ID: 1184831564

View in Genome Browser
Species Human (GRCh38)
Location 22:46992111-46992133
Sequence TGGGATCCCCTGACACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184831564_1184831567 5 Left 1184831564 22:46992111-46992133 CCTGTCTGTGTCAGGGGATCCCA No data
Right 1184831567 22:46992139-46992161 ACCCCACAGAGCCACACTCGTGG 0: 1
1: 0
2: 0
3: 14
4: 117
1184831564_1184831572 28 Left 1184831564 22:46992111-46992133 CCTGTCTGTGTCAGGGGATCCCA No data
Right 1184831572 22:46992162-46992184 CTGTGATTCTTCACAGTGCAAGG 0: 1
1: 0
2: 0
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184831564 Original CRISPR TGGGATCCCCTGACACAGAC AGG (reversed) Intronic
No off target data available for this crispr