ID: 1184832680

View in Genome Browser
Species Human (GRCh38)
Location 22:46999605-46999627
Sequence CAAGTGATGAAACAGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184832680_1184832686 0 Left 1184832680 22:46999605-46999627 CCCCTCACCTGTTTCATCACTTG 0: 1
1: 0
2: 3
3: 27
4: 263
Right 1184832686 22:46999628-46999650 CCTCCTAGAGAAAGGATTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 189
1184832680_1184832691 19 Left 1184832680 22:46999605-46999627 CCCCTCACCTGTTTCATCACTTG 0: 1
1: 0
2: 3
3: 27
4: 263
Right 1184832691 22:46999647-46999669 GTGGGTTGGAACTTTTTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 144
1184832680_1184832687 1 Left 1184832680 22:46999605-46999627 CCCCTCACCTGTTTCATCACTTG 0: 1
1: 0
2: 3
3: 27
4: 263
Right 1184832687 22:46999629-46999651 CTCCTAGAGAAAGGATTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 195
1184832680_1184832690 18 Left 1184832680 22:46999605-46999627 CCCCTCACCTGTTTCATCACTTG 0: 1
1: 0
2: 3
3: 27
4: 263
Right 1184832690 22:46999646-46999668 TGTGGGTTGGAACTTTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 151
1184832680_1184832684 -8 Left 1184832680 22:46999605-46999627 CCCCTCACCTGTTTCATCACTTG 0: 1
1: 0
2: 3
3: 27
4: 263
Right 1184832684 22:46999620-46999642 ATCACTTGCCTCCTAGAGAAAGG 0: 1
1: 1
2: 3
3: 93
4: 568
1184832680_1184832689 5 Left 1184832680 22:46999605-46999627 CCCCTCACCTGTTTCATCACTTG 0: 1
1: 0
2: 3
3: 27
4: 263
Right 1184832689 22:46999633-46999655 TAGAGAAAGGATTTGTGGGTTGG 0: 1
1: 0
2: 2
3: 35
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184832680 Original CRISPR CAAGTGATGAAACAGGTGAG GGG (reversed) Intronic
900160930 1:1223497-1223519 CAGGTGAGGAAACGGGTGTGGGG - Intronic
900177834 1:1298559-1298581 CAAGACATGGAACCGGTGAGAGG - Exonic
900616486 1:3567860-3567882 TAAGTGAGGAAAGAGGGGAGGGG - Intronic
905906261 1:41620452-41620474 GAAGTGCTCAGACAGGTGAGAGG - Intronic
907580993 1:55572624-55572646 CATGTGATGACACAGAGGAGAGG - Intergenic
908258988 1:62324949-62324971 CAAGTGCTGAAAAGGATGAGGGG - Intergenic
909317623 1:74243886-74243908 CAGGTGATGAAAAATGTAAGGGG + Intronic
909379524 1:74982370-74982392 CAAGGGAGGAAACTGGTGGGAGG + Intergenic
910014551 1:82505633-82505655 AAAATGATGAAAAATGTGAGAGG + Intergenic
910212155 1:84804445-84804467 TAAGTGATAACTCAGGTGAGCGG - Intergenic
910245651 1:85135480-85135502 CAAGGCCTGAAAGAGGTGAGGGG + Intergenic
910552046 1:88486328-88486350 CAGGTCTTGACACAGGTGAGAGG + Intergenic
911583437 1:99661975-99661997 CAAGTTGTGAAATAGGTGTGAGG - Intronic
913471292 1:119189940-119189962 GAACTGATGAAGCATGTGAGAGG - Intergenic
913590563 1:120320709-120320731 CAAGTGAGAAGACAAGTGAGAGG + Intergenic
913617621 1:120577654-120577676 CAAGTGAGAAGACAAGTGAGAGG - Intergenic
914313923 1:146490614-146490636 CAAGTTATCAAATATGTGAGCGG + Intergenic
914500425 1:148242766-148242788 CAAGTTATCAAATATGTGAGCGG - Intergenic
914572650 1:148933318-148933340 CAAGTGAGAAGACAAGTGAGAGG + Intronic
914600190 1:149196944-149196966 CAAGTGAGAAGACAAGTGAGAGG - Intergenic
916086984 1:161278059-161278081 AAACTGATGATACAGGAGAGGGG - Intronic
916367364 1:164046812-164046834 AAAGTGATGAGAAAGGTAAGTGG - Intergenic
916852785 1:168720506-168720528 CAAGTGATGAACAAGGTAAAAGG + Intronic
918013510 1:180610006-180610028 CAAGAGAAGAAACAGTGGAGTGG + Intergenic
918075124 1:181165117-181165139 CAAGGGAGGGACCAGGTGAGAGG - Intergenic
924025983 1:239833390-239833412 CAAGAGAAGAACCAGGGGAGAGG + Intronic
1064355886 10:14617560-14617582 GAAGTGATGAAACACGTAAGTGG + Intronic
1065173942 10:23059212-23059234 TAAATGATGAAAGAGGGGAGGGG - Intergenic
1066577176 10:36838958-36838980 AAAGTAATGAACAAGGTGAGTGG + Intergenic
1067758871 10:49027827-49027849 CAAGTCATCCAGCAGGTGAGTGG - Intronic
1067994175 10:51251220-51251242 CAATTTATGAAACAGGTGCCTGG - Intronic
1068159508 10:53245876-53245898 CATGGGAGGAATCAGGTGAGAGG - Intergenic
1068279840 10:54854487-54854509 TGAGTGATAAAACAGTTGAGAGG + Intronic
1069321367 10:67175559-67175581 CAAGAGAAGAAACAAGTGGGTGG + Intronic
1070421484 10:76241813-76241835 AAAGTCATGAAGCTGGTGAGTGG - Intronic
1070737831 10:78876531-78876553 CAAGTGAAGACAGAGGGGAGGGG - Intergenic
1071305333 10:84294505-84294527 CATATGATGGAAAAGGTGAGGGG - Intergenic
1072202405 10:93172487-93172509 CACGTGATGAAAGGGGTAAGAGG - Intergenic
1074616885 10:115078645-115078667 CAAGTGATGATAGAGGAGAGAGG - Intergenic
1079327933 11:19510557-19510579 CAGGTGAGGAAACAGGTGAGAGG + Intronic
1081318708 11:41664153-41664175 AAAGTGATGACACAGTTGGGGGG - Intergenic
1083152687 11:60802737-60802759 AAAGTCATGAAAAAGCTGAGAGG - Intergenic
1083718509 11:64592497-64592519 CAAGTGGAGAGACAGGAGAGAGG + Intronic
1084667295 11:70583250-70583272 CAACTGATGCAAGAGGTGGGAGG + Intronic
1085327530 11:75618644-75618666 CATCTGAGGAAGCAGGTGAGAGG - Intronic
1085831537 11:79906260-79906282 CAAGGGAAGAATCAGGGGAGAGG + Intergenic
1086286636 11:85259269-85259291 CAAATGATGAAGCAGGAGAGAGG - Intronic
1086390195 11:86355799-86355821 CAAGGGAAGAATCAGGGGAGAGG + Intergenic
1086955443 11:92930458-92930480 CAAGGGAAGAATCAGGGGAGAGG - Intergenic
1088983358 11:114883829-114883851 CAAGTGAAATAACAGGTCAGAGG + Intergenic
1089055664 11:115582890-115582912 CAAGGGAAGAATCAGGGGAGAGG - Intergenic
1089387012 11:118075027-118075049 CAGGTGATGAACCAGGAAAGAGG - Intergenic
1090743964 11:129692155-129692177 CAAGACTTGAAGCAGGTGAGGGG - Intergenic
1091124051 11:133080920-133080942 CTAGTGGGGACACAGGTGAGTGG + Intronic
1091503635 12:1043358-1043380 CAAGAGATGAAGCAGGTAAAAGG + Intronic
1091975149 12:4818393-4818415 CAAGTTATGAAACAGTTCTGTGG + Intronic
1092918524 12:13209680-13209702 TAAATGAGGAAACAGATGAGCGG + Intronic
1093195758 12:16127924-16127946 CAAGAGATGTAACAGGTTGGGGG + Intergenic
1093384174 12:18530769-18530791 CACGTGGTGGAGCAGGTGAGGGG - Intronic
1094018807 12:25892364-25892386 CAAGTGATGGAAAATATGAGGGG + Intergenic
1094631443 12:32179247-32179269 CAAGTGATGAAGCAGTTCTGTGG + Intronic
1095577008 12:43751856-43751878 AAAGTCAGGAAACAGGTGACAGG - Intronic
1096064339 12:48727545-48727567 CAACTGAAGAAACAAGTAAGGGG + Intergenic
1098359074 12:69637608-69637630 CAAGTCATGAAACAGGTCCAGGG + Intergenic
1099184222 12:79500073-79500095 CAACAGATGACACAGATGAGAGG - Intergenic
1099248701 12:80225244-80225266 CAAGTGAGAAAACAAGTGAGGGG - Intronic
1100597709 12:96086064-96086086 CAAGGGAGCAAACTGGTGAGAGG + Intergenic
1100828715 12:98498451-98498473 AAAGTGATGGAGAAGGTGAGAGG - Intronic
1103204273 12:119116149-119116171 CCAGGGTTGAAACAGATGAGAGG - Intronic
1106049656 13:26178352-26178374 CATGTGGTGAAACGGGAGAGGGG + Intronic
1108483028 13:50894545-50894567 CAAGGGAAGAATCAGGGGAGAGG + Intergenic
1108979797 13:56496321-56496343 CAAGTGATGAAAGATGTTAAAGG - Intergenic
1108992244 13:56674569-56674591 AAAGTAATGAAACTGGTAAGAGG + Intergenic
1110279023 13:73671157-73671179 CAAGGGATGGGAAAGGTGAGAGG - Intergenic
1110492937 13:76130214-76130236 CAAGTGTTGATGCAGGTGACAGG + Intergenic
1110588147 13:77219732-77219754 AAAAGGAGGAAACAGGTGAGTGG + Intronic
1112081705 13:95979415-95979437 CCAGGGATGAAACGGGTGAAGGG - Intronic
1115505720 14:34092576-34092598 CAAGAGAGGAAGCAAGTGAGGGG + Intronic
1116845515 14:49861794-49861816 CCTGTGATGACAGAGGTGAGGGG - Intergenic
1119859740 14:77927556-77927578 CAAGTGAACAAACAGGTGAATGG + Intronic
1120647126 14:87087296-87087318 CAAGGAATGCAAGAGGTGAGCGG + Intergenic
1121220151 14:92278962-92278984 CACGTGAGGGAACAAGTGAGGGG - Intergenic
1122064986 14:99166646-99166668 CATGTTATGAAACAGGACAGGGG - Intergenic
1122110956 14:99501891-99501913 CATTTGAAGAAACAGTTGAGTGG + Exonic
1123167592 14:106341222-106341244 CAAGGGAGGGACCAGGTGAGAGG + Intergenic
1123170212 14:106365935-106365957 CAAGGGAGGGACCAGGTGAGAGG + Intergenic
1123199502 14:106648946-106648968 CAAGGGAGGGACCAGGTGAGAGG + Intergenic
1124245179 15:28063698-28063720 CAATAGAACAAACAGGTGAGAGG - Intronic
1125303521 15:38283315-38283337 CAAGGGAGGAACCAGGTGGGAGG - Intronic
1125399475 15:39285148-39285170 CAAGTGTTGATATAGCTGAGTGG + Intergenic
1129050607 15:72778681-72778703 CAGGTGATGAAACAGAAGGGAGG - Intronic
1129060840 15:72859288-72859310 CAAGTGAGGCAACAGGGGAAGGG - Intergenic
1132576250 16:665787-665809 CAGGTGCTGAACCAGGTGTGTGG + Exonic
1133678605 16:8099202-8099224 CTAGTAATGAAAAATGTGAGAGG + Intergenic
1135207346 16:20494403-20494425 CCAATGATGAAATAGGAGAGTGG + Intergenic
1135211539 16:20529229-20529251 CCAATGATGAAATAGGAGAGTGG - Intergenic
1135658276 16:24270852-24270874 CAAAATATGAAGCAGGTGAGAGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138645872 16:58424460-58424482 CAAGTGAAGAAACAGGCGGAGGG - Intergenic
1138967690 16:62105572-62105594 CAAGTGAGGAGACTGGAGAGTGG - Intergenic
1139054355 16:63163928-63163950 AAAGTTATAAAACATGTGAGTGG - Intergenic
1140178343 16:72688460-72688482 CAAATGATGAATCAGTTTAGAGG - Intergenic
1143261920 17:5605898-5605920 CAAGTACTGAATCAGGTAAGGGG + Intronic
1146486800 17:33249578-33249600 CAAGTGAATAAACACGTCAGTGG + Intronic
1148292155 17:46462635-46462657 CAAGTGATGATACAGATCAGAGG + Intergenic
1148314343 17:46680331-46680353 CAAGTGATGATACAGATCAGAGG + Intronic
1148454575 17:47804140-47804162 AGAGTGCTGAACCAGGTGAGAGG - Intergenic
1148901800 17:50884160-50884182 CTAGGGATGAATGAGGTGAGAGG - Intergenic
1150270464 17:63861132-63861154 CAAGTGGGGAACCAGATGAGGGG + Intergenic
1150961857 17:69922437-69922459 AAGGTGATTATACAGGTGAGTGG - Intergenic
1151298561 17:73204326-73204348 CAAGTGAGGAAACCACTGAGCGG - Intronic
1155209018 18:23585433-23585455 GAAGTGGTGAATCAGGGGAGAGG - Intronic
1155697600 18:28701399-28701421 GATCTGATGAAAAAGGTGAGAGG + Intergenic
1156129920 18:33959664-33959686 CAAATAATGAAGCAAGTGAGAGG + Intronic
1156942860 18:42791527-42791549 AAAATAATGAAACAGGTCAGCGG - Intronic
1158105108 18:53876538-53876560 CACGTGATTAAACCAGTGAGAGG + Intergenic
1158131285 18:54155350-54155372 CCAGTGATTTATCAGGTGAGAGG + Intronic
1158830761 18:61275537-61275559 CAATTGTTGAAACAGCTGAGTGG + Intergenic
1159185563 18:64967814-64967836 CAAGGGAGGAATCTGGTGAGTGG - Intergenic
1159820100 18:73130793-73130815 CAACTAGTGAAACAGGAGAGTGG - Intergenic
1162526781 19:11210849-11210871 CAGGTGAGGAGACAGGTGAAGGG - Intronic
1162526796 19:11210925-11210947 CATGTGAGGACACAGGTGACAGG - Intronic
1162526801 19:11210953-11210975 CAGGTGAGGACACAAGTGAGGGG - Intronic
1163691221 19:18739516-18739538 CAAGTGAACAAAGATGTGAGGGG - Intronic
1163921987 19:20297950-20297972 CAACAGATGACACAGGTAAGAGG + Intergenic
1164000986 19:21098928-21098950 CAACAGATGACACAGATGAGAGG + Intronic
1164058015 19:21639022-21639044 CAACAGATGACACAGATGAGAGG + Intergenic
1164735158 19:30535949-30535971 CAGGTGAGGCACCAGGTGAGGGG - Intronic
1166594730 19:44035357-44035379 CAAGTGAAGAAAAGGGTGACTGG + Intergenic
1168471750 19:56645822-56645844 ACAGTGATGAGAAAGGTGAGAGG + Exonic
925160815 2:1682100-1682122 AAAGTGAGCAAACAGGAGAGGGG + Intronic
926530688 2:14040970-14040992 TCAGGGATGGAACAGGTGAGTGG + Intergenic
926960628 2:18354844-18354866 CAAGTGAAGACACAGAGGAGAGG - Intronic
927645940 2:24877060-24877082 CAAGTGATGGAGCAGATGGGAGG - Intronic
927969441 2:27295826-27295848 CAAGTGAGGAAAGAGGTGTTGGG - Intronic
928512702 2:32016351-32016373 CAAAAGATGAAACTGGTGAGTGG - Intronic
928813433 2:35257792-35257814 CAAATCATTAAACAGTTGAGAGG + Intergenic
929969859 2:46564781-46564803 CAAGTGTTGAAAAGGGTGAGAGG + Intronic
931152586 2:59591131-59591153 CAAGTGAGGAAACTGGTCAAGGG - Intergenic
931525092 2:63144642-63144664 AAAGTGATGCAACAAGTGAAGGG - Intronic
931585645 2:63824076-63824098 CAAGGGAGGGAACTGGTGAGAGG + Intronic
936032090 2:109080463-109080485 CAACTGAAGAAACTGGAGAGTGG + Intergenic
937422483 2:121769784-121769806 AAAGAGATTAAACAGGTAAGAGG + Intergenic
939396424 2:141636463-141636485 CAAATGTTGAAACTGGTGATTGG + Intronic
939564230 2:143767644-143767666 CAATTGAGGAAACAGGTGAGAGG - Intronic
940892177 2:159045739-159045761 CAACTGGTTAAACAGGTCAGTGG - Intronic
941042645 2:160640427-160640449 AAAGTGATGAAAAAGGAGACTGG - Intergenic
941287043 2:163627686-163627708 CAAGTGATGAAACTGGTAACGGG - Intronic
942550187 2:177107678-177107700 GGAGTGCTGAAACAAGTGAGGGG - Intergenic
942793612 2:179790665-179790687 TAGGTGGTGGAACAGGTGAGTGG - Intronic
944149861 2:196546292-196546314 CAAGTGATGACAAAGGTTTGGGG - Intronic
944624485 2:201557336-201557358 CAAATGATGATACAGCAGAGGGG + Intronic
945475062 2:210272355-210272377 CAAGGGAGGGACCAGGTGAGAGG - Intergenic
945991112 2:216396080-216396102 CAAGTGTTGAAGGAGGCGAGGGG + Intergenic
946788877 2:223278293-223278315 AAAGTGAAAAAACAGGTAAGAGG - Intergenic
947798864 2:232914438-232914460 AAAGTGCTGAGACAGGTGTGAGG - Intronic
947862096 2:233367788-233367810 CAAGCGATGACACAGCAGAGGGG - Intronic
948800926 2:240433236-240433258 CAAGTGAGGAAACACCTGAGAGG - Intergenic
1169587910 20:7107222-7107244 CATGTGATGGAAGGGGTGAGGGG - Intergenic
1169726703 20:8741559-8741581 GAAGTAAAGAAAGAGGTGAGAGG + Exonic
1170333590 20:15243375-15243397 CAAGTGATGAAAAGGGTAATAGG + Intronic
1170340768 20:15324620-15324642 AATGTGATGACACAGGTTAGAGG - Intronic
1171858815 20:30376441-30376463 GAAATCATTAAACAGGTGAGAGG - Intergenic
1172082437 20:32352725-32352747 CAAGTGATGAGAGCGGTGAATGG - Intergenic
1172223987 20:33291974-33291996 CTAGTGAAAAACCAGGTGAGTGG + Exonic
1172497565 20:35399421-35399443 CAGGTGTTGAAACTGTTGAGTGG - Intronic
1172601664 20:36188121-36188143 CAAATGATCAAACAAGTGAGTGG + Intronic
1174022926 20:47546039-47546061 CAAGTGAGGAAACAAAAGAGAGG - Intronic
1174913974 20:54636032-54636054 CAAGTGGTGAAAGAGCAGAGAGG + Intronic
1176873970 21:14107655-14107677 CAAGGGAGGAACCTGGTGAGAGG - Intergenic
1179373646 21:40829573-40829595 CACCTGGTGAAACAGGTCAGAGG + Intronic
1181037647 22:20177682-20177704 CAAGTCACGAAACAGCTCAGAGG + Intergenic
1181788020 22:25241645-25241667 CAAGTGATGAAGCAGCTGGCTGG + Intergenic
1181819764 22:25466660-25466682 CAAGTGATGAAGCAGCTGGCTGG + Intergenic
1183239127 22:36642933-36642955 CAAGCCATGAAACAGTTGTGTGG + Intronic
1183816651 22:40307455-40307477 AAAATGATGAAACAGGGGAGGGG - Intronic
1184294461 22:43515034-43515056 CAAGTGGGGAAACTGGGGAGGGG + Intergenic
1184770369 22:46593608-46593630 CAAATGATGAAAAAGGGAAGAGG - Intronic
1184832680 22:46999605-46999627 CAAGTGATGAAACAGGTGAGGGG - Intronic
949863673 3:8529468-8529490 CAAGTGAAGACACAGGCGACTGG - Intronic
952915923 3:38241631-38241653 CAAATGATAAAGCAGATGAGGGG + Intronic
954213717 3:49112481-49112503 CTAGAGGTGCAACAGGTGAGTGG - Exonic
955294825 3:57725350-57725372 CAAGTGCTGAAACAGGTGGTTGG - Intergenic
956738624 3:72258218-72258240 CAAATGAGGAAACAGGCCAGTGG - Intergenic
957200408 3:77127325-77127347 CAAATGCTGAGACAGGAGAGAGG - Intronic
957325679 3:78690714-78690736 CAAGTGATTAATTAGATGAGTGG + Intronic
958685511 3:97387669-97387691 CAAGTGTTGGAACAGTTTAGAGG - Intronic
959711955 3:109394424-109394446 CAAGGAAGGAAACAGGTGAGAGG - Intergenic
960466632 3:118003823-118003845 CAAATGGTGACACAGGTGAGTGG - Intergenic
960987258 3:123289025-123289047 CAAGTTATGAAATGGGTCAGTGG - Intronic
960995184 3:123335930-123335952 CAAGAGATGGAACAAATGAGAGG + Intronic
961223778 3:125220718-125220740 CCAGTGGTGAAAGAGGAGAGAGG + Intergenic
962894159 3:139698903-139698925 CAAGAGAGGAAACAAGAGAGTGG - Intergenic
964005871 3:151827969-151827991 CAGGTGATGACATAGGTCAGGGG - Exonic
964526940 3:157625084-157625106 CATGTGATGACAGAGGTGATTGG + Intronic
967020635 3:185519323-185519345 GAAGTGATGAAAGAGTAGAGCGG + Intronic
968818832 4:2835275-2835297 CAAGTGATGAGGCTGGTTAGCGG + Exonic
968872070 4:3247238-3247260 GAGGTGAGGAAACAGGTTAGTGG + Intronic
968880075 4:3294039-3294061 CAAGTGACCAAGCAGGTGAGAGG - Intronic
969345651 4:6568275-6568297 CCAGTGATGAATCTGGTGGGCGG - Intergenic
970049623 4:11898535-11898557 CAAGGGAGGAACCAGGTGGGAGG + Intergenic
970199091 4:13583898-13583920 AAAGTGAACAAACAAGTGAGGGG + Intronic
970370266 4:15398926-15398948 CAAGGGAAGAATCAGGGGAGAGG - Intronic
971583577 4:28375636-28375658 CAAGTGATGAAAAAAATGGGAGG - Intronic
971664882 4:29470360-29470382 CCAGTGCTGAGAGAGGTGAGGGG - Intergenic
972462820 4:39321561-39321583 CAAATGAGGAAACAGATGAAAGG + Intronic
973833113 4:54781683-54781705 AAAGTGATGAAAAAGGTGTTCGG + Intergenic
974943748 4:68501439-68501461 CAAGAGAACAAGCAGGTGAGGGG - Intergenic
978467103 4:109019676-109019698 CAAGGGAGGGACCAGGTGAGAGG - Intronic
980203825 4:129691826-129691848 CAAGGGAGGAACCTGGTGAGAGG - Intergenic
983270180 4:165551899-165551921 CATGTGGTAAAAGAGGTGAGGGG + Intergenic
984325693 4:178247698-178247720 CAATCTCTGAAACAGGTGAGAGG - Intergenic
987516567 5:18917953-18917975 CAAGGGAGGAAACTGGTCAGAGG + Intergenic
988024025 5:25660547-25660569 CAAGTGAATAAACAACTGAGAGG + Intergenic
988986201 5:36621332-36621354 GAAGTGTGGAAACAGGTGAGAGG + Intronic
992560458 5:77947415-77947437 CCAGTGATGGAGCAGGAGAGAGG + Intergenic
992616834 5:78553261-78553283 CAAGGGATGAAAGAGGGGAATGG - Intronic
993178758 5:84521163-84521185 CACTAGATGATACAGGTGAGGGG - Intergenic
994359934 5:98839391-98839413 CAAGTGAATACACAGGTGAAAGG + Intergenic
995379022 5:111512103-111512125 CAAGTACTTAAATAGGTGAGCGG + Intronic
995826443 5:116305006-116305028 CAACTGGTGAGGCAGGTGAGTGG - Intronic
996679804 5:126219812-126219834 GAAGTGGTGAGAGAGGTGAGTGG - Intergenic
997843308 5:137262418-137262440 CAAGTGTTTATACAGGTGACAGG - Intronic
997848368 5:137308655-137308677 CAGGAGATGAAAGAGCTGAGAGG - Intronic
999652521 5:153781421-153781443 CAAGTGAAGATACAGGAGTGGGG - Intronic
999893423 5:156003270-156003292 TAAGTGATGAACCAGTAGAGAGG - Intronic
1000014257 5:157263903-157263925 CAGGTGAGGAAACAGGGGTGAGG + Intergenic
1000284537 5:159815727-159815749 CAAGTGATGACACAGTTAAAAGG + Intergenic
1006411699 6:33877689-33877711 CAAGTGCTGAAAGTGGGGAGTGG + Intergenic
1006768050 6:36526429-36526451 AAAGTGATCAAAAAGGTGACTGG + Intronic
1007973692 6:46078529-46078551 TAAGAGATGAAACAGAGGAGTGG - Intronic
1008085190 6:47236930-47236952 GAATTTAGGAAACAGGTGAGTGG - Intronic
1009742931 6:67771012-67771034 CTAGAGATGAAACAGGGAAGGGG - Intergenic
1009815951 6:68735364-68735386 AAAGTGATGATACAATTGAGAGG + Intronic
1009844423 6:69118133-69118155 CAAGTGATGAAACTGGGAACCGG - Intronic
1012538880 6:100336453-100336475 CCAAAGAGGAAACAGGTGAGAGG - Intergenic
1013790227 6:113828053-113828075 CAAGGGATGGAACAGGTGGGAGG - Intergenic
1014090826 6:117401965-117401987 CATGTGGTGACCCAGGTGAGAGG - Intronic
1014263169 6:119243790-119243812 CAGGAAATAAAACAGGTGAGGGG + Intronic
1015112432 6:129608919-129608941 TAATTGATGAAATAGGTGAAGGG + Intronic
1015342371 6:132115946-132115968 CAGGTGATGCAGCTGGTGAGAGG + Intergenic
1015351073 6:132220587-132220609 CAAATGGTATAACAGGTGAGGGG - Intergenic
1017568527 6:155715120-155715142 ATAGTAATAAAACAGGTGAGAGG - Intergenic
1017825225 6:158076768-158076790 CCTTTGATAAAACAGGTGAGGGG + Exonic
1017937274 6:159016831-159016853 CATGTGGTGGAAGAGGTGAGGGG + Intergenic
1021858852 7:24885354-24885376 GAACTCATAAAACAGGTGAGTGG - Intronic
1023268983 7:38438980-38439002 CAAGGGAGGAACCTGGTGAGAGG + Intronic
1024195983 7:47059396-47059418 CAAGTGATTGAACAGTTGATCGG - Intergenic
1025774113 7:64543661-64543683 CAACAGATGACACAGATGAGAGG - Intronic
1025962644 7:66237135-66237157 TAAGTGATGGAGCAGGTGGGAGG - Intronic
1026898369 7:74023445-74023467 CAAGTGCTCAAACATGGGAGGGG - Intergenic
1028536696 7:91896130-91896152 CAAGTGATGGAGAAGGTGGGAGG + Intergenic
1032518238 7:132522800-132522822 CCAGTGATGACTCTGGTGAGTGG - Intronic
1033614376 7:142998416-142998438 CAAGTGATATAACAGGTCAATGG + Intergenic
1034017230 7:147600162-147600184 CAAGTTATGAGACAGATCAGTGG - Intronic
1034481885 7:151328072-151328094 CATGTGATGGAAGGGGTGAGAGG - Intergenic
1035923230 8:3700965-3700987 GACATGATGATACAGGTGAGGGG + Intronic
1037323209 8:17663533-17663555 CAAGTGATGTAGCAGCTGAGTGG - Intronic
1039358791 8:36851262-36851284 CAAGGGAGGAACCTGGTGAGAGG + Intronic
1042493961 8:69435341-69435363 CAAGGGAGGAAACTGGTGGGAGG - Intergenic
1043780478 8:84327702-84327724 CAATTGATGAGACAGATGAGGGG - Intronic
1045206418 8:100045802-100045824 CAGGTGATGAAACAAGTGAAAGG - Intronic
1045871585 8:106933847-106933869 CCAGTGATGCGAGAGGTGAGAGG + Intergenic
1048662567 8:136621965-136621987 GATGTGATTAAACAGGAGAGTGG + Intergenic
1048697641 8:137046325-137046347 CAAGGGATGGACCTGGTGAGAGG - Intergenic
1048977523 8:139681324-139681346 CAAGTGAAGAAACAGCAGAGTGG + Intronic
1050087269 9:1979027-1979049 CAAGTGATGAAAGAGGAGTGAGG + Intergenic
1050242463 9:3651461-3651483 CAAGGGAGGGAACAGGTGGGAGG + Intergenic
1050312438 9:4367212-4367234 CAACTGATGAAGCTGGAGAGTGG - Intergenic
1051618004 9:19024726-19024748 CAAGTGATGTAGGATGTGAGGGG - Intronic
1052175882 9:25462798-25462820 CAAGGGAGGAACCTGGTGAGAGG - Intergenic
1055174186 9:73297916-73297938 AAATTGATGAAACAAGTAAGTGG + Intergenic
1055717184 9:79130988-79131010 CAAGTGATGAAACTGGTCTAGGG - Intergenic
1055782163 9:79831745-79831767 CAAGAGAGGAAACAAGAGAGGGG + Intergenic
1055816837 9:80216773-80216795 CAACTGATTCAACAGGTAAGTGG + Intergenic
1056202262 9:84288256-84288278 CAAGGGAAGAAACAGGGCAGGGG + Intronic
1057404220 9:94753486-94753508 TAAGTTATGAAACAGTGGAGGGG + Intronic
1058391176 9:104497111-104497133 CCAGTGATGAACAAGGAGAGAGG + Intergenic
1059698994 9:116757113-116757135 CTAGTGAGGAAACAGATAAGAGG + Intronic
1059702027 9:116784627-116784649 CAAGTGTTAAAAGAGGAGAGAGG + Intronic
1060272492 9:122156106-122156128 TCAGTGAAGAAGCAGGTGAGGGG - Intronic
1061519622 9:131110408-131110430 CAGGTGAGGAAACAGGTGAGAGG + Intronic
1061844442 9:133379108-133379130 CATGTGATAAAGCAGGTAAGAGG + Exonic
1062025340 9:134337706-134337728 AAAGTGAAGACACAGGTGTGAGG - Intronic
1062706957 9:137951007-137951029 CAAGTGCTTGAGCAGGTGAGAGG + Intronic
1188580473 X:31705797-31705819 GAATAGATGAAATAGGTGAGAGG + Intronic
1188774092 X:34190883-34190905 CATGGGAGGAAACTGGTGAGAGG - Intergenic
1189711186 X:43814028-43814050 GAAGAGATGAAAGAGGTGAGGGG + Intronic
1189745033 X:44160171-44160193 GAAGTGATGAAACTGGGGAGGGG + Intronic
1194435197 X:93860784-93860806 CAAGGGAGGAATCAGGTGGGAGG + Intergenic
1195220849 X:102744846-102744868 CAAGGGTTGAAGGAGGTGAGGGG - Intronic
1199835048 X:151581736-151581758 AAAATGATGAAAAAGGAGAGAGG + Intronic
1199837322 X:151604720-151604742 CAAGTGACGCTACAGGTAAGAGG + Exonic
1201471501 Y:14340404-14340426 CAAGTTTTGAAACATGTGGGGGG - Intergenic