG - Intergenic
1082886203 11:58085795-58085817 ACATCAGTAAGATGGAAGAATGG + Intronic
1083314666 11:61807052-61807074 AAAAAAGTACGATGGGAGAAAGG - Intronic
1083610505 11:64002113-64002135 ACATCAGTGTGATGGGAGGTGGG + Intronic
1085307171 11:75493291-75493313 ACATGAGTATAATGTGACAGAGG - Intronic
1089943124 11:122440392-122440414 CCCTAAGTAAGATGGGGGAGGGG + Intergenic
1090351695 11:126112134-126112156 ACATAGGTAGAATGGCAGAGAGG - Intergenic
1093269142 12:17037184-17037206 AAATAACTATGAAGGGAAAGAGG - Intergenic
1093473759 12:19532780-19532802 ACAAAAGTATGTGGGCAGAGGGG + Intronic
1095510530 12:42946934-42946956 ACAGGAGTGTCATGGGAGAGAGG + Intergenic
1097177819 12:57153419-57153441 GCTTAAGGATGATGGGAGTGGGG - Intronic
1098911112 12:76209849-76209871 ACTCTAGTATGATGTGAGAGGGG - Intergenic
1098930742 12:76409381-76409403 ACAGAAGTATGATTGGACAAAGG - Intronic
1099470958 12:83047206-83047228 AGATAAAGCTGATGGGAGAGGGG + Intronic
1100013887 12:89985446-89985468 ACATAGGAATGGTGGGAAAGAGG - Intergenic
1102083788 12:110119570-110119592 ACATCAGCAGGACGGGAGAGAGG - Intergenic
1104623241 12:130333797-130333819 ACATGAGTCTGAAGGGAGAAGGG + Intergenic
1106477311 13:30109435-30109457 ACATAAGGAGGAGGGGAGAAGGG + Intergenic
1106872723 13:34039037-34039059 ACAGAAGTGTGGTGGGAGAAGGG - Intergenic
1108225583 13:48285675-48285697 GCAAAAGTATGATGAGCGAGTGG - Intergenic
1110270339 13:73581964-73581986 ACATAAGTATGGGGGAAAAGGGG + Intergenic
1111033687 13:82641471-82641493 AAATAAGCAAGATGGGAAAGTGG - Intergenic
1111648281 13:91059289-91059311 ACTTAAGTTTGAAGGGTGAGAGG + Intergenic
1111802213 13:92995090-92995112 ACATAAGAATGAGAAGAGAGGGG - Intergenic
1112266583 13:97929681-97929703 GCAGAAATATCATGGGAGAGGGG + Intergenic
1116047040 14:39756116-39756138 ACATAATCATGATGGGGGTGGGG + Intergenic
1117007250 14:51433793-51433815 AATTAATTATAATGGGAGAGGGG - Intergenic
1117261470 14:54038659-54038681 AGATAGGTAAGCTGGGAGAGAGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126155699 15:45563800-45563822 ACAGAAGTATGCTGGAAGATTGG - Intergenic
1126612680 15:50545462-50545484 GGATAGGTATGTTGGGAGAGAGG - Intronic
1127055605 15:55127936-55127958 ACATGAGAAAGATGGAAGAGGGG - Intergenic
1128969235 15:72092332-72092354 AGAAAAGAATGATGGGAGAAAGG + Intronic
1131168614 15:90160765-90160787 ACAGAACTATGGTGGGAGGGAGG + Intronic
1132040684 15:98522482-98522504 ACATCAGGACGATGGGAGAGAGG - Intergenic
1132463142 16:65416-65438 TGCTAAGTATGATGGGAGCGGGG + Intronic
1132625548 16:889871-889893 ACACAAGTCTGAGGTGAGAGGGG + Intronic
1134238441 16:12486177-12486199 ACAGAAGAATGGTGGGAGAGAGG - Intronic
1134778676 16:16875646-16875668 ACAGAAGAATGATCGAAGAGTGG - Intergenic
1136014534 16:27387137-27387159 ACATCAGTATGGTGGGAAAAGGG - Intergenic
1137947369 16:52746942-52746964 AGATTACTCTGATGGGAGAGAGG - Intergenic
1138924099 16:61569683-61569705 CCACAATTATGATGGGACAGTGG - Intergenic
1139322018 16:66122558-66122580 ACATAAGCAAGATGAGAAAGAGG + Intergenic
1144356443 17:14451311-14451333 ACATTAGCATGAGGGGCGAGTGG + Intergenic
1146494235 17:33306747-33306769 ACATAATTACAATGGCAGAGTGG - Intronic
1148220467 17:45858229-45858251 ACATAAACAAGATGTGAGAGTGG + Intergenic
1149300813 17:55303433-55303455 ACAGAACTATGGTGGGAGAAGGG - Intronic
1149829863 17:59862508-59862530 ACATAAGATTCTTGGGAGAGTGG - Intronic
1151039455 17:70841648-70841670 ACATATGCATAATGGGAGAATGG + Intergenic
1153849037 18:9076350-9076372 ACATAATTAGGATGGAGGAGGGG + Intergenic
1154008925 18:10559276-10559298 AGCTAAGTCTGATGGGACAGTGG - Intergenic
1158325204 18:56306449-56306471 AAATAAGCAGGATGAGAGAGAGG - Intergenic
1159895400 18:73991268-73991290 ACAGAAGTATGATGGGATCAAGG + Intergenic
1160288904 18:77572317-77572339 AAAGATGGATGATGGGAGAGTGG + Intergenic
926572809 2:14547864-14547886 ACATTAGCATGATGGGAGTTGGG - Intergenic
928611501 2:32996432-32996454 ACATATGAATTTTGGGAGAGTGG + Intronic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
932958896 2:76388993-76389015 TCATAAATATAATTGGAGAGTGG - Intergenic
933934204 2:87187525-87187547 GCAAAAATAAGATGGGAGAGAGG - Intergenic
935493226 2:103746377-103746399 ACATCAGGGTGCTGGGAGAGTGG + Intergenic
935657912 2:105440810-105440832 TGATATGTATGATGGAAGAGGGG + Intergenic
936244612 2:110815966-110815988 ACAGATGGATGATGGGTGAGTGG + Intronic
936358938 2:111778370-111778392 GCAAAAATAAGATGGGAGAGAGG + Intronic
936746303 2:115580788-115580810 ACATATGTAAGATGGGAATGAGG - Intronic
940702951 2:157069337-157069359 ACCTAGGTCTGATGGGAGAGAGG - Intergenic
940778232 2:157906362-157906384 ACAAATGGAGGATGGGAGAGAGG + Intronic
943964625 2:194318183-194318205 AGATAACTATTAAGGGAGAGAGG - Intergenic
945773398 2:214074292-214074314 ACATAAATACAATGGAAGAGAGG + Intronic
946237748 2:218334867-218334889 ACCCAAGTATGATGAGAAAGAGG - Intronic
946583021 2:221151110-221151132 ACTTAAGCAAGATGGGATAGTGG - Intergenic
947395705 2:229684664-229684686 ACAGAAGTATTATGAGTGAGTGG + Intronic
948081705 2:235211717-235211739 ACAGAAATATGATGGTAGAAGGG - Intergenic
1168751905 20:288558-288580 ACATAGGTAGGCTGGGGGAGGGG - Intronic
1170146559 20:13181348-13181370 CCAGAAGCATGATGAGAGAGTGG - Intergenic
1172834976 20:37867633-37867655 AGAAAAGGATGAGGGGAGAGAGG - Intronic
1175192645 20:57221965-57221987 AGACAAGTGTCATGGGAGAGAGG + Intronic
1175194251 20:57231465-57231487 TCATGAGTATGCTAGGAGAGAGG + Intronic
1176201608 20:63863304-63863326 ACAAAAGGATGATGGGAACGGGG + Exonic
1176258745 20:64167731-64167753 AGATGAGGAAGATGGGAGAGAGG - Intronic
1177064788 21:16416852-16416874 AAATAAGTATCATGGAAAAGTGG + Intergenic
1177074777 21:16558174-16558196 AAAACAGTATGATGGCAGAGAGG - Intergenic
1178810675 21:35878483-35878505 AGACGAGTACGATGGGAGAGAGG + Intronic
1181691425 22:24564068-24564090 ACAAAAGTATTATGGGGTAGAGG - Intronic
1184830216 22:46981231-46981253 ACATAAGTATGATGGGAGAGGGG + Intronic
1184850197 22:47115475-47115497 ACGAAAGTCTGGTGGGAGAGTGG - Intronic
949297452 3:2542238-2542260 AGATAAGAATGATGGCTGAGAGG - Intronic
949806064 3:7957046-7957068 ACATAACAATGATGGTAGTGTGG + Intergenic
952185877 3:30968297-30968319 ATATTAGGAAGATGGGAGAGGGG + Intergenic
955583751 3:60453906-60453928 ACAAAAGTTTCAGGGGAGAGAGG + Intronic
955885743 3:63596403-63596425 AAATAAGGAGGATGAGAGAGGGG - Intronic
956152758 3:66260337-66260359 AGATAAGTTTGAAGGGAGACTGG + Intronic
956224468 3:66940713-66940735 ACAGAAGTATGATTGGACAAAGG - Intergenic
957413197 3:79866953-79866975 AAATGAGTAGGGTGGGAGAGAGG - Intergenic
957579333 3:82050528-82050550 TGATAAATATGTTGGGAGAGGGG + Intergenic
957780889 3:84816204-84816226 TCCTAAGTAGGCTGGGAGAGGGG + Intergenic
959360317 3:105381846-105381868 ACATCACTCTGATGGCAGAGGGG - Intronic
959749098 3:109812074-109812096 ACATGAGACAGATGGGAGAGGGG + Intergenic
959792804 3:110384641-110384663 ACATAAATATCATGGGATAGTGG + Intergenic
960239831 3:115327494-115327516 GCTAAAGTATGATGGCAGAGAGG - Intergenic
961312595 3:126013073-126013095 AAGTAAGGATGAGGGGAGAGTGG + Intronic
962781307 3:138720451-138720473 AGACGAGTGTGATGGGAGAGAGG - Intronic
963351435 3:144156736-144156758 AGATAAGTATGATTGTAGTGAGG - Intergenic
963542976 3:146617901-146617923 ACATATTTAAGAAGGGAGAGAGG - Intergenic
963637870 3:147822473-147822495 ACAAAAGCATGATTGGAAAGGGG - Intergenic
963845142 3:150147801-150147823 TCAGAAGAATGCTGGGAGAGAGG - Intergenic
965158000 3:165089303-165089325 AAATAAAGATGTTGGGAGAGAGG + Intergenic
970537518 4:17044180-17044202 GCATAACTATTATGGGGGAGAGG + Intergenic
975307612 4:72867085-72867107 ACTTGAGTATGGTGGGGGAGGGG + Intergenic
976698629 4:87945253-87945275 ACATACATATGATTGGAGTGGGG + Intergenic
977452238 4:97213322-97213344 ACAGAAGTATTAAGGTAGAGAGG + Intronic
977778297 4:100949797-100949819 ACATGAGGATGATGGTAGACAGG + Intergenic
980098785 4:128520617-128520639 AAATAAGTGTGATCAGAGAGGGG + Intergenic
980626585 4:135381284-135381306 ACAGAAGCAAGATGGGAGGGCGG - Intergenic
981027139 4:140088197-140088219 AAAAAAGTGTGATGGGAGGGAGG + Intronic
983967264 4:173828126-173828148 ACATAAGTCAAATGGGAGATAGG + Intergenic
985770296 5:1805614-1805636 ACATAAGTCAGATGGGGGACTGG + Intronic
985899092 5:2773357-2773379 GTATAAGTATATTGGGAGAGTGG - Intergenic
987107010 5:14649467-14649489 ACATATGAATGGTGGGGGAGGGG - Intergenic
990027753 5:51215863-51215885 ATATGTGTATGATGGGGGAGGGG + Intergenic
990849620 5:60188107-60188129 ACATATGTATTATTTGAGAGAGG - Intronic
992272184 5:75076498-75076520 ACATCAGGGTGCTGGGAGAGTGG - Intronic
993340386 5:86718295-86718317 AGAGAAGAATGATGGGAGAAGGG - Intergenic
993786278 5:92141729-92141751 ACCTCAGTATGATTGGAGGGAGG + Intergenic
995366234 5:111364526-111364548 ATCTAAGAATGAAGGGAGAGAGG + Intronic
995815198 5:116159417-116159439 ACTCAAGTATCATTGGAGAGAGG + Intronic
995978848 5:118076943-118076965 ACATGAGTATTTTGGAAGAGAGG - Intergenic
997286158 5:132680200-132680222 ACATAAGAGTCATGGGGGAGGGG + Intronic
997853294 5:137351814-137351836 ACATAATCATGATGGGAGTAGGG + Intronic
1000322891 5:160148951-160148973 ACATCAGTGAGAAGGGAGAGTGG + Intergenic
1001345590 5:170894707-170894729 ACATAAGTATGTTTGGAGTGTGG - Intronic
1002644400 5:180646084-180646106 ACTTGAGTATGATGGGACAGAGG - Intronic
1002969182 6:1996508-1996530 ACATAAGTCTGCTGGTAGACAGG + Intronic
1003693288 6:8376129-8376151 GCATATGTAGGATGGGCGAGAGG - Intergenic
1003736577 6:8884083-8884105 ACATACTTGTGATGAGAGAGGGG + Intergenic
1004066362 6:12248540-12248562 AACTAAGCATGATGGAAGAGAGG + Intergenic
1004069282 6:12283224-12283246 ACATGAGTATGCTGGGAAAAGGG - Intergenic
1005827620 6:29644252-29644274 TTATAAGTAGGATGGGGGAGGGG + Intergenic
1006660940 6:35643709-35643731 ACAGAAGTAGGATTTGAGAGAGG - Intronic
1008616640 6:53232846-53232868 ACATGAGTTTAATAGGAGAGGGG - Intergenic
1009459932 6:63900355-63900377 AAATAAGTACAATGGGGGAGGGG + Intronic
1009953456 6:70423180-70423202 AAATAAGTATGATGGGAGTGAGG + Intronic
1010544659 6:77137534-77137556 AAATAAGTATGATGGATGAATGG + Intergenic
1011355800 6:86472301-86472323 AGAGAAGAATCATGGGAGAGGGG + Intergenic
1011535671 6:88373542-88373564 ACATGAGCATTATTGGAGAGAGG + Intergenic
1012527010 6:100189984-100190006 CCATAAGTATGATGGAAGATTGG - Intergenic
1013024379 6:106255287-106255309 ACATAAGCATGATGGGGGAAGGG + Intronic
1014135051 6:117879375-117879397 ACTTAAGTATTATGGGAGATAGG + Intergenic
1014664288 6:124217208-124217230 ACAGAAGCATCCTGGGAGAGGGG + Intronic
1014939753 6:127423863-127423885 ACAAAATGATGATGGGAGACAGG - Intergenic
1015010083 6:128335189-128335211 TCATCAGTAAGATGGTAGAGAGG - Intronic
1015383711 6:132598866-132598888 AGAGAAGAAGGATGGGAGAGAGG + Intergenic
1015916147 6:138219226-138219248 AGATAATTATGTTGGGAGAGAGG + Intronic
1020557969 7:9693275-9693297 ACAGTGGTATGATGGGACAGTGG - Intergenic
1021910703 7:25383502-25383524 ACTTGGGTAAGATGGGAGAGTGG - Intergenic
1022012410 7:26320359-26320381 ACAGAAGTGGGATGGGTGAGGGG - Intronic
1023180176 7:37474584-37474606 ACATAAGAATCATGGGAGTTGGG + Intergenic
1023323090 7:39021654-39021676 ACATAACTATAATGGAATAGAGG - Intronic
1023431552 7:40097173-40097195 ATATATTTATGTTGGGAGAGTGG + Intergenic
1023525068 7:41093396-41093418 ACATAATTATGGTTGGATAGGGG + Intergenic
1023537191 7:41225861-41225883 AACTGAGTATGATGGGGGAGAGG + Intergenic
1023690526 7:42781485-42781507 ACATAAGAAGAATGGGAGAAAGG + Intergenic
1025929543 7:65982714-65982736 ACATAAAGATGCAGGGAGAGAGG + Intergenic
1026248615 7:68646932-68646954 ACATCAGTCTGATGGCATAGAGG + Intergenic
1026363662 7:69625990-69626012 AGATAAGTGTGATGGAAGGGAGG + Intronic
1026732963 7:72927209-72927231 ACAAAAGTATGAGGGTAGCGTGG - Intronic
1027512447 7:79099622-79099644 ACTTAAGGGTGAAGGGAGAGAGG - Intronic
1028776604 7:94684336-94684358 AAAGAAGTAAGAAGGGAGAGAGG - Intergenic
1029263708 7:99322565-99322587 AGATTAGTATCATGGGTGAGGGG - Intergenic
1030505872 7:110421521-110421543 AGATAAGTTTGATGGGACAGTGG - Intergenic
1032827379 7:135584188-135584210 AGATATGTATGAGTGGAGAGGGG + Intronic
1033970259 7:147030596-147030618 ATAAAAGTATAAAGGGAGAGTGG - Intronic
1034600680 7:152252188-152252210 AATTAAGTATGAGAGGAGAGAGG + Intronic
1035244965 7:157556253-157556275 GCATATGTATGATGTGAGTGTGG - Intronic
1035244980 7:157556540-157556562 ACATATGTATGACGTGAGGGTGG - Intronic
1035636969 8:1154999-1155021 ACAGAAGCAGGATGGGAGGGAGG - Intergenic
1037096364 8:14992145-14992167 AGATGAGGATGATGGGGGAGAGG - Intronic
1037839271 8:22232362-22232384 ACTTTAGGATGCTGGGAGAGGGG + Intergenic
1037929452 8:22869192-22869214 ACATAAATAGGATGGCAGAGTGG - Intronic
1038495355 8:27998180-27998202 TCATAATTTTGAGGGGAGAGGGG - Intergenic
1038646327 8:29365392-29365414 AGAGAAGAATGATGGGGGAGTGG + Intergenic
1041302389 8:56426369-56426391 ACTTGAGTGTGAAGGGAGAGAGG - Intergenic
1041612292 8:59865248-59865270 ACAAAAATTTGATGGCAGAGGGG - Intergenic
1041825139 8:62087037-62087059 ATATAAGTATCATGGCATAGAGG + Intergenic
1042198723 8:66258580-66258602 ACATAATTCAGATGGCAGAGTGG + Intergenic
1042387148 8:68189729-68189751 ACATAACACTGATGGGAGTGTGG - Intronic
1044326473 8:90864693-90864715 ACAGAGAAATGATGGGAGAGAGG - Intronic
1044496070 8:92884828-92884850 ACGTAAATGTGATGGGAGTGGGG + Exonic
1047037622 8:120956720-120956742 ACATCAGAGTGGTGGGAGAGAGG + Intergenic
1048125618 8:131632152-131632174 CCATAAGTTTAGTGGGAGAGGGG - Intergenic
1050758436 9:9036776-9036798 ATATATGTATCAGGGGAGAGAGG - Intronic
1051039592 9:12791145-12791167 ACATAAGTAAGATGGATGAATGG + Intronic
1051690787 9:19710104-19710126 ACAGAAGAAAGATTGGAGAGGGG + Intronic
1053469093 9:38332890-38332912 AAATAAGTATGTTGGCAGTGTGG + Intergenic
1053656124 9:40219745-40219767 ATATAATTATCATGGGATAGTGG + Intergenic
1053906470 9:42848942-42848964 ATATAATTATCATGGGATAGTGG + Intergenic
1054368229 9:64365958-64365980 ATATAATTATCATGGGATAGTGG + Intergenic
1054528491 9:66156549-66156571 ATATAATTATCATGGGATAGTGG - Intergenic
1054675850 9:67855712-67855734 ATATAATTATCATGGGATAGTGG + Intergenic
1054863687 9:69978344-69978366 TCATAAGTGGGATGAGAGAGTGG + Intergenic
1055099388 9:72447365-72447387 ACCTAAGTATGAGGGGGAAGGGG - Intergenic
1055290910 9:74780939-74780961 ATAAAAGTATGTTGGGAAAGAGG + Intronic
1058191742 9:101924843-101924865 ACAGAAGAATGAAGGGACAGAGG + Intergenic
1059551033 9:115229138-115229160 ACATAAGTGTCATGGTAGAAAGG - Intronic
1059695197 9:116723965-116723987 TTACAAGTAAGATGGGAGAGGGG - Intronic
1059857544 9:118416596-118416618 CCATAAGGATGATGGCAGAAGGG + Intergenic
1060259172 9:122058603-122058625 GCTCAAATATGATGGGAGAGGGG + Intronic
1185589197 X:1262635-1262657 ACATAAGCAAGATGGGCCAGGGG - Intergenic
1187650670 X:21401511-21401533 ACATAATTATGAAAGGAAAGGGG - Intronic
1188920456 X:35970057-35970079 ACGTAAGTATGGGGGGAGGGGGG - Intronic
1190018918 X:46854273-46854295 AGATGAGTCTGTTGGGAGAGGGG - Intronic
1190322453 X:49186959-49186981 TTATAAGGATGAGGGGAGAGAGG - Intergenic
1193671372 X:84390182-84390204 ACAAAACAATGATGGGGGAGGGG - Intronic
1194756017 X:97741066-97741088 ACATTAGCATGCTGGGAGGGTGG - Intergenic
1195386225 X:104315882-104315904 AGCTAAGTATTATGGAAGAGAGG + Intergenic
1197600704 X:128524951-128524973 ACATCATTATGATCAGAGAGAGG + Intergenic
1197947037 X:131850895-131850917 AACTAAGTATGATGGTAGAATGG + Intergenic
1197951373 X:131901155-131901177 AGATTAGTGGGATGGGAGAGGGG - Intergenic
1198329252 X:135606358-135606380 ACAGATGTATGATGATAGAGTGG + Intergenic
1198786392 X:140292886-140292908 ACATAAGTATTATGTGACATTGG + Intergenic
1198820363 X:140640728-140640750 ACACAAGTATAAAGTGAGAGAGG + Intergenic
1198820660 X:140644747-140644769 CCATATGTATGATGGGGCAGTGG + Intergenic
1198853782 X:140994844-140994866 ACATAGGTATGATGGAAGTTAGG - Intergenic
1199252345 X:145677505-145677527 TCATACGGATGACGGGAGAGCGG + Intergenic
1199374591 X:147092152-147092174 ACATAAGTGTGAAAGGAGGGAGG + Intergenic