ID: 1184832589

View in Genome Browser
Species Human (GRCh38)
Location 22:46998587-46998609
Sequence CCTTCTGTGCTAAAGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184832589_1184832598 11 Left 1184832589 22:46998587-46998609 CCCTGCGCCTTTAGCACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1184832598 22:46998621-46998643 GTCTTCACGGGAAGGGCGCTCGG No data
1184832589_1184832600 17 Left 1184832589 22:46998587-46998609 CCCTGCGCCTTTAGCACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1184832600 22:46998627-46998649 ACGGGAAGGGCGCTCGGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 29
1184832589_1184832594 -1 Left 1184832589 22:46998587-46998609 CCCTGCGCCTTTAGCACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1184832594 22:46998609-46998631 GCCGTAACAGCAGTCTTCACGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1184832589_1184832593 -2 Left 1184832589 22:46998587-46998609 CCCTGCGCCTTTAGCACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1184832593 22:46998608-46998630 GGCCGTAACAGCAGTCTTCACGG 0: 1
1: 0
2: 1
3: 3
4: 51
1184832589_1184832596 3 Left 1184832589 22:46998587-46998609 CCCTGCGCCTTTAGCACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1184832596 22:46998613-46998635 TAACAGCAGTCTTCACGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1184832589_1184832599 16 Left 1184832589 22:46998587-46998609 CCCTGCGCCTTTAGCACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1184832599 22:46998626-46998648 CACGGGAAGGGCGCTCGGTTTGG 0: 1
1: 0
2: 1
3: 1
4: 38
1184832589_1184832597 4 Left 1184832589 22:46998587-46998609 CCCTGCGCCTTTAGCACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1184832597 22:46998614-46998636 AACAGCAGTCTTCACGGGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184832589 Original CRISPR CCTTCTGTGCTAAAGGCGCA GGG (reversed) Intronic
904944661 1:34190319-34190341 CATTTTGTTCTAAAGGCACAGGG - Intronic
905602327 1:39264208-39264230 CCCTCTTTGCTATAGGCACAAGG - Intronic
906034206 1:42740594-42740616 CCTTCTGTCCTAAAGTCAAAGGG - Intergenic
908276983 1:62483535-62483557 CTTTCTGAGGTAAAGGCTCATGG + Intronic
912258319 1:108083743-108083765 TCTTCTTTCCTAAAGGCACAGGG - Intergenic
915713162 1:157920408-157920430 CCTTCAGAGCTGAAGGAGCAAGG - Intergenic
919731792 1:200917314-200917336 CCTTTTGTGGTAAATGGGCAGGG + Intergenic
922654597 1:227370596-227370618 CCTTTTGTGCTAAAGGGGCCGGG - Intergenic
923462710 1:234220993-234221015 CCTTATGTCCTAAATGTGCACGG - Intronic
923986152 1:239385097-239385119 CCTTGTGTACTAAAGGAGAAAGG - Intergenic
924266004 1:242282966-242282988 CCTTCTGTGCTAAAGGAAACTGG - Intronic
1062870490 10:898787-898809 CCTGCTGTGCTAAATAGGCATGG - Intronic
1064137278 10:12761963-12761985 CCTTCTGTGCCAACGGGGAAAGG - Intronic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1066718833 10:38315571-38315593 CCTTCTGTGCTAAAGGAAACTGG + Intergenic
1067054726 10:43043982-43044004 CCTTCTCTGCAAAAGCCCCAAGG + Intergenic
1076352158 10:129824540-129824562 GCTTCTGTGCTCGAGGCACATGG - Intergenic
1077409803 11:2398703-2398725 CCTTGTGTGCCCAAGGGGCAGGG - Intergenic
1078018248 11:7633676-7633698 TCCTCTGGGCTAAAGGCTCAAGG - Intronic
1078773126 11:14369453-14369475 CCTTCTGTGCCCATGGGGCAAGG + Intergenic
1082858822 11:57834085-57834107 CCGTGTGTTTTAAAGGCGCAGGG - Intergenic
1084051133 11:66600705-66600727 CTTTCTGTGATCAAGGCCCAGGG + Intronic
1087753504 11:102030639-102030661 CCTTATGTGCCAAAGACACATGG + Intergenic
1093948070 12:25133534-25133556 TCTTCTGTGCTGAAGGGGGAAGG - Intronic
1103704830 12:122865854-122865876 CCATGTGTGCTGAAGGCCCAGGG - Exonic
1107036130 13:35904633-35904655 CCTTCTTTCCTAAAGGCAAAAGG - Intronic
1107256348 13:38432078-38432100 ACTTCTGTGCTAAAGTCCCCAGG - Intergenic
1110324942 13:74202868-74202890 GCTTCTTTCCTAAAGGAGCACGG + Intergenic
1113900638 13:113794917-113794939 CCTTCCGTGCAGAAGGCGCCTGG + Intronic
1116495431 14:45554265-45554287 CCTTCTTTGCTAAATGAGTAGGG + Intergenic
1117475464 14:56090183-56090205 CCATCAGTGCCAAAGGCCCATGG + Intergenic
1118688854 14:68318727-68318749 CCTTCGGGGCTTAAGGGGCAAGG - Intronic
1128857368 15:71030947-71030969 TCTTTTGAGCTAAAGGAGCATGG - Intronic
1134630214 16:15750760-15750782 CCTTCTGTGCTCCAGGCCCTGGG + Intronic
1134812220 16:17177351-17177373 CCTTCTCTTCTAAAGGACCAGGG - Intronic
1146515829 17:33488723-33488745 TGTTCTGAGCTAAAGGCTCAGGG - Intronic
1148069762 17:44901663-44901685 CCTGCTGGACTAAAGGGGCAGGG - Intronic
1155070043 18:22307045-22307067 CCTGATGTGCTCAAGGCACAGGG + Intergenic
1157684473 18:49631264-49631286 CCTTCGGTACTAACGGCACATGG - Intergenic
1164975008 19:32566406-32566428 CTTTCTGGGCTCAAGGAGCATGG - Intergenic
927007809 2:18868390-18868412 ACTTCTGTCCTATAGGGGCAAGG - Intergenic
929257600 2:39829918-39829940 CCCTCTGAGCTAAAGGAGCATGG - Intergenic
931088500 2:58861330-58861352 CTTTCTGTGCTAAGGGTTCAAGG - Intergenic
1170342437 20:15344413-15344435 TCTTCTGTGCTACAGGCTTAGGG + Intronic
1170800271 20:19584681-19584703 CCTTATGAGCTAAAGGCTCTTGG - Intronic
1173307949 20:41869230-41869252 CCTTCTTTGCTGATGGCTCAAGG + Intergenic
1173742674 20:45412461-45412483 CCTTCTGTGCAAAAGCCTCTAGG + Intergenic
1174698295 20:52582263-52582285 CCTTCTTTGCTCCAGGAGCAAGG - Intergenic
1180598444 22:16996005-16996027 TCCTCTGAGCTAAAGGAGCATGG + Intronic
1182713941 22:32340317-32340339 CCTTCTGTGCACAAGGCACTGGG + Intergenic
1183021353 22:35029889-35029911 TCCTCTGAGCTAAAGGAGCATGG - Intergenic
1184401253 22:44275901-44275923 CCTTCTGTGCACAAGGCACGGGG + Intronic
1184832589 22:46998587-46998609 CCTTCTGTGCTAAAGGCGCAGGG - Intronic
949414613 3:3800745-3800767 CCTTCTGGGCTCAAGGCTCACGG - Intronic
968984546 4:3867979-3868001 TCTTCTGTGCTAAAGTGGAAAGG + Intergenic
974045860 4:56897989-56898011 CCTTCTCTGTTTAAGGTGCAAGG - Intergenic
975635914 4:76447975-76447997 CCTTCTCTGTTAAAGAAGCAAGG - Intronic
976092849 4:81474835-81474857 TCCTCTGTGCTAAAGGAGCATGG + Intronic
979423759 4:120538820-120538842 CCTTCTGAGCTGACAGCGCAAGG + Intergenic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
985031842 4:185797121-185797143 CCTGCGTTGCTAGAGGCGCATGG - Intronic
996290920 5:121851820-121851842 CCTTCTGTTCCAGAGGCGCGGGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000132464 5:158313293-158313315 CCTGCTGTGCAAAAGGAGCCGGG + Intergenic
1005805686 6:29472298-29472320 CCTTCTGTGCTCTAGGGCCAGGG + Intergenic
1011497387 6:87950051-87950073 CCTTCAGTGCTAGAGGCTCGAGG - Intergenic
1011688191 6:89840946-89840968 CCTTCTGTGATAATGGAGCTAGG - Intronic
1017453430 6:154575858-154575880 CCTGCTGTGTTAAAGGATCAGGG + Intergenic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1019482172 7:1271990-1272012 CCTCCTGAGCCCAAGGCGCAAGG - Intergenic
1019990896 7:4690035-4690057 CCTGCAGTGCCAAAGGCGAAGGG + Intronic
1026780103 7:73260516-73260538 CCTTCTCTGATAAAGGCGTTAGG - Intergenic
1027067068 7:75131990-75132012 CCTTCTCTGATAAAGGCGTTAGG + Intronic
1029854344 7:103499046-103499068 CATTCTGTGCTAGAGGCTGAAGG - Intronic
1032443332 7:131959173-131959195 CCTTCTGGGCTTCAGGCACAGGG - Intergenic
1032947213 7:136868696-136868718 CCTGCTGTACTAAAGGCGCCAGG + Exonic
1033657624 7:143383604-143383626 CTTTCTGGGGTAAAGGCACAAGG - Intronic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1037987703 8:23299963-23299985 CCTCCTTAGCTAAAGGCACAGGG - Intronic
1047789396 8:128187191-128187213 CAGTCAGTGCTACAGGCGCAGGG + Intergenic
1049988503 9:972504-972526 CCTTGTGTTCTAAAGTCGCAGGG + Intergenic
1050168200 9:2788526-2788548 CCTTCTGTGCCAAGGGAACAGGG - Intronic
1051378858 9:16434823-16434845 CCTTCTGTGCATAATCCGCATGG + Intronic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1055157998 9:73088171-73088193 TCTTCTGTGCTAAATGCACGTGG - Intergenic
1055218628 9:73899351-73899373 CTTTCAGTGCTAAAGGCTAATGG + Intergenic
1060818036 9:126645665-126645687 CCTTGTGTGCTCAAGGCTCCTGG - Intronic
1186518750 X:10186837-10186859 CCTTTTGTGCTACAGTGGCAGGG + Intronic
1188915320 X:35903795-35903817 TCCTCTGAGCTAAAGGAGCATGG - Intergenic
1188921789 X:35986550-35986572 TCCTCTGAGCTAAAGGAGCATGG - Intronic
1193827621 X:86245458-86245480 CCTTCTGCTCTAAAGGGGCAAGG - Intronic
1197799717 X:130336742-130336764 CCCTCAGTGCTACAGGTGCAAGG + Intergenic
1202039650 Y:20668488-20668510 CTTTCTGTGGCAAAGGGGCATGG - Intergenic