ID: 1184835632

View in Genome Browser
Species Human (GRCh38)
Location 22:47019423-47019445
Sequence ACAGAAACTACAGCCAGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184835632_1184835633 -6 Left 1184835632 22:47019423-47019445 CCGTCACTGGCTGTAGTTTCTGT 0: 1
1: 0
2: 0
3: 23
4: 243
Right 1184835633 22:47019440-47019462 TTCTGTGACAGCGAGCGTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184835632 Original CRISPR ACAGAAACTACAGCCAGTGA CGG (reversed) Intronic
905644787 1:39617503-39617525 ACAGAAACTTCAGGGAGGGAGGG - Intergenic
906422549 1:45682967-45682989 ACAGCAACTACAGCCACTTAGGG + Intronic
906788590 1:48638495-48638517 GAACAAACTATAGCCAGTGATGG + Intronic
907393191 1:54171988-54172010 ACAGAACCTACACGGAGTGAGGG + Intronic
908275595 1:62467541-62467563 ACAGAAACTAAAGCAAGTGGTGG + Intronic
910123224 1:83813261-83813283 ACTGGAAATACTGCCAGTGAAGG + Intergenic
911599111 1:99828847-99828869 ACAGAAAATACAGCTACTGTTGG + Intergenic
912414897 1:109501413-109501435 GCAGAAATTACCTCCAGTGAGGG + Intronic
912701819 1:111883619-111883641 ACAGACACTACACTGAGTGACGG + Intronic
913264252 1:117028682-117028704 ACAGACACTAAAGGCAGAGAGGG + Intronic
913542814 1:119838179-119838201 ACAGAAACAGCAGCCATTCATGG + Intergenic
914921242 1:151848732-151848754 CCAGTCACTACAGCCAGTGCGGG + Intronic
915263949 1:154701352-154701374 AAAGCAACAACAGCAAGTGAGGG + Exonic
916388243 1:164301614-164301636 TCAGAAACAACTGCCAGTGGAGG + Intergenic
916798870 1:168195299-168195321 ACAGAAAGAACAGCTAGAGATGG - Intronic
918605949 1:186426130-186426152 ACAGGAAATACAGACAGTGGTGG - Intergenic
924178477 1:241417443-241417465 ACAGAGACACCAGCCTGTGAAGG - Intergenic
924368653 1:243323186-243323208 ACAGTACCTACAACCACTGAAGG - Intronic
1062986711 10:1775876-1775898 ACAGAAATAATAGCCAGAGATGG - Intergenic
1065964191 10:30757554-30757576 CCAGACATTACAGCCAGGGATGG + Intergenic
1068103444 10:52584175-52584197 ACAGAATCTACTGCTGGTGAAGG + Intergenic
1068578382 10:58710169-58710191 GAAGAAACTAAAGCCAGTAAAGG + Intronic
1068848357 10:61706814-61706836 ACAGAAACTATAACCTGTGAAGG - Intronic
1069888217 10:71637210-71637232 ACAGAAAGTACAGCCGAGGAAGG + Intronic
1070527946 10:77311323-77311345 AGAGAAACCACAGCCAGTTGGGG + Intronic
1071816574 10:89238431-89238453 ACTGAAACTAAAGCAAATGATGG + Intronic
1074280790 10:112049604-112049626 ATGGAAACAACAGCCAGAGAAGG + Intergenic
1074401562 10:113145170-113145192 ACAGAAACTATACCCAGGGTTGG - Intronic
1075115222 10:119620433-119620455 ACAGAGCCTACTGCCAGGGAGGG - Intergenic
1075270339 10:121043891-121043913 AAATAAACTAAAGCCTGTGAAGG + Intergenic
1075852867 10:125603219-125603241 CCAGAAACTACAGGAAGGGATGG + Intronic
1076625138 10:131817050-131817072 CCAGAAACTGCAGCCCCTGAAGG + Intergenic
1076907805 10:133372320-133372342 TCAGATACTAGAGCCGGTGATGG + Intronic
1077394483 11:2314469-2314491 ACAGAAACTACAGGAACAGAAGG - Exonic
1077446194 11:2592060-2592082 ACAGAAAGCACAGCCAGACAAGG - Intronic
1080586529 11:33687928-33687950 GGAGACACTACAGCCATTGAAGG - Intergenic
1080965410 11:37209168-37209190 AAAGAAACTACATCAAGTAATGG - Intergenic
1081413424 11:42786005-42786027 ACAGAAACTTCAGCAAGTTTGGG - Intergenic
1081982869 11:47280465-47280487 ACTGAAAACACAGCAAGTGAAGG - Intronic
1082924082 11:58527589-58527611 ACTGATACAACGGCCAGTGATGG + Exonic
1083248731 11:61450922-61450944 ATACAAAGGACAGCCAGTGATGG - Intronic
1083823877 11:65187469-65187491 ACATGAACTACAGTCAGTCAGGG - Intronic
1084561952 11:69910298-69910320 ATAGAAATTAAAGCCAGAGAGGG - Intergenic
1087720608 11:101660943-101660965 AAAGAAACTTCAGCCAGGCACGG - Intronic
1088886975 11:114015399-114015421 ACAGAAGCTGCAGGCAGTGCAGG - Intergenic
1089334103 11:117710943-117710965 TCACAAACTATATCCAGTGAGGG + Intronic
1089346040 11:117792452-117792474 ACAGGCACTACAGTCACTGAGGG - Intronic
1090374506 11:126279516-126279538 AGAGGAACTAGAGCCACTGAGGG + Intergenic
1090945980 11:131430130-131430152 ACAGAGACTATAGCCAGGAAGGG + Intronic
1091234472 11:134011576-134011598 ACTGAAGCTGCAGTCAGTGAAGG + Intergenic
1091543203 12:1481635-1481657 AAAGCAACTCCAGCTAGTGAAGG + Intronic
1093372637 12:18383361-18383383 ACAGATACTATAGCCATTGTAGG + Intronic
1093529950 12:20148887-20148909 ACAGAAACTAAAGCAAATGGTGG - Intergenic
1095122581 12:38437023-38437045 ACATCAACACCAGCCAGTGAAGG - Intergenic
1095286223 12:40413934-40413956 TCAGAAACTAGAGCCAATGAAGG + Intronic
1096414163 12:51399037-51399059 ACAGAAACTTCAGCCAGGTGTGG - Intronic
1097144161 12:56928509-56928531 CCATAAGCTACAGGCAGTGAAGG + Intronic
1097668377 12:62507607-62507629 AAAGAAAATACAGCCAGGCATGG - Intronic
1097715773 12:62964414-62964436 AAAGAAACTGAAGCCAATGAGGG - Intergenic
1098676895 12:73301042-73301064 TAAGAAACTAAAGCCAGTCAGGG + Intergenic
1098976765 12:76910560-76910582 AGAGAAAGTACAGAGAGTGAAGG - Intergenic
1101182023 12:102229351-102229373 ACAGAAAATAAAGCCATCGAGGG - Intergenic
1101225494 12:102684201-102684223 ACAAAAATTACAGCCCCTGAAGG - Intergenic
1103468877 12:121164101-121164123 ACTGAAACTGCAGTCAGTCAAGG - Intronic
1107216998 13:37933749-37933771 ACAAGAACAATAGCCAGTGAAGG - Intergenic
1108208828 13:48118059-48118081 ACAGAAACTGCCCCTAGTGAAGG + Intergenic
1109660341 13:65450514-65450536 ATAGAAATTAGAGCCAGTCATGG - Intergenic
1111256876 13:85681569-85681591 ACAGATCCTTCAGTCAGTGAGGG - Intergenic
1113387774 13:109866397-109866419 ACAGAACAGACAGCCAGAGATGG + Intergenic
1113836496 13:113331449-113331471 ACAGCAAGGACAGCCAGTGCAGG + Intronic
1115834484 14:37383856-37383878 ACAGCAACAAAAGCCAGTAAAGG - Intronic
1117251120 14:53939613-53939635 ACAGAAACATCAGCAATTGATGG + Intergenic
1117257012 14:53988085-53988107 ATAGAAACTAAAGCCAGGCATGG - Intergenic
1119047857 14:71336593-71336615 ACAGAAACTACAACCTGTGCTGG + Intronic
1121296787 14:92833427-92833449 AAAGAAACTTCATCCAGTGAAGG + Intronic
1121878217 14:97474447-97474469 ACAGAAAATAAAGCCAGAAATGG - Intergenic
1122362304 14:101174671-101174693 ACAGAAACCAGAGCCTGTGGTGG - Intergenic
1123207167 14:106724757-106724779 ACAGAGACCACATCCAGTGCAGG - Intergenic
1123212192 14:106771760-106771782 ACAGAGACCACATCCAGTGCAGG - Intergenic
1123483627 15:20661603-20661625 ACAGAGATTACAGCCAGTTTTGG - Intergenic
1123724216 15:23086107-23086129 ACAGAAACAACAACCAGGAAGGG - Intergenic
1123966360 15:25463584-25463606 ACAGGAACTACAGCTAATAAAGG - Intergenic
1124402053 15:29357313-29357335 ACAGAAAGTATCCCCAGTGAAGG + Intronic
1124722062 15:32118929-32118951 ACAGAAGGAACAGCCAGTGCAGG + Intronic
1124925360 15:34065221-34065243 AGAAAATCTTCAGCCAGTGAAGG - Exonic
1127170118 15:56292484-56292506 ATAGCAACTACAGCCTGGGAAGG + Intronic
1128239158 15:66089204-66089226 GCAGAAGCTACAGCTGGTGATGG + Intronic
1131497204 15:92922896-92922918 ACAGAAACCACAGAGACTGAGGG - Intronic
1132133144 15:99303910-99303932 ACATAAATTACATCCAGTGGGGG - Intronic
1133600474 16:7335371-7335393 AGAGAAATTACTCCCAGTGATGG - Intronic
1136501797 16:30674432-30674454 TCAGAAACTGCATCAAGTGAGGG - Intergenic
1136998150 16:35205421-35205443 ACAGAGACCAGAGCCAGTGCGGG + Intergenic
1137540064 16:49355961-49355983 ACAGATGCCACAGCCAGTGGAGG + Intergenic
1137547229 16:49412799-49412821 AAGTAAAATACAGCCAGTGAGGG + Intergenic
1139254321 16:65526825-65526847 CCACACATTACAGCCAGTGAAGG - Intergenic
1140193839 16:72840376-72840398 ACAAGAACGACAGCCAGGGAAGG + Intronic
1140286550 16:73607914-73607936 ACAAAAAATTCAGCCAGTCATGG + Intergenic
1141663787 16:85455430-85455452 AAAGAAACTCCACCCAGTGTAGG + Intergenic
1142875973 17:2852543-2852565 ACAGAAAATCCAGGCAGGGAGGG - Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1144122588 17:12169795-12169817 ACTGAACCTAAAGCAAGTGAAGG - Intergenic
1144466078 17:15498821-15498843 ACAGACTCTAGAGCCAGTGATGG - Intronic
1144703687 17:17353994-17354016 ACAGAAACCCCAGCTGGTGAGGG + Intergenic
1146086056 17:29830752-29830774 AGAGTAAATACAGTCAGTGAAGG + Intronic
1149121768 17:53176906-53176928 ACTGAAACTAAAGCAAATGATGG + Intergenic
1152058363 17:78050233-78050255 TCTGGAACTACAGCAAGTGAAGG + Exonic
1155905346 18:31444001-31444023 AAACAAACTAAAGCCAGTGAAGG + Intergenic
1156620719 18:38848252-38848274 ACAGAAACAACAGAAAGTCATGG + Intergenic
1159627034 18:70707228-70707250 ACAAAAACTATTGCTAGTGATGG + Intergenic
1159714188 18:71800797-71800819 AAAGAAACTAAAGACAGTCATGG + Intergenic
1162614356 19:11785426-11785448 CCAGAATTTACAGCAAGTGATGG + Intergenic
1166816689 19:45550588-45550610 AGAGATGCCACAGCCAGTGAGGG - Intronic
1168445399 19:56407342-56407364 ACAGACACTAAACCCAGAGAAGG - Intronic
925800685 2:7597375-7597397 ACAGAACCTACAGCCGAAGAGGG + Intergenic
926308723 2:11659227-11659249 CCAGGAACCACAGCCAGGGATGG - Intronic
927162734 2:20283743-20283765 ATAGAAACTACAGGCTATGAAGG + Intronic
927987739 2:27424847-27424869 ACTAAAAATACAGCCAGGGATGG + Intergenic
928110312 2:28503037-28503059 ACAGAAGCTACAGGTATTGAAGG - Intronic
928186290 2:29114409-29114431 GCAGAAACAAAATCCAGTGAGGG + Intronic
929952491 2:46425508-46425530 ACAGAAACTACTTTCAATGAAGG + Intergenic
930721016 2:54638134-54638156 ACTTAAAATACAGCTAGTGATGG - Intronic
932933150 2:76066763-76066785 ACAGAAACTTGAGCCAATGTAGG + Intergenic
933152822 2:78935407-78935429 ACTGTGACTACAGCCAGTGAGGG - Intergenic
935056120 2:99568587-99568609 ATAGTAACTAGAGCCAGTGGAGG - Intronic
938823690 2:134983514-134983536 ACAGAAAATCCAACCACTGAGGG - Intronic
940785110 2:157972462-157972484 ACAGACACAACAGCCTGTGGAGG - Intronic
941393262 2:164942737-164942759 ACAGAAGCTACAGACAGTTCGGG + Intronic
941876608 2:170439968-170439990 ACTGAAACTATAGCCAGGCATGG - Intronic
941895889 2:170628712-170628734 ACAAAACCTACAGCCACTGAAGG + Intronic
941937885 2:171000749-171000771 ACTGAAACTAAAGCAAGTGGTGG - Intronic
944296846 2:198075120-198075142 CCAGAAACAACAGTCAGTGCTGG + Intronic
944747320 2:202671434-202671456 CCAGAAACTTCAACCAGTGAAGG - Intronic
946622742 2:221576228-221576250 ACAGAAACAATAGCCAGGCATGG - Intergenic
947351429 2:229250048-229250070 ACACTAACTACAGAAAGTGAAGG + Intronic
948502454 2:238405417-238405439 AAAGAAACTCCAGCCAGGCACGG + Intergenic
1169464204 20:5823198-5823220 TGAGAAACAGCAGCCAGTGAGGG - Intronic
1170927312 20:20737215-20737237 GCACAAACTTCAGCCACTGAGGG - Intergenic
1171075936 20:22123326-22123348 ACAGTGACTATAGCCAGGGAAGG - Intergenic
1171141416 20:22747053-22747075 ACACAAACTCCAGCAAGTGGTGG + Intergenic
1172357011 20:34287274-34287296 TCAGAGACCAAAGCCAGTGATGG + Intronic
1173104598 20:40121895-40121917 GCAGAAAATACAGTCAGTGGAGG + Intergenic
1174214734 20:48907586-48907608 AAAGAAAATACAGCCAGGCATGG - Intergenic
1175874278 20:62222039-62222061 ACTGAGGCTCCAGCCAGTGAAGG - Intergenic
1176011800 20:62900863-62900885 ACAGACTCAACAGTCAGTGAAGG + Intronic
1176228556 20:64018038-64018060 ACAGAAACAAAAGCCAGGCATGG + Intronic
1178573262 21:33760883-33760905 AAATAAACTACAGTCAGAGAGGG - Intronic
1179127350 21:38602152-38602174 AAAGAAACCACAGCCAGGCATGG + Intronic
1183333731 22:37234995-37235017 ACAGAACCCACAGCCCTTGAAGG - Intronic
1184050828 22:42002999-42003021 AAAGAAACTATAGCCAGGCATGG + Intronic
1184536218 22:45088868-45088890 ACAGAAACCTCAGCCAGCTATGG - Intergenic
1184835632 22:47019423-47019445 ACAGAAACTACAGCCAGTGACGG - Intronic
1185057349 22:48587912-48587934 ACAGAAAGTTCAGCCTGGGAGGG - Intronic
1185225624 22:49650406-49650428 ACAGAAACTAAACACAGTGCTGG + Intronic
949472556 3:4412178-4412200 ACAGTGACTAAAGACAGTGAGGG + Intronic
952454102 3:33456881-33456903 ACAAAAAATTCAGCCAGTCATGG - Intergenic
952794972 3:37230943-37230965 ACAGTAGTTACAACCAGTGATGG - Intergenic
953168916 3:40489729-40489751 TGAGAAACTACAGCAAGTCATGG - Exonic
954589604 3:51771322-51771344 ACTGAAACTATATCCATTGAGGG + Intergenic
955855983 3:63274685-63274707 AGAGAAACTTCAGCAAGTAAGGG - Intronic
956572179 3:70709147-70709169 ACTGAAACTAAAGCAAATGATGG - Intergenic
957142778 3:76382717-76382739 AAAGAAAGAACAGCCAGGGAAGG + Intronic
957234647 3:77570399-77570421 ACAGAAGTTACAGCCCATGACGG - Intronic
957314029 3:78554374-78554396 ACAGAAACAACAGCAGATGAGGG + Intergenic
957710558 3:83852717-83852739 ACAGAAGCTAAGGCCAGTGGAGG - Intergenic
958907375 3:99956712-99956734 AAAGAAACTACAGCTACAGAAGG - Intronic
960785649 3:121370874-121370896 ACAGACAAAACAGCCAGTGCAGG - Intronic
961761650 3:129174197-129174219 TCAGAACAAACAGCCAGTGAAGG + Intronic
961919015 3:130406635-130406657 ACAGAAATTACTGACATTGATGG - Intronic
963226279 3:142865610-142865632 AAAGAAACAACATCCTGTGAAGG + Intronic
967190113 3:186977579-186977601 ACAGAAACTGCAGGCAGCCAAGG + Intronic
967566250 3:190976907-190976929 ACTGAAACTAAAGCAAATGATGG + Intergenic
969538669 4:7772170-7772192 ACAGAACAGGCAGCCAGTGAGGG - Intronic
969914731 4:10479203-10479225 ACAGATACTACAGACATTGAAGG - Intergenic
969915157 4:10483494-10483516 ACAGATACTACAGACATTGAAGG - Intergenic
970641836 4:18075424-18075446 ACAGAGACAACAGAAAGTGAAGG + Intergenic
971621565 4:28860611-28860633 ACTGAAACTAAAGCAAATGATGG - Intergenic
971666243 4:29489262-29489284 ACATAAACAACAACCAATGAGGG - Intergenic
973189188 4:47367837-47367859 ACAGAAACCCCAGCCAGTTTTGG + Intronic
973550070 4:52025372-52025394 ACAGAAACTAGAGGAAGTGAGGG + Intronic
974308538 4:60174081-60174103 ACAAAAACTGCAGCCATTCAGGG - Intergenic
975330563 4:73107897-73107919 ACATAAACTACAAGCAATGATGG + Intronic
975551133 4:75613763-75613785 ACAGAAAATAGAGCCAGGCACGG + Intronic
975644870 4:76536165-76536187 ACAGAAGATCCTGCCAGTGAAGG - Intronic
975798141 4:78031192-78031214 ACTTCACCTACAGCCAGTGATGG - Intergenic
977984368 4:103364255-103364277 ACTTAAACGACAGCCAGTGCAGG - Intergenic
978648557 4:110972189-110972211 ACAGAAACTACAGGCATGAAAGG - Intergenic
979099215 4:116593984-116594006 ACAGAAATTCCAGCCAGTCAAGG - Intergenic
980078185 4:128316191-128316213 ACAGAAATGACAGACACTGAAGG - Intergenic
982888324 4:160812618-160812640 AGAGAAACTACAACAAATGAAGG + Intergenic
983653689 4:170058204-170058226 ACTGAAGCTGCAGCCAGAGAGGG - Intergenic
983791716 4:171806923-171806945 ATAGAAAGAACAGCAAGTGAAGG - Intergenic
988969495 5:36452160-36452182 CCAGAAATTACAGCGAGTTAGGG - Intergenic
992233186 5:74683598-74683620 ACAGAAACTAGAGCCACTGTTGG - Intronic
993223323 5:85132491-85132513 ACAGAAATTACAGGCTGAGATGG + Intergenic
993360956 5:86975794-86975816 ATAGAAACTGAAGCCAGTGAGGG - Intergenic
994380370 5:99063742-99063764 ACAGAAACTAACTCCAGTTACGG - Intergenic
997025292 5:130053264-130053286 ACAGAAAATATAGACAATGAGGG + Intronic
997858220 5:137392147-137392169 ACAGAGAGTTGAGCCAGTGAAGG - Intronic
998583005 5:143400682-143400704 TGAGAAGCGACAGCCAGTGAGGG + Exonic
999535337 5:152510566-152510588 ACAGAAAATAAAGGTAGTGATGG - Intergenic
999562887 5:152824502-152824524 CCTGAAAATTCAGCCAGTGAAGG - Intergenic
1001779369 5:174354662-174354684 ACAGAAACTAAGGCCAGCGTGGG - Intergenic
1002537819 5:179887832-179887854 GCAGAAAGGACAGCCAGAGAAGG + Intronic
1002965717 6:1964468-1964490 AGAGAAGCTACAGCAAGTGGTGG + Intronic
1003111122 6:3252983-3253005 ACAGCAACTCCAGCCTGGGAAGG - Intronic
1007351948 6:41280544-41280566 AAAGAAGCTAAAGCCAGAGAGGG + Intronic
1007513047 6:42389374-42389396 TCAGAAACTGATGCCAGTGAAGG + Intronic
1011164457 6:84430673-84430695 ACAGCAACTACAGGCTGGGAGGG - Intergenic
1011253972 6:85402612-85402634 ACAGAAGCTAGAGCAAATGAAGG - Intergenic
1012805968 6:103893326-103893348 ACATAAACTCCAGCTGGTGAAGG + Intergenic
1013420865 6:109965589-109965611 ATTGAGACTACAGCCTGTGACGG - Intergenic
1014046917 6:116899542-116899564 ACAGAAATTACAACAAATGAAGG + Intronic
1015169749 6:130239451-130239473 AAAGAAACCTTAGCCAGTGAAGG + Intronic
1016024430 6:139271811-139271833 ACAGAAACTGAGGCCAGTGGAGG - Intronic
1016913849 6:149226240-149226262 ACAGAAAATAGCTCCAGTGAAGG + Intronic
1016978638 6:149833357-149833379 ACAGAAACTACAGGATGTGAGGG + Intronic
1018293248 6:162314890-162314912 ACAGGAACTACTGCCAAGGAAGG + Intronic
1018874036 6:167804364-167804386 ACAGTGACAACAGCCAGCGAAGG - Intergenic
1020679124 7:11215149-11215171 ACAGAAAATAAAGACAGTGCAGG + Intergenic
1020866939 7:13576742-13576764 AGAGTAGCTGCAGCCAGTGATGG - Intergenic
1023669034 7:42556682-42556704 AAAGAATGTACTGCCAGTGAAGG + Intergenic
1026015419 7:66667590-66667612 ACAGAAAGTAAAACCAGAGAGGG - Intronic
1026891831 7:73986742-73986764 ACAGAAAGTAAAACCAGAGAGGG - Intergenic
1028130993 7:87172847-87172869 ACTGAAAATACAGCTAGTGGTGG + Intronic
1028536199 7:91890595-91890617 ACAGAATCTCCAGTCAGTGATGG + Intergenic
1031677524 7:124629724-124629746 AAAGAAACTACAGCAATTAAGGG + Intergenic
1033191306 7:139283198-139283220 TCAGAAACAAGATCCAGTGAAGG - Exonic
1033267161 7:139896262-139896284 ACAGAAACTACAAGGAGCGAAGG + Intronic
1033507256 7:142017335-142017357 AAAGAAACTACAGAAAATGATGG - Intronic
1034954356 7:155325281-155325303 ACAGAAAATACAGCCCCTGGTGG - Intergenic
1035570809 8:671194-671216 ACAGACATTACAGCCAGGGCCGG - Intronic
1035570887 8:671542-671564 ACAGACATTACAGCCAGGGCCGG - Intronic
1035603452 8:912945-912967 ACAGCAACTGCAGCTACTGAGGG - Intergenic
1038240667 8:25805452-25805474 ACAAAAACTACAGACAATGAAGG - Intergenic
1038416628 8:27401196-27401218 ACAGAAAGAGCAGCCAATGAAGG + Intronic
1038456991 8:27680385-27680407 ATAGAATCAACAGACAGTGAAGG + Intergenic
1038667781 8:29555898-29555920 ACATAAAATACTGCCGGTGACGG + Intergenic
1038928580 8:32168127-32168149 AGAGCAATCACAGCCAGTGATGG + Intronic
1038937194 8:32265463-32265485 GCAGAACCTACAGACAGGGAGGG - Intronic
1040894722 8:52354244-52354266 ACACAATCTGCAGCAAGTGAGGG + Intronic
1041079512 8:54202896-54202918 ACAGGAACTAAGCCCAGTGAGGG - Intergenic
1042958519 8:74277747-74277769 ACAGAAAATACAGGCAATGCTGG + Intronic
1043007242 8:74834726-74834748 CCAGAAAGTGCAACCAGTGATGG - Intronic
1043823294 8:84894955-84894977 GGAAAAACTAAAGCCAGTGAAGG - Intronic
1044446205 8:92279820-92279842 ACAGTAACAACAGTCAGTTATGG - Intergenic
1044679259 8:94760710-94760732 TTTGACACTACAGCCAGTGAAGG + Intronic
1045560600 8:103258449-103258471 ACAGAAAACACAGCCCTTGAGGG - Intergenic
1045760922 8:105606652-105606674 ATAGAAAATACAGGCAGTAATGG - Intronic
1048447320 8:134501403-134501425 ACAGAAAATACAAGCAGTTATGG + Intronic
1049239027 8:141527487-141527509 ACAGAAACCACAGCGAGCGCAGG - Intergenic
1058972813 9:110098397-110098419 ACAAAAACTACATACTGTGATGG + Intronic
1060563568 9:124568759-124568781 ACATAAACTACCTCCTGTGAAGG + Intronic
1061826772 9:133262735-133262757 ACTGAAACTCCAGCAAGCGAAGG - Intronic
1185532136 X:830431-830453 ACAAAAATTACAGGCAGTGGCGG + Intergenic
1186068254 X:5789682-5789704 ACAAAAACAATAGCCAGTCATGG + Intergenic
1186429764 X:9495106-9495128 AGAGAAACTGCAGGCAATGAGGG - Intronic
1187915761 X:24150508-24150530 GCGGAAACTGCAGCCAGTCACGG - Intronic
1189954056 X:46260537-46260559 ACTGAAACTACAACCAGTCAGGG + Intergenic
1190092268 X:47449908-47449930 GAAGAAACTGCAGCCTGTGAGGG + Intronic
1190114075 X:47614316-47614338 ACAGCAGCTACAGCCTGAGAAGG + Intronic
1190368835 X:49722627-49722649 TAAGGAACTACAGCCACTGATGG - Intergenic
1191572199 X:62642149-62642171 ACAGAAGCGATGGCCAGTGATGG + Intergenic
1192688826 X:73337476-73337498 ACAGAAACTTCAGCCAGCTATGG + Intergenic
1194153750 X:90361400-90361422 AGGGAAACTATAGTCAGTGATGG - Intergenic
1198340419 X:135708318-135708340 CCAGAAAGTACAGCCAGTGGTGG + Intergenic
1199999829 X:153054264-153054286 ACATAAAACACTGCCAGTGAGGG - Intergenic
1200500100 Y:3938280-3938302 AGGGAAACTATAGTCAGTGATGG - Intergenic